Supplemental Methods, Results and Figure Legend:
Supplemental Methods:
SSCP, dHPLC Analysis and Sequencing of PIK3CA
Amplifications for dHPLC analysis of PIK3CA, exon 9 were carried out with primers X9FF and X9RR, and
primers X20F2 and X20R2 for exon 20. For PIK3CA sequence analysis, exon 9 was amplified with primers
X9F and X9RC, and exon 20 with primers X20F1 and X20R. PCRs were performed in a 50-l volume
containing 50 ng genomic DNA, 2 mM MgSO4, 140 M dNTPs, 0.3 M of each primer, and 2.5 U Platinum Hi
Fidelity DNA Taq polymerase (Invitrogen). The initial denaturing step at 94C for 2 min was followed by 35
cycles consisting of 30 sec at 94C, 30 sec at 55C, and 45 sec at 68C. The final extension step at 72C was 2
min. PCR was performed in a GeneAmp 2400 PCR System (Applied Biosystems). PCR products were purified
on a Qiagen QiaQuick column and sequenced at the Moores-UCSD Cancer Center shared sequencing resource
with internal primers X9S and X9SF and X20F and X20S for exons 9 and 20, respectively.
For SSCP analysis of the region of PIK3CA exon 20 that most frequently harbors mutations, DNA was
amplified with primers X20F2 and X20R2 using 50 ng of genomic DNA in a 50 l reaction volume containing:
1X Qiagen PCR buffer, 2.0 mM MgCl2, 50 M 4dNTP, 50 Ci α32P-dATP, 1 unit Taq DNA polymerase
(Qiagen) and 10 pmol each sense and antisense primer. Following an initial denaturation at 95oC for 3 min.,
amplification proceeded for 30 sec. each at 95oC, 58oC and 72oC for 30 cycles. The amplification products are
diluted 50-fold in 0.1% sodium dodecyl sulfate (SDS), 10 mM EDTA, diluted a further 2-fold in 2X loading
buffer (95% formamide, 20 mM EDTA and 20 mM NaOH), heat denatured, cooled and resolved on a 0.5x
MDE gel containing 5% glycerol in 0.6X TBE (54 mM Tris-borate, 1.2 mM EDTA) and resolved at 8W for 18h
at room temperature.
Denaturing high-performance liquid chromatography (dHPLC) was performed using the WAVE DNA
Fragment Analysis System (Model 3500 HT; Transgenomic), controlled by Navigator software. To enhance
heteroduplex formation, PCR products were denatured at 95C for 5 minutes, followed by gradual reannealing
to 25C at -0.1C/sec. Initially, for each PCR product, the melting behavior of the wild-type sequence was
visualized using the WAVEMAKER software (Transgenomic) algorithm. The elution for each PCR product
was performed at a temperature corresponding to 80-90% -helical fraction for each melting domain. After a
few test trials with the positive control samples for each axon, the optimal temperature for mutation detection
for 258-bp exon 9 was determined to be 59C, and 58C for 420-bp exon 20. Sample volumes of 10 l (optimal
quantity of the loaded PCR product corresponded to a peak of A260 ~4-12 mV) were loaded on a DNASep
(Transgenomic) cartridge and eluted within 4.5 min at a flow rate of 0.9 ml/min using a linear acetonitrile
gradient 48.3 – 62.3% buffer B (0.1 M triethylammonium acetate [TEAA]; 25% acetonitrile) for exon 9 PCR
products and 50.8 – 68.4% buffer B for exon 20 PCR products. Eluted DNA fragment was detected by the
system’s ultraviolet detector and observed online at 260 nm. Regeneration of the column was achieved by
washing with 100% buffer D (75% acetonitrile) for 30 sec followed by an equilibration time of 2 min. The
ability and sensitivity of this protocol is illustrated in the Supplemental Figure.
Primers: (5’  3’)
X9F
GATTGGTTCTTTCCTGTCTCTG
X9RC
CCACAAATATCAATTTACAACCATTG
X9S
TTGCTTTTTCTGTAAATCATCTGTG
X9SF
AGTTTAAAAATCATGTAAATTCTGCTT
X9FF
CCAGAGGGGAAAAATATGACA
X9RR
TGCTGAGATCAGCCAAATTC
X20F1
TCTAGTGGGGTAAAGGGAATCA
X20R
GGGGATTTTTGTTTTGTTTTG
X20F2
GACCTGAAGGTATTAACATCATTTGC
X20R2
ATTCCTATGCAATCGGTCTTG
X20F
TTGCATACATTCGAAAGACC
X20S
TTTGTTTTGTTTTGTTTTTT
Supplemental Results
No leukemia cell lines were found to have PIK3CA mutations. In primary T-ALL, a heterozygous conserved
mutation at codon 546 in exon 9 (CAG (Gln)  (C/A)AG (Gln/Lys)) and a heterozygous silent mutation at
codon 1025 in exon 20 (ACC (Thr)  AC(C/T) (Thr/Thr)) were identified. Several sequence changes outside
of the coding or splice region of exon 9 were also identified in the 46 patient samples sequenced. A T  T/G
located 105 bases 3’ of the exon 9 coding sequence was observed in 3 T-ALL cell lines and 7 primary ALL. A
CC/T located 85bp downstream of exon 9 was observed in one patient and a CC/T located 55 bp upstream
of exon 9 was observed in 4 patients. Their presence in non-coding regions suggest they are polymorphisms and
their characterization was not pursued further.
Supplemental Figure Legend
dHPLC detection of PIK3CA mutations in PIK3CA exons 9 and 20.
DNA obtained from the MCF7 breast cancer cell line was used as a positive control for mutations to
PIK3CA exon 9, and DNA from the LS174 colon cancer cell line was used as a positive control for mutations to
PIK3CA exon 20. dHPLC analysis of PIK3CA exon 9 from MCF7 DNA (panel A) and exon 20 from LS174
DNA (panel B) show distinct elution profiles versus DNA from normal cells, suggesting the presence of
mutations. The exon 20 mutation in LS174 is also easily detectable via SSCP (panel C) (lane 1) versus the
HL60 (lane 2) and primary leukemia samples (lanes 3-5) with a wild-type PIK3CA exon 20. Mutations were
confirmed by direct sequence analysis (PIK3CA exon 9 from MCF7 (G G/A mutation at bp 1633, codon 545
(panel D) and PIK3CA exon 20 from LS174 (A A/G mutation at bp 3140, codon 1047 (panel E). Sensitivity
of the dHPLC assay was determined by the sequential dilution of MCF7 DNA, which carries a PIK3CA exon 9
mutation, with DNA from a normal individual (panel F). This assay could detect a heterozygous mutation in a
DNA sample diluted 20-fold with normal DNA, representing the ability to detect a heterozygous mutation
present in a population containing as few as 5% tumor cells, or a homozygous mutation in a sample population
containing as few as 2.5% tumor cells.