Supplementary Figure Legend
Figure S1. Exogenous auxin and ethylene response of Osiaa23.
(a-c) 7 day old seedlings of wild type, heterozygous and homozygous Osiaa23 (from
left to right), with out ACC or NAA (a); with 0.1 μM NAA (b) and with 30uM ACC
(c). Root tips of the three genotypes are showed at the bottom. Bars=2cm.
Figure S2. Phenotypes and molecular characterization of Osiaa23-2.
(a) Phenotype of 7 day old wild type (WT), heterozygous and homozygous Osiaa23-2
(from left to right). Bar=2cm. (b-d) The root tips of WT (b), heterozygous (c) and
homozygous Osiaa23-2 (d) (from left to right). Bars=250μm. (e) The point mutation
in Osiaa23-2. A C-to-T base pair change happened in OsIAA23 and consequently
resulting in a change of proline (P) to leucine (L) in the conserved core sequence in
domain II. The core sequence in domain II was underlined. (f) The confirmation of
the point mutation in Osiaa23-2 using a CAPS marker. From left to right are wild type,
heterozygous and homozygous Osiaa23-2 respectively.
Figure S3. RT-PCR analysis of OsIAA23 in various tissues and expression
pattern of OsIAA23::GUS in the tissues above ground.
(a) RT-PCR analysis of OsIAA23 expression in various tissues. 1, shoot; 2, shoot base;
3, root; 4, leaf blade; 5, leaf sheath; 6, stem; 7, flower; 8, embryo. 1, 2 and 3 are from
7 day old seedlings. 4, 5, 6, 7 and 8 are from mature plants. OsIAA23 was expressed
in all the tissues examined. (b-f) GUS expression driven by promoter of OsIAA23 in
anther ,bar=1mm (b), hull vasculature, bar=2mm (c), embryo, bar=0.5mm (d), in
vasculature of leaf, bar=1mm (e) and stem, bar=1mm (f). Arrow and arrow head
indicate the root and shoot apical meristem of the developing embryo (d).
Figure S4. The expression of auxin response genes in the Osiaa23.
Four samples are wild type without IAA (white), homozygous Osiaa23 without IAA
(black), wild type with IAA (light gray) and homozygous Osiaa23 with IAA (dark
gray). Numbers at y-axis are the relative expression levels of each gene. Three genes
are OsIAA23 (a), OsIAA20 (b) and ARL1/CRL1 (c). All the three genes are induced by
IAA in the WT, while the inductions were inhibited in homozygous Osiaa23.
Figure S5. A mutant with rescue of iaa23-dependent root traits designated as
mKiaa23.
(a) The wild type (indica rice Kasalath) (WT), heterozygous iaa23 mutant (Aa),
homozygous iaa23 mutant (aa) and the mutant with rescue of iaa23-dependent root
traits (mKiaa23). (b) Root cap of the four genotypes. (c) Point mutation in domain
II (P68L) in the mKaa mutant confirmed by a CAPS marker. Forward primer:
GACGCCAAGCCGCCTTCCCCAAAGT; Reverse primer:
GATTGAGATGTGTACACGCGTTGCTTACCTC. Restrict enzyme: Hae III. (d)
Point mutation in domain IV (W167S) in the mKaa mutant confirmed by a CAPS
marker. Forward primer: CTCCGCGCGCTCCACGGCATGTTC; Reverse primer:
1
GATTGAGATGTGTACACGCGTTGCTTACCTC. Restrict enzyme: Xho I (e) The
point mutation in domain II resulting a change of C to T, and consenquently a change
of Proline (P) to Leucine (L) (P68L). The point mutation in domian IV resulting a
change of G to C, and concenquently a change of Tryptophan (W) to Serine (S)
(W167S).
Figure S6. Phenotypic traits of roots and response to exogenous auxin treatment
(NAA at 0.1 mM ) of the transgenic plants harboring iaa23 driven by promoter
of QHB.
(a) The wild type (WT) and the transgenic plants grown in a solution without NAA
(-NAA) for 7 days. (b) The wild type (WT) and the transgenic plants grown in a
solution with NAA (+NAA) for 7 days. (c) Root cap of WT and the transgenic plants
from (a).
2