Supplementary Material and References
Patients
Bone marrow (BM) samples from 259 acute myeloid leukemia (AML) patients at
diagnosis were provided by the Department of Genetics of the University of Navarra
(Spain). From the total cohort of AML cases, 112 patients received chemotherapy
according
to
the
Spanish
PETHEMA
co-operative
group
protocol
LAM/99
(ClinicalTrials.gov identifiers: NCT00464217 and NCT00390715). The median age of
this group was 57 years (range 14–83) and the male to female ratio was approximately
1:1. Of these cases, 75 were young (≤65 years old) and 37 elderly patients (>65 years
old). The protocol for young patients included one or two 3/7 courses of idarubicin and
cytosine arabinoside (ara-c); 58 patients achieved complete remission (CR).
Subsequently, patients in CR received one identical consolidation cycle, followed by
intensification therapy with one course of ara-c and mitoxantrone (36 cases at this point
of follow-up), followed by an autologous stem cell transplant (12 cases at this point of
follow-up) or by allogeneic stem cell transplant (9 cases at this point follow-up). The
protocol for elderly patients included one or two 3/7 courses of idarubicin and ara-c; 15
patients achieved complete remission (CR). Subsequently, patients who reached CR
received one identical consolidation cycle, followed by intensification therapy with one
course of ara-c and daunomycin. These samples were taken anonymously. Two
independent series of bone marrow AML samples at diagnosis with normal karyotype
were screened: 42 cases from the Hematology Unit of the Hospital la Fe, Valencia
(series 1), and 57 from the Hospital Universitario de Salamanca (series 2) (Spain).
Characteristics of patients are included in Supplementary Table 1. Informed consent
was obtained from all patients.
Cell culture
Cell lines (DSMZ, Braunschweig, Germany) were grown at 37°C in a 5% CO2
atmosphere. All cells were maintained in RPMI 1640 medium, except the OCI-AML2,
that was cultured in Alpha-MEM (Invitrogen, Carlsbad, CA, USA). Media were
supplemented with 20% fetal bovine serum, penicillin G (100 U/mL), and streptomycin
(0.1 mg/mL). We also added GM-CSF (R&D Systems Europe Ltd., Minneapolis, MN,
USA) to TF-1 (5ng/ml) and F-36P (10ng/ml) culture media.
Cytogenetics and Fluorescent in situ hybridization
Cytogenetic and fluorescent in situ hybridization (FISH) analyses were performed as
previously described.1 FISH experiments were performed with 6 bacterial artificial
chromosome (BAC) clones located on chromosome 3. Clones were designed
according to the current mapping data and were obtained from the Children’s Hospital
Oakland Research Institute (CHORI, Oakland; http://www.chori.org/bacpac/home.htm).
The order from centromere to telomere was: RP11-390G14 (3q21.3), RP11-475N22
(3q21.4; GATA2/GR6), RP11-689D3 (3q21.3; RPN1), RP11-82C9 (3q26.2; EVI1),
RP11-115B16 (3q26.2; MDS1) and RP11-196F13 (3q26.31; TNFSF10/TRAIL),
including a probe for chromosome 3 centromere.
Sample preparation
Mononuclear cells were isolated from fresh bone marrow cells from AML cases at
diagnosis and normal donors by density gradient centrifugation using Histopaque
(Sigma, St. Louis, MO, USA) following manufacturer's instructions. Then, we proceed
with DNA and RNA extraction as indicated below.
DNA extraction and detection of FLT3, NPM1 and CEBPA mutations
Genomic DNA was obtained with the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany)
from bone marrow mononuclear cells of the patients. Mutation analyses of FLT3,
NPM1 and CEBPA were performed as previously described.2-4
RNA extraction and gene expression studies
Two micrograms of total RNA isolated from bone marrow mononuclear cells of the
patients using the RNeasy Mini Kit (Qiagen, Hilden, Germany), were used for cDNA
synthesis (SuperScript™II RNase HRT; Invitrogen, Carlsbad, CA, USA) under standard
conditions. Since it has been described that the expression of the EVI1 alternative
transcript forms correlated significantly, we measured the mRNA levels of the EVI1-1D
and
EVI1-1C
transcripts.5
(Hs01118675_m1),
GATA2
Quantification
of
(Hs00231119_m1),
the
WT1
expression
of
EVI1-1C
(Hs00240913_m1)
was
performed using TaqMan Gene Expression Assays (Applied Biosystems, Foster City,
CA, USA). For quantification of the EVI1-1D transcript a custom TaqMan Gene
Expression Assay was purchased. The primer and probe sequences were as follows:
forward
primer
(5’
GCTTCTTGACTAAAGCCCTTGGA
3’);
reverse
primer
(5’
GCATCTATGCAGAACTTCACATTGT 3’); and probe (5’ TCTAAGATCATATACTTCAAGAAAA
3’). The GAPDH housekeeping gene (Hs99999905_m1) was used as internal control.
In the present study there was no significant difference (P = 0.433) in median and
range for GAPDH expression between bone marrow leukemic samples (GAPDH
median; range: 18.69; 16.47-22.84) and bone marrow samples from normal donors
(GAPDH median; range: 19.21; 17.06-22.36). The relative standard curve method was
used to measure the amount of relative EVI1-1C, EVI1-1D, GATA2, WT1 and GAPDH
cDNA in patients and normal controls. In the relative standard curve method, two fold
serial dilutions of quantified total cDNA starting from 200ng to 1ng were used to
construct the standard curve for EVI1-1C, EVI1-1D, GATA2, WT1 and GAPDH cDNA.
An eight point linear relative standard curve was generated by plotting the Ct (threshold
cycle value) of each standard against the logarithm of the quantity of total cDNA.
Amplification reactions were performed with the ABI Prism 7500 Real Time PCR
System (Applied Biosystems, Foster City, CA, USA). For each PCR run, a master mix
was prepared on ice with 2X Taqman Master Mix (Applied Biosystems, Foster City, CA,
USA), 150nM of the unlabelled primers and 250nM of the labeled probe (assay on
demand) and 20ng of cDNA in a total volume of 25µl. The thermal cycling conditions
were 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles each of 95°C for 15
seconds and 60°C for 1 minute. Each cDNA sample was tested in triplicate. Positive
and negative controls were included in all assays. The mean and the standard
deviation (SD) of the 3 Ct values were calculated for each sample. The triplicate cycle
threshold values were averaged; concentrations of the target genes were interpolated
form the standard curves and normalized to the GAPDH expression for each sample.
Since all the studied genes are normally expressed in bone marrow hematopoietic
stem cells, we decided to choose fresh bone marrow cells from normal donors as our
reference group for establishing a cut-off definition. For that reason, a gene was
considered overexpressed if its expression value was higher to the cut-off value
established for each gene (mean + 3SD), defined by the analysis of 10 bone marrow
samples from 10 normal donors used for normalization. Overexpression of EVI1 was
defined when at least the level of one of the EVI1 transcripts was higher than the cutoff value established for each transcript form.
Western blotting
Pellets from cell lines were lysed in lysis buffer (Cell Signaling, Danvers, MA, USA) with
complete protease inhibitors and 1mM NaVO4 (Sigma, St. Louis, MO, USA). Proteins
from AML sample patients were extracted using the Trizol method (Invitrogen,
Carlsbad, CA, USA) following manufacturer’s protocol. Antibodies used were goat
policlonal anti-GATA2 (R&D Systems, Minneapolis, MN, USA) and mouse monoclonal
anti-b-actin (Sigma, St. Louis, MO, USA). The secondary antibodies were goat antimouse horseradish peroxidase (Sigma, St. Louis, MO, USA) and donkey anti-goat
horseradish peroxidase (R&D Systems, Minneapolis, MN, USA). Proteins were
detected
with
Western
Lightning
Chemiluminescence
(PerkinElmer
LAS,
Massachusetts, MA, USA).
Statistical analyses
To investigate the association between GATA2 expression levels and other biological
variables, and to evaluate the clinical impact of GATA2 expression levels, we set an
optimal cut-off point (described above) for its expression level; thus, patients were
divided into cases “without GATA2 overexpression” or “with GATA2 overexpression”.
GATA2 expression as a continuous variable was also used to investigate the clinical
outcome of GATA2 expression levels in patients with AML. Statistical analyses were
performed using the software package SPSS version 15 (SPSS Inc., Chicago, IL,
USA). Associations between groups of GATA2 expression and baseline clinical and
biologic features were analyzed using the χ2 test or the Fisher's exact test, as
appropriate, for categorical variables and the Mann-Whitney test for continuous
variables. Overall survival (OS) was measured from the date of diagnosis until the date
of death from any cause, with observation censored for patients last known to be alive.
Complete remission (CR) was defined as the presence of all the following: <5% of
blasts in BM, no blasts in peripheral blood, recovery of peripheral blood values, and no
evidence of extramedullary leukemia. Disease-free survival (DFS) was measured from
the date of CR until the date of relapse or death from any cause, with observation
censored for patients last known to be alive without report of relapse. Event-free
survival (EFS) was defined as the time from diagnosis until first event, in which failure
to achieve complete remission, relapse, death, or end of follow-up were considered
events. Estimated probabilities of OS, DFS and EFS were calculated using the KaplanMeier method, and differences between survival distributions were evaluated by the
log-rank test. Proportional hazards models were constructed to determine whether the
groups of GATA2 expression were associated with outcome when adjusting for other
prognostic variables.
References
1.
Odero MD, Carlson K, Lahortiga I, Calasanz MJ, Rowley JD. Molecular cytogenetic
characterization of breakpoints in 19 patients with hematologic malignancies and 12p
unbalanced translocations. Cancer Genet Cytogenet 2003; 142: 115-119.
2.
Nakao M, Yokota S, Iwai T, Kaneko H, Horiike S, Kashima K et al. Internal tandem
duplication of the flt3 gene found in acute myeloid leukemia. Leukemia 1996; 10: 1911-1918.
3.
Dohner K, Schlenk RF, Habdank M, Scholl C, Rucker FG, Corbacioglu A et al. Mutant
nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid
leukemia and normal cytogenetics: interaction with other gene mutations. Blood 2005; 106:
3740-3746.
4.
Gombart AF, Hofmann WK, Kawano S, Takeuchi S, Krug U, Kwok SH et al. Mutations
in the gene encoding the transcription factor CCAAT/enhancer binding protein alpha in
myelodysplastic syndromes and acute myeloid leukemias. Blood 2002; 99: 1332-1340.
5.
Poppe B, Dastugue N, Vandesompele J, Cauwelier B, De Smet B, Yigit N et al. EVI1 is
consistently expressed as principal transcript in common and rare recurrent 3q26
rearrangements. Genes Chromosomes Cancer 2006; 45: 349-356.