Name: ___________________________ Period:______ X-Men Genetic Mutations Suppose that the base sequence below is found in a normal, non-mutant human and is from one side of a DNA helix and codes for the formation of a protein. TACCCGGATGCTCACGGGATT 1. Decode the strand of DNA into an mRNA, in other words complete transcription. Then use the codon chart to translate it into a sequence of amino acids. You may write the first three letters of each amino acid with a dash between each. mRNA: amino acid sequence: 2. Wolverine has a mutation that allows him to heal rapidly. Create his mutation by changing the original piece of DNA above by replacing the 15th base, a C, to a T. Transcribe this new DNA into mRNA and then translate into an amino acid sequence. changed DNA: mRNA: amino acid sequence: 3. Storm has the ability to manipulate the weather. To decode her mutation, again go back to the original DNA at the top of the page and remove the 10th base, then transcribe and translate it. changed DNA: mRNA: amino acid sequence: 4. Rogue’s powers allow her to steal the powers of other mutants. Her mutation can be decoded by again going back to the original DNA at the top of the page and change the 10th base from a G to an A and then transcribe and translate it. changed DNA: mRNA: amino acid sequence: 5. Finally, the villain Magneto can use magnetic fields to control metal objects. Again go back to the original DNA at the top of the page and add an A between the 6th and 7th bases and then transcribe and translate it to decode his mutation. changed DNA: mRNA: amino acid sequence: Analysis: Answer with complete thoughts in complete sentences on the back. 1. Identify the TYPE of gene mutation that occurred in 2, 3, 4, and 5. Explain why you chose each type of gene mutation. 2. 3. 4. 5. 2. Is a point mutation always damaging? Provide evidence from this activity for your answer. 3. Is there any real difference in the effect of adding or deleting a base? Explain your answer. 4. What is the minimum number of base changes necessary to mutate a protein? Provide evidence from this activity for your answer.