_________________________’s Notes
(Place name above)
Protein Synthesis & Mutations
Chapter 13
The Central Dogma of Biology:
Protein Synthesis
RNA Structure:
1. It is a nucleic acid.
2. It is made of monomers called nucleotides
3. There are two differences between a DNA & an RNA nucleotide:
- RNA has __________________________ instead of deoxyribose
- RNA has the base _______________ instead of Thymine
- it still has A, C, & G
- ____________will pair with __________ (Uracil is a pyrimidine)
Protein Synthesis
Types of RNA:
1
1. ______________________________________ (mRNA)
- carries the info from DNA to the ribosome
- contains “______________” that code for individual amino acids
2. ______________________________________ (rRNA)
- a component of the ribosome
3. ______________________________________ (tRNA)
- “Transfers” the info on the mRNA to an amino acid sequence (protein).
- contains “_________________” that complement the codons on mRNA.
Protein Synthesis
What is transcription?
_________________________________________________________________
- All forms of RNA are made using this process.
- The process is similar to replication.
Protein Synthesis
The Steps of Replication:
1. ________________________:
RNA polymerase binds to a location on the DNA called a
2
___________________
- Promoters signal the beginning of a gene.
- RNA polymerase has the ability to unzip
the DNA.
Protein Synthesis
The Steps of Replication:
2. ________________________:
RNA polymerase makes a complementary RNA strand from one of the
exposed DNA strands.
- This DNA strand is called the “__________________________.”
Protein Synthesis
The Steps of Replication:
3. ________________________:
RNA polymerase comes across a DNA
sequence called a “_________________”
3
and stops the transcription process.
Protein Synthesis
Eukaryotic mRNA Transcripts must be
edited.
1. The original mRNA contains sequences
known as introns & exons.
______________________ = sequences that do not code for anything.
______________________ = sequences that actually code for a protein.
2. The introns are cut out and the exons are spliced together.
3. A __________ sequence & a _________ sequence are added and the mRNA is ready
to go.
Protein Synthesis
The Genetic Code:
1. The sequence of the DNA bases “codes” for the individual amino acids in a protein.
2. This code is copied on to an mRNA strand.
3. The mRNA code:
- 3 mRNA bases in a row are called a ___________________ & each
codes for a particular amino acid.
4. Because there are 4 RNA bases, there are 64 different 3-base combinations.
- One combination is known as the “______________________” (AUG).
This marks the beginning of the protein.
4
- Three of them are “__________________________” (UAA, UAC,
UGA). These codons do not cods for any amino acids, thus signaling
the end of the protein.
Protein Synthesis
What is the amino acid sequence from the following mRNA sequence?
AUGGUCGAUAAACCACGCCUGUGA
_______________________________________________________
Protein Synthesis
What is Translation?
__________________________________________________________________
__________________________________________________________________
Ribosome Structure:
1. Has two subunits: small & large
2. Large subunit has two sites:
__________________ (polypeptide site)
__________________ (amino acid site)
Protein Synthesis
5
Mutations
What is a mutation?
__________________________________________________________________
- Mutations cause the amino acid sequence to be incorrect.
- An incorrect amino acid sequence usually causes the protein to be
nonfunctional or it gives the protein new functions.
- A change in amino acid sequence often causes a change in shape, thus a
change in function.
Types of Mutations
1. Gene Mutations (a.k.a. ________________________________________)
These affect a particular gene only.
A. ____________________________ – replace one base with another.
- affects only _________ amino acid in the protein.
- May not even cause a problem
(____________________________).
6
B. _________________________ – a new base is placed in the sequence;
this alters the reading frame & every amino acid after the
mutation is altered.
C. ________________________ – a base is removed & every amino acid
after this mutation is altered.
_____________ & ____________ are called ____________ mutations.
Types of Mutations
2. Chromosomal Mutations – affect whole chromosomes
A. ________________ – part of the chromosome disappears
B. ________________ – part of the chromosome is copied.
C. _________________ – the sequence of genes on the chromosome is partially
flipped.
D. _________________ – part of one chromosome is removed and placed onto a
different chromosome
E. _________________ – parts of two chromosomes are clipped off & switch
7
places.
8