This file contains supplementary methods and Figure legends for three
supplementary Figures (Fig. S1, Fig. S2, Fig. S3).
Supplementary Methods
Mice
Genotyping was performed by PCR analysis of tail DNA using the following primers:
mycS,
5`-CGGACACACAACGTCTTGGA-3´,
and
mycAS,
5`-
CTCTCACGAGAGATTCCA GC-3´.
Constructs, Transfection and Retroviral Infection
Human MCL-1 was amplified by PCR and cloned into the pMIG retroviral vector using
the
following
primers:
hMCL-1S,
CGCGGATCCACCATGTTTGGCCTCAAAAGAAACGC-3`,
and
hMCL-1AS,
5´5`-
CCGGAATTCCGGCTATCTTATTAGATATGCCAAACCA-3. The MCL-1 mutant S159A
was generated using the Quikchange Kit (Agilent) following primers: hMCl-1S, 5`ACGGACGGGGCACTACCCTCGA-3`,
and
hMCL-1AS,
5`-
TCGAGGGTAGTGCCCCGTCCGT-3. 293T cells were infected with Hit60, VsVg and
pMIG constructs using superfect (Qiagen) according to manufacturers protocol. After
16h, sodium butyrate was added (5mM) for 8h. Retrovirus-containing supernatant was
harvested after 12h and 24h, respectively. C57BL/NCrl or Eµ-myc mouse BM was
mobilized with 5-Fluoruracil (150mg/kg), isolated 3 days after injection and taken in
culture with IMDM containing IL-3 (10ng/ml), IL-6 (10ng/ml) and mSCF (50ng/ml). After
12h in culture, the BM cell culture was infected with the respective virus supernatants,
which was repeated after 10h. The infection level (GFP) of BM cells was monitored after
10h by FACS and 5x105 infected BM cells were engrafted in 6-8 weeks old irradiated
(9.5Gy) female C57BL/NCrl mice.
ADVIA hematology analyzer and Flow cytometric analysis
Peripheral blood was analyzed using the ADVIA hematology analyzer and by FACS.
Hematopoietic organs were isolated and single-cell suspensions of bone marrow, lymph
nodes, spleen and thymus prepared. Cells were counted with the Z1 Coulter Counter
and 1x106 cells stained for certain cell populations using specific monoclonal antibodies:
500A2, anti-CD3e; H129.19, anti-CD4; 53-6.7, anti-CD8a; RA3-6B2, anti-CD45R-B220
1
(Becton Dickinson); M1/70, anti-CD11b; 1B11, anti-CD43; RMM-1, anti-IgM; 11-26c.2a,
anti-IgD; D7, anti-Sca-1; RB6-8C5, anti-Gr-1 (BioLegend); 3C1, anti-c-Kit (Milteny
Biotec); hematopoietic lineage biotin panel (CD3e, CD11b, CD45R-B220, Ter-119, and
Ly6G-Gr-1) (eBioscience).
Histology
Tissues were fixed in 4% buffered formalin, decalcified in a mixture of 10 % ethylenediamine-tetraacetic acid disodium salt (EDTA, Serva, Cat. No. 11280.02) and 3.3 % tris(hydroxymethyl) aminomethane (THAM, AppliChem, Cat. No. A1086,1000) in dd H2O at
pH: 7.0 – 7.2 and paraffin embedded. Histological examination of all the specimens was
performed using hematoxylin-eosin (H&E) staining.
Proliferation using RTCA analyzing system
HeLa cells were plated (5000/ well) onto 96-well E-plates and recorded every 15 min for
49 h over time.
Western blotting
Immunoblotting was performed using antibodies raised angainst MCL-1 (S-19, sc-819,
Santa Cruz) and GFP (#2255, Cell Signaling Technology).
Real-time PCR
Relative expression of MCL-1 was determined by real-time PCR in comparison to the
L32 housekeeping gene as described before6. Primers sequences are as follows:
mL32F: TTAAGCGAAACTGGCGGAACC, mL32R: TTGTTGCTCCCATAACCGATG,
mcl-1F: AGAAAGCTGCATCCAACCAT, mcl-1R: CCAGCTCCTACTCCAGCAAC.
2
supplementary Figure legends Lindner et al.
Figure S1. Effect of S159 phosphorylation-deficient MCL-1 on neutrophil,
monocyte, eosinophil and red blood cell numbers, and on cell proliferation
(A) Analysis of MCL-1 mRNA expression by quantitative RT-PCR in BM cells either
before (left panel, freshly isolated BM or donor BM infected with empty vector pMIG,
MCL-1 or MCL-1S159A as indicated) or six weeks after adoptive transfer (right panel, bars
representing BM isolated from a representative mouse cohort expressing pMIG, MCL-1
or MCL-1S159A as indicated). Bars represent relative MCL-1 mRNA expression,
normalized to L32, error bars indicate SEM of biological replicates. (B) Neutrophil
granulocyte numbers in the peripheral blood were determined using the ADVIA
hematology analyzer 4 weeks after engraftment. Empty vector control pMIG 0.44 x
103/µl ± 0.04 (n= 29), MCL-1WT 0.72 x 103/µl ± 0.11 (n= 29) and MCL-1S159A 0.88 x 103/µl
± 0.14 (n= 30). (C) Monocyte count: pMIG 0.36 x 103/µl ± 0.12 (n= 29), MCL-1WT 0.35 x
103/µl ± 0.11 (n= 29) and MCL-1S159A 0.41 x 103/µl ± 0.1 (n= 30). (D) Platelets count:
pMIG 581.8 x 103/µl ± 71.24 (n= 29), MCL-1WT 584.8 x 103/µl ± 57.77 (n= 29) and MCL1S159A 636.3 x 103/µl ± 66.65 (n= 30). (E) Red blood cell count (RBC): pMIG 9.09 x 103/µl
± 0.1 (n= 29), MCL-1WT 9.55 x 103/µl ± 0.15 (n= 29) and MCL-1S159A 9.69 x 103/µl ± 0.13
(n= 30). (F) HeLa cell were stably infected with empty vector (blue), vectors encoding
MCL-1WT-IRES-GFP (green) or Mcl-1S159A-IRES GFP (red) and sorted for GFP,
indicating equal expression levels of MCL-1. Proliferation was monitored using the
RTCA DP Analyzer. From the data of the cell growth curves, doubling times were
calculated.
Figure S2: Cellular composition of pMIG, MCL-1WT and MCL-1S159A in BM, spleen,
lymph nodes and thymus. Flow cytometric analysis of of primary and secondary
hematopoietic organs. Total cells from mice of all three genotypes were isolated 6-8
weeks after engraftment. (A) Proportion of pro B (B220+IgM-CD43+), pre B (B220+IgMCD43-), immature (B220+IgM+CD43-) and mature (B220hiCD43-IgM+) cells among
GFP+B220+ BM cells (B) Proportion of splenic B (B220+) and T cells (CD3+) among
GFP+ splenocytes (C) Proportion of LN B (B220+) and T cells (CD3+) among GFP+ LN
lymphocytes (D) assessment of B cell maturation stages, bars represent percentage of
transitional type 1 (T1) B cells (IgM+ IgD-), transitional type 2 (T2) B cells (IgM+ IgD+) and
follicular (FO ) B cells (IgMlow IgD+) among GFP+B220+ splenocytes (E) CD4+ and CD8+
3
T cell subpopulations (DN (CD4-CD8-), DP (CD4+CD8+), CD4+CD8- and CD4-CD8+ SP
maturation stages) among thymocytes (F) CD4+ and CD8+ T cell subpopulations among
CD3+ splenocytes and (G) CD4+ and CD8+ T cell subpopulations among CD3+ LN
lymphocytes. Mouse numbers (Fi. S2A-C, E) pMIG (n= 11), MCL-1WT (n= 9) and MCL1S159A (n= 8); (Fig. S2D, F-I) pMIG (n= 26), MCL-1WT (n= 28) and MCL-1S159A (n= 28). (H)
Splenocyte total cell extracts from mice, which had received BM expressing MCL-1 or
MCL-1S159A were analyzed by western blotting using anti-MCL-1 and anti-GFP
antibodies.
Figure S3: Cooperation of S159 phosphorylation-deficient MCL-1 with Eµ-myc to
induce lymphoma. (A) BM cells from young Eµ-myc transgenic mice were infected with
pMIG, MCL-1WT or MCL-1S159A and analyzed by flow cytometry before engrafting into
recipient mice. Peripheral white blood cell count was determined using the ADVIA
hematology analyzer 4 weeks after engraftment. pMIG 7.37 x 103/µl ± 0.78 (n= 22),
MCL-1WT 11.91 x 103/µl ± 1.44 (n= 22) and MCL-1S159A 15.23 x 103/µl ± 2.04 (n= 22). (B)
Lymphocyte count: pMIG 4.59 x 103/µl ± 0.43 (n= 22), MCL-1WT 9.61 x 103/µl ± 1.39 (n=
22) and MCL-1S159A 13.08 x 103/µl ± 1.52 (n= 22). (C) Neutrophil granulocyte count:
pMIG 1.22 x 103/µl ± 0.22 (n= 22), MCL-1WT 1.93 x 103/µl ± 0.51 (n= 22) and MCL-1S159A
2.33 x 103/µl ± 0.42 (n= 22). (D) RBC: pMIG 10.83 x 103/µl ± 0.23 (n= 22), MCL-1WT
10.95 x 103/µl ± 0.14 (n= 22) and MCL-1S159A 11.24 x 103/µl ± 0.23 (n= 22). (E) Platelets
count: pMIG 772.4 x 103/µl ± 35.29 (n= 22), MCL-1WT 706.2 x 103/µl ± 46.52 (n= 22) and
MCL-1S159A 751.8 x 103/µl ± 30.98 (n= 22). (F) Percentage of GFP+ peripheral blood
cells, expressing MCL-1WT-IRES-GFP or MCL-1S159A-IRES-GFP as determined by flow
cytometry.
4