Name ____________________________________
MBMB 451A Section 1: Nucleic and Gene Expression
Fall 2007
9-20-07
1. DNA was sequenced using the combination of DNA template and primer as seen above and
the G sequencing ladder is shown in lane 1. Please complete the gel for the lanes containing
dideoxy-ATP (lane 2), dideoxy-TTP (lane 3) and dideoxy-CTP (lane 4).
*(5'`)-GGATTC
DNA primer
CCTAAGATTATTTCATTGCGCAATGCTGAACC Template Strand
G
A
T
C
DNA
1
2
3
4
5
Gal4
+DNA
6
Next a DNA footprinting experiment using DNAse I was done with the transcription factor Gal4
bound to the double-stranded DNA of this same sequence. The DNA was end –labeled the same
as in the DNA sequencing reaction. Assuming that DNAse I can cut at every base pair show what
pattern you would expect to see in lane 5 with only DNA added and that in lane 4 in which enough
Gal4 was added to completely bind the DNA. The DNA sequence that Gal4 binds to is underlined
in the template strand shown above.
[10 points/5pts per lane]
2. What are the important components of a yeast artificial chromosome or YAC?
1. ARS: Origin of Replication
2. CEN : Centromere sequence for proper segregation
3. Telomere: for chromosome stability
4. Selectable marker
5. MCS: Multicloning Site or Polylinker
[10 points]
Name ____________________________________
3. Name the following molecule
A.
B.

C.
D.
adenosine
adenylate
deoxyguanosine
deoxyadenosine
deoxyguanylate
[1 point]
4. In the nucleotide shown above indicate the positions in the purine ring used to make hydrogen
bonds in Watson-Crick base pairing and which positions have the potential to make hydrogen
bonds that are not involved in Watson-Crick base pairing.
[3 point]
5. The genes that are up regulated in order to help cells adapt to heat shock conditions were
identified by whole genome expression profiling using DNA microarrays. Cells were grown at
normal temperature (37C) and then a portion of the cells were transferred to 42C for a brief
period of time before harvesting. RNA was extracted from cells grown at 37C and those that
were heat shock. Describe how samples from both cells were prepared and used for DNA
microarray analysis.
1. Prepare c-DNA from m-RNA, Write how to make c-DNA (Reverse transcriptase and
primers used)
2. Label with Cy3 (green fluorescence) and Cy5 (Red fluorescence) dye
3. Combine equal amount of c-DNA, denature and hybridize to micro-array plate
4. Scan to take picture
Name ____________________________________
A B C D E F G H I
1
1
2
3
4
5
6
2
3
4
5
6
7
8
7
8
A B C D E F G H I
[5 point]
A portion of the microarray analysis is shown with each DNA spot assigned a letter (A-I) and a
number (1-8), and each spot corresponds to a different gene. The cDNA from the normal cells
was labeled with a green fluorescent dye and cDNA from the heat shock cells was labeled with a
red fluorescent dye. Provide your analysis of this data making sure to comment on those genes
not expressed and those that were mutually or exclusively expressed at the two temperatures.
Which of these genes are likely to be heat shock genes?
[5 point]
1. Black spots (1A, D E, G, H, I, 2ADFGHI etc ) –No expression of either gene
2. Green spots (1B, 2E, 4C, 6ABC, 8I) : genes expressed at 37C from normal cells
3. Red spots (1C, 3C, G, 5H, 7C) :Genes from 42C grown cells expresses, heat shock
genes
4. Yellow spots (3B, 6G, I, 7B) : Genes fro both normal and heat shock cells expressed.
6. What are the key differences between topoisomerase I and II?
[10 point]
1. Relaxes only negatively super coiled DNA whereas Topo-isomerase II relaxes both
negatively and positively super coiled DNA
2. Introduces changes of writhe by increments of 1 but Topo-isomerase II changes writhe by
increments of 2
3. Topo-isomerase I is a monomeric protein where II consists of 2 subunits
4. Topo-isomerase I breaks one phospho-diester bond where II breaks two phospho-diester
bonds simultaneously.
Name ____________________________________
7. Draw out the DNA elements of a typical eukaryotic mRNA gene that are required for both basal
and activated transcription. Make sure to indicate besides their name, the position and distance
from the start site of transcription and whether they are important for activated or basal level
transcription.
[10 point]
1. Basal Transcription: Inr Region, TATA Box and Down stream promoter elements
2. Activated Transcription: Enhancer and Response elements
8. You find a fourth RNA polymerase in Arabidopsis and now it is time to focus on its subunit
composition. You want to know how much it is like the other nuclear RNA polymerases. What
kind of subunit features would you be looking for and why? Make sure to classify the type of
subunit organization that is typical for nuclear RNA polymerases with that of your novel RNA
polymerase.
[10 point]
1. Sequence comparison of the newly discovered RNA polymerase with the CORE subunits
known three nuclear RNA polymerases to find out the extent of similarity
a. RNA Polymerase 1 (Rpa1, Rpa2, Rpc5, Rpc9 and Rpb6)
b. RNA Polymerase II ( Rpb1, Rpb2, Rpb3, Rpb11, Rpb6)
c. RNA Polymerase III (Rpc1, Rpc2, Rpc5, Rpc9, Rpb6)
2. Compare with the common subunits (Rpb5, Rpb8, Rpb9)
3. Comparison with specific subunits to find out how this newly discovered RNA pol is
different than others: Rpa3 and Rpa5 in pol I, Rpc3, Rpc4, Rpc6 and Rpc8 are distinct in
RNA pol III
Name ____________________________________
9. Which one of the following statements about heterochromatin is not true?
A. It is transcriptionally active
B. It is found in telomeres and centromeres
C. It is hyperacetlylated
D. It is highly condensed
 A and C
10. Which kind of cloning vector can hold the largest insert of foreign DNA?
A. Plasmid
B. Lambda Phage
C. Cosmid
 Yeast artificial chromosome
E. Shuttle Vector
11. The RLFP autoradiogram of murder case was given bellow. The samples analyzed are:
1. Known sample of victim
2. Known sample from suspect A
3. Known sample from suspect B
4. DNA size marker
5. Sample 1 collected from crime site
6. Sample 2 collected from crime site
From the evidence shown in this gel which one is true?
A. Suspect A can be excluded from the case
B. Suspect B can be excluded from the case
C. Both suspect A and Suspect B can be excluded from the case
D. Sample 1 collected from the crime site could probably originated from the victim
 B and D
12. Which of the following techniques can be used to determine the interaction of protein with
DNA
A. Gel retardation (gel shift)
B. DNA footprinting
C. DNA microarray
D. All of the above
 A and B
13. Which of the following statements about telomeres is NOT true?
A. It is required in constructing a reasonably stable artificial linear chromosome
B. It must lie at the end of a chromosome
C. It contains guanosine tetraplex
D. It gets shorter and shorter as aging
Name ____________________________________

It consists of highly decondensed chromatin structure
[1 point each]
14. Which statement about topoisomerase I is NOT correct:
A. It breaks only one strand of DNA
B. It relaxes negatively supercoiled DNA
C. It can pass one segment of a single-stranded DNA through another
 It is DNA sequence specific
15. Which one of the statements about nucleosome is true?
 DNA sequences 80 nucleotides apart are brought into proximity when coiled around a
histone octamer
A. H2A-H2B form a tetramer
B. H4 is the linker histone
C. 200 bps of DNA are packaged into a nucleosome
16. RNAP III transcribes
 tRNA genes
A. rRNA genes
B. siRNA genes
C. mRNA genes
 A and B
17. Tm is the temperature at which 1/2 of a certain DNA is single-stranded.
 A. true
B. false
18. Type I restriction endonuclease is useful for molecular cloning. 18B
A. true
B. false
19. Regarding nucleosome structure, which of the following statements is correct?
A. Nucleosomes are spherical structures comprised of RNA, nonhistone proteins and
histone proteins.
B. The major histones comprising nucleosomes are H1 and H4.
 Nucleosomes permit efficient packing of DNA to about one seventh its normal
length.
D. The histone associated with the DNA in the linker region holding nucleosomes is
called H2A.
E. All of the above.
20. What determines the number of copies of plasmid in a cell
A. Multi Cloning site
B. Presence of resistance marker
 Origin of replication
D. beta-galactosidase gene
21. Which of the following enzymes are NOT necessary for DNA cloning?
A. Alkaline Phosphatase
 B. Acetylase
C. Kinase
D. DNA ligase
22. A 4.2 Kb relaxed plasmid has been negatively supercoiled giving a  Lk of -5. What is the
specific linking difference or superhelical density of this plasmid now?
 - 0.0125
B. - 0.05
C. +0.0125
D. +0.05
23. Which histones are NOT a part of the nucleosome core particle?
 H1
B. H2A
C. H3
D. H4
24. Formation of Z-DNA is favored by
 high salt concentration
Name ____________________________________
A. alternating adenine and guanine residues
B. methylation of guanosine
C. increase in pH
D. change in temperature
[1 point each]
25. The IIA form of RNA polymerase II is
 the form of the enzyme that is involved in promoter recognition
B. the form of the enzyme that is involved in productive elongation
C. caused by phosphorylation of the N-terminus of the largest subunit
D. is also found as a feature of RNA polymerase III
26. Phosphorylation of the RNA polymerase II C-terminal domain (CTD) is
A.catalyzed by TFIIH
B. involved in the formation of the preinitiation complex
C. correlated with the switch from an initiation polymerase to elongation polymerase
D. involved in transcription termination
 A and C
[1 point each]
27. Give definitions for the following terms that are used to describe DNA supercoiling:
From the equation L=T+W
L [ 2 point]
T [2 point]
W [2 point]
Plectonemic
[1 point]
Solenoidal
[1 point]