1
Supplementary Material
Methods
Growth of cultures
In August 2003, peat was collected from McLean Bog, an ombrotrophic (rain fed) kettle
hole bog near Ithaca, NY (42o 30’N, 76o 30’W), as described previously1. Enrichment
cultures were grown in PM1 medium as described2. The final PM1 medium used to grow
culture 6A8 contained the following minerals (in mg/L) 1.5 KCl, 13.6 KH2PO4, 26.8
NH4Cl, 0.024 CoCl2x6H2O, 0.075 ZnCl2, 0.019 H3BO3, 0.024 NiCl2x6H2O, 0.024
Na2Mo4x2H2O, 1.344 FeCl2x4H2O, 0.026 MnSO4x4H2O, 1.556 MgSO4, 2.336
CaCl2x2H2O, 0.009 CuSO4x5H2O, 3.446 AlK(SO4)2x12H2O. The medium was dispensed
inside an anaerobic chamber (Coy, Ann Arbor, MI, USA) into 18 x 150 mm crimp-top
tubes, which were sealed with thick blue butyl rubber stoppers (Bellco, Vineland, NJ,
USA), and the tubes were autoclaved. The headspaces of the tubes were flushed with sterile
O2-scrubbed 70%N2/30%CO2, and sterile anaerobic additions were made to the following
final concentrations: 1.0 mM titanium (III) nitrilotriacetate3, 5 mM Homopipes (pKa=4.7 at
28 oC, filter-sterilized 0.5 M stock solution adjusted to pH 5.5), 0.5 mM coenzyme-M (2mercapthoethanesufonic acid), 0.2 mM sodium acetate, 0.2 g/L yeast extract, and a vitamin
solution4. The final liquid volumes in the tubes were ca. 5 ml, and 0.7 atm H2/CO2 was
added to the headspaces. The cultures were incubated on a gyratory shaker at 28 oC and 200
RPM.
2
For experiments on the effect of pH on culture 6A8, Homopipes was omitted and
the pH of the medium was adjusted by addition of 10 mM citrate adjusted to various pH
values. The pH of the cultures was assessed at the end of incubations. For experiments on
the effect of temperature, cultures were incubated under static conditions. Methane
production by cultures was quantified using a flame ionization gas detector as previously
described1.
Molecular and phylogenetic analyses
A MoBio Ultraclean Microbial DNA extraction kit that includes a bead-beating step was
used to extract and purify DNA from the culture. Primers 1Af(-1)
(TCYGKTTGA
TCCYGSCRGA) (a 3'-G was deleted from the original primer5 to increase range) and
1100Ar (TGGGTCTCGCTCGTT G) were used to amplify methanoarchaeal 16S rRNA
genes
and
27f
(AGAGTTTGATCMTGGCTCAG)
and
1492r
(TACGGYTACCTTGTTACGACTT) were used to amplify bacterial 16S rRNA genes. The
PCR reaction contained 1.25 units Brinkmann Taq polymerase, 1x Brinkmann Taq buffer,
0.18 µM primer, 200 µM dNTPs, and 4 µl of a 1:1 diluted DNA extract in a total volume of
55 µl. For both the bacterial and archaeal amplifications, the program consisted of 4
minutes at 95 oC, then 25 cycles of 95 oC for 1 minute, 50 oC for 1 minute, and 72 oC for
1.5 minutes, then a final elongation step at 72 oC for 10 minutes. To obtain an amplicon
containing the 16S rRNA gene, the internal transcribed spacer region (ITS, ca. 200 bases),
and
ca.
50
bases
of
the
23S
rRNA
gene,
the
primers
1AF
(TCYGKTTGATCCYGSCRGAG)5 and ArchLSU47 (CTTATCGCAGCTTRSCACG)
were used, producing an amplicon of 1730 bases. The PCR program was 4 minutes at 95 oC
3
followed by 25 cycles of 94 oC for 0.5 minutes, 53 oC for 1 minute, and 72 oC for 2
minutes, followed by a final incubation at 72 oC for 6 minutes. The PCR products were
screened on a 1% agarose gel in TBE buffer.
Ligations and transformations were performed using the Invitrogen TA Cloning kit.
Potential transformants were screened using the M13f(-20) and M13r(-27) primers using
the following amplification program: 4 minutes at 95 oC, then 35 cycles of 95 oC for 1
minute, 46 oC for 1 minute, and 72 oC for 1.5 minute, then an elongation step of 72 oC for
10 minutes. Clones with proper sized inserts were digested overnight using restriction
endonucleases HaeIII and HhaI6 (New England BioLabs). Representatives of restriction
digestion types were sent to Cornell's Bioresource Center for sequencing.
Most sequences used for phylogenetic analyses of 16S rRNA genes were either prealigned in the 2003 ARB database7 or were aligned using the ARB sequence editor, except
for AMC1, KB-1, FenH1 and K4-a2, which were added using CLUSTALX to an alignment
exported from ARB. The tree presented in Fig. 2 was produced from 956 bases (many of
the environmental sequences were <1100 bases) using the DNAML maxiumum likelihood
program with the global rearrangement option from the PHYLIP 3.62 package8. Bootstrap
values were using SEQBOOT, DNADIST using the F84 distance model, and NEIGHBOR
from PHYLIP.
Fluorescence microscopy
Acridine orange (AO) staining was performed by adding 10 µL of cell culture and 1 µl
0.01% w/v AO for each wet mount. For examination of cells by fluorescence in situ
hybridization (FISH), cells were fixed in 4% paraformaldehyde for 15-24 hours, filtered
4
onto black 0.2-µM polycarbonate membrane filters, and stored with desiccant at –20 oC.
FISH was performed as described9
with some modifications.
Hybridization buffer
contained 0% formamide and 2 µg/mL DAPI (4’, 6-diamidino-2-phenylindole) and one of
the following indocarbocyanine dye-labeled (Cy-3-labeled) probes at a final concentration
of 2 ng/µL (EUB 33810, NON EUB 338 5’Cy-3 – ACTCCTACGGGAGGCACG, ARCH
91511, MG120011, MG12006A, 5’Cy-3 – CGGACAATTCGGGGCATGCTG, or 6A8 644
5’Cy-3
–
TCTTCCGGTCCCTAGCCTGCCA
(E.
coli
numbering
644-665)).
Oligonucleotide probe 6A8 644 targeting small subunit rRNA from methanogen 6A8 was
designed using the probe design and probe match tools in ARB software7 using the August
2003 database, to which we added over 200 archaeal sequences including many from our
studies. This probe had five mismatches to Methanospirillum hungatei, the closest cultured
relative to 6A8, and of the sequences in Fig. 2, only matched KB-1 and R10 perfectly, with
a single mismatch to other members of the E2 group and two mismatches to members of
the E1 group. Quartered membrane sections were fixed to slides using tough-tag centrifuge
labels and 50 µL of hybridization buffer were added to each membrane section, which was
then covered with square 22 mm cover slips. Reactions were conducted in a high humidity
chamber at 37 oC overnight. Hybridization stringency was optimized according to Morris
et al.12 by washing at a temperature near the empirically determined disassociation
temperature for each probe. Membrane sections were washed in two 10-minute intervals in
wash solution (.2X SET 9, without formamide). Membrane sections were dried, mounted
with Citifluor and a cover slip, and viewed using a Nikon Eclipse E600 epifluorescence
microscope equipped with a Hamamatsu CCD digital camera, or using an Olympus BX61
epifluorescence microscope equipped with a Cooke SensiCam camera with a Sony Interline
5
Chip and the SlideBook Software package (Intelligent Imaging). Consistent exposure times
(3.0 seconds), histogram thresholds and contrast values were used for all cy3 images made
with the species specific probe 6A8 644, with positive controls made with the archaeal
probe ARCH 915 and with negative controls made with the NON EUB 338 probe.
Exposure times for cy3 images made with probe MG12006A8 were auto-calibrated by the
slide book software and were approximately three seconds. Exposure times for the DAPI
images were all approximately one second and were auto-calibrated by the SlideBook
software.
References
1.
Bräuer, S. L., Yavitt, J. B. & Zinder, S. H. Methanogenesis in McLean Bog, an
acidic peat bog in upstate New York: Stimulation by H2/CO2 in the presence of
rifampicin, or by low concentrations of acetate. Geomicrobiol J 21, 433-443 (2004).
2.
Bräuer, S. L., Yashiro, E., Ueno, N. G., Yavitt, J. B. & Zinder, S. H.
Characterization of acid-tolerant H2/CO2-utilizing methanogenic enrichment
cultures from an acidic peat bog in New York State. (in press).
3.
Moench, T. T. & Zeikus, J. G. An improved preparation method for a titanium(III)
media reductant. J Microbiol Methods 1, 199-202 (1983).
4.
Balch, W. E., Fox, G. E., Magrum, L. J., Woese, C. R. & Wolfe, R. S.
Methanogens: reevaluation of a unique biological group. Microbiol Rev 43, 260-296
(1979).
6
5.
Hales, B. A. et al. Isolation and identification of methanogen-specific DNA from
blanket bog peat by PCR amplification and sequence analysis. Appl Environ
Microbiol 62, 668-75 (1996).
6.
Moyer, C. L., Tiedje, J. M., Dobbs, F. C. & Karl, D. M. A computer-stimulated
restriction fragment length polymorphism analysis of bacterial small-subunit rRNA
genes: efficacy of selected tetrametric restriction enzymes for studies of microbial
diversity in nature. Appl Environ Microbiol 62., 251-257 (1996).
7.
Ludwig, W. et al. ARB: a software environment for sequence data. Nuc Acids Res
32, 1363-1371 (2004).
8.
Felsenstein, J. PHYLIP (Phylogeny Inference Package) version 3.6. Distributed by
the author. Department of Genome Sciences, University of Washington, Seattle.
(2004).
9.
DeLong, E. F., Taylor, L. T., Marsh, T. L. & Preston, C. M. Visualization and
enumeration of marine planktonic archaea and bacteria by using polyribonucleotide
probes and fluorescent in situ hybridization. Appl Environ Microbiol 65, 5554-5563
(1999).
10.
Amann, R. I. et al. Combination of 16S rRNA-targeted oligonucleotide probes with
flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol
56, 1919-25 (1990).
11.
Raskin, L., Stromley, J. M., Rittmann, B. E. & Stahl, D. A. Group specific 16S
rRNA hybridization probes to describe natural communities of methanogens. Appl
Environ Microbiol 60, 1232-1240 (1994).
7
12.
Morris, R. M. et al. SAR11 clade dominates ocean surface bacterioplankton
communities. Nature 420, 806-810 (2002).
13.
Boone, D. R. & Castenholz, R. W. Bergey's manual of systematic bacteriology. 2nd
Ed. Vol 1. The Archaea and deeply brainching and phototrophic Bacteria. (ed.
Garrity, G. M.) (Springer, New York, 2001).
14.
Basiliko, N., Yavitt, J. B., Dees, P. M. & Merkel, S. M. Methane biogeochemistry
and methanogen communities in two northern peatland ecosystems, New York
State. Geomicrobiol J 20, 563-577 (2003).
8
Supplementary Figures
Supplementary Figure 1. Phylogenetic tree for 16S rRNA gene sequences from culture
6A8, selected sequences in the Methanomicrobiales showing presently accepted families 13,
and other members of the Euryarchaeota. Sequences labelled PBC are peat bog clones,
those labelled MB were from a McLean Bog clone library14, and enrichment culture clones
are labelled ECC. The tree was constructed by the maximum likelihood method (see
methods) and nodes with bootstrap values > 80% (100 replicates) from a neighbour-joining
method are labelled.
Methanomicrobiales
Sulfolob us acidocaldariusU05018
Methanococcus maripaludisAF005049
M etha nococca les
100
MethanocaldococcusjannaschiiU67473
M etha nopyra les
Methanopyrus kandleriM59932
Methanothermus fervidus M59145
M etha noba cteria les
99
Methanob acterium b ryantiiM59124
Archa ea ogloba les
Archeoglob us fulgidusAE000965
Methanosarcina acetivoransM59137
100
M etha nosa rcina les
Methanosaeta conciliiM59146
95
Methanoculleus b ourgensisAF095269
100
Methanomicrob ium mob ileAF095269
Methanomicrob iaceae
Methanogenium cariaci M59130
Methanocorpusculaceae
Methanospirillum hungateiM60880
100
Methanocorpusculumparvum M59147 Methanospirillaceae
PBC MB-10 AY175398
100
E1
PBC MB-06 AY175393
PBC MB-16 AY175403
PBC MB-03 AY175390
0.1
R10 group,
99
ECC KB-1 1 AY780566
Fen cluster,
86
Strain6A8 DQ282124
E2
E1/E2 group
ECC K4-a2 AF524852
ECC AMC1 AJ459899
90
PBC R10 L48407
PBC FenH1 AJ548948
9
Supplementary Figure 2. Fluorescence micrographs of 6A8 stained with DAPI or with a
Cy-3-labelled 16S rRNA probe MG12006A8 (a,b) or Methanospirillum hungatei JF1 cells
stained with the DNA stain DAPI (c,e) or with a Cy-3-labelled16S rRNA probe targeting
Archaea, probe Arch 915 (d), or targeting 6A8, probe 6A8 644(f).
(a)
(b)
(c)
(d)
(e)
(f)
10
Supplementary Figure 3. Effect of temperature on methanogenesis by culture 6A8. Data
points represent the averages and error bars the standard errors for triplicate samples.
Methane Production (mmoles/L)
8
7
Day 3
6
Day 6
Day 24
5
4
3
2
1
0
0
10
20
30
40
o
Temperature ( C)
50