Supplementary Methods
Southern Blotting. DNA was isolated from whole blood or tissue samples using the
Qiagen DNA Mini or QIamp DNA mini kit (Qiagen) protocols according to the
manufacturer’s instructions. DNA was digested with HindIII and then approximately
10µg of DNA was electrophoresed on a 0.8% agarose gel in 1 x TAE and blotted onto
Hybond N+ (Amersham). 32P-dCTP (Perkin Elmer) labeled probes were prepared
from KoRV pol and env gene PCR products using the Amersham Mega Prime DNA
labeling kit. Blots were pre-hybridised using hybridisation buffer (0.5M Na2HPO4,
7% SDS, 0.9M EDTA) and salmon sperm DNA and then hybridized overnight at
65°C in hybrisation buffer. Blots were then washed in 1 x SSC, 0.1% SDS, dried and
exposed in a phosphoimager plate (Kodak) and read using a SI phosphoimager
(Molecular Dynamics).
Cytogenetics/Fluoroscent in situ hybridization (FISH). Koala peripheral blood
mononucleocytes were isolated from whole blood using Ficoll-Hypaque (Amersham)
and then cultured as previously described (Hanger et al, 2000)with the modification of
18% foetal calf serum and 2% koala serum and no β-mercaptoethanol. Cells were
harvested after three days and chromosomes prepared using standard methods with 3
hours colcemid incubation. Sperm for FISH analysis were collected via epididymal
washing from post mortem obtained koala testicles, fixed in 3:1 acetic acid/methanol,
dropped onto glass slides and air dried. Viral DNA was prepared by double digestion
from a plasmid containing the full length KoRV genome (Hanger et al, 2000).
Digoxygenin labeled probe was prepared from this DNA using the Dig Nick
Translation kit (Roche) and hybridisation preformed using the DIG hybridisiation kit
(Roche). Images were collected with a Zeiss microscope fitted with the Axiophot
imaging system (Zeiss).
PCR. DNA was isolated from whole koala blood or sperm using the Qiamp DNA
mini kit (Qiagen). Real time PCR was performed as described in Tarlinton et al
(2005) 3. Additional PCR primer sets used were; Envelope gene primers Env 2:
5’ATGCTTCTCATCTCAAACCCG3’ (sense) and
5’TTCAAGTCCTCCGCACCTCC3’ (antisense) and Env3:
5’GGAGGTGCGGAGGACTTGAA3’ (sense) and
5’CGTGGTGGGAGATGGAGTAC3’ (antisense). Polymerase gene primers:
5’CCTTGGACCACCAAGAGACTTTTGA3’ (sense) and
5’TCAAATCTTGGACTGGCCGA3’(antisense) Reaction comprised the following
mixes: 2 μM primers, 1x PCR mix, 5 mM MgCl2, 0.5 mM dNTP, 5 u Taq, 1 μl DNA
and diH20 to 50 ul. Cycling was carried out on a Gene amp PCR system 2400
(Applied Biosystems): 95◦C for 2 min, followed by 30 cycles of 95◦C for 30 sec, 65◦C
for 30 sec, 72◦C for 30 sec and a final elongation step of 72◦C for 2 min. Beta actin
PCR was performed in parallel with KoRV PCR as a control for DNA quality.
Primers were 5’AGATCATTGCCCCACCT3’ (sense) and
5’TGGAAGGCCCAGATTC3’ (antisense).
Single sperm cell PCR. Koala sperm obtained by epididymal washing was diluted
approximately 100 times in sterile water (HPLC grade) in a petri dish. Using a
dissecting microscope and a narrow bore glass pipette attached to tubing and a filter,
single sperm were identified, mouth pipetted and deposited into individual 0.5 ml
PCR tubes. Sperm and negative samples were treated with Promega DNase.One µl of
lysis buffer (200 mM KOH, 50 mM DTT) was then added to each tube. Tubes were
incubated at 65oC for 10 minutes and then 1 µl of neutralization buffer (300 mM
KCL, 900 mM Tris-HCL pH 8.3, 200 mM HCl) and1µl of 30 mM mercaptoethanol
was added to each tube. Primers for Multiplex fluorescent PCR were: KoRVmgbf,
FAM- 5’ TTGGAGGAGGAATACCGATTACAC 3’ and KoRVmgbr, 5’
GCCAGTCCCATACCTGCCTT 3’ (Qiagen, Clifton Hill, Australia). PCR reactions
were as follows: 10 pmol/µl primers, 1x PCR buffer (Qiagen), 1.25 mM dNTPs
(Invitrogen) and 0.24 µl HotStart Taq (Qiagen) and HPLC grade water to 25 µl. PCR
conditions were as follows; 94oC for 10 min, followed by 44 cycles of 94oC for 40
sec, 57oC for 60 sec and 65oC for 40 sec. Samples were precipitated using ammonium
acetate/ ethanol, DNA was resuspended in 10ul water. Prior to capillary
electrophoresis 2 ul of product was added to 3 ul of loading buffer (Amersham
Biosciences). Samples were then denatured at 95C for 1 min, before loading onto a
Megabace 1000 with Genetic Profiler version 1.5 software (Amersham Biosciences)
for capillary electophoresis.