Construction of a Natural Peptide Library in f88-4 or fuse5
An NPL is constructed by splicing randomly fragmented genomic DNA into the gene for a
host phage coat protein. Some of the phage clones in the library display fragments of
"natural" proteins. Successful natural peptide display requires that the genomic insert encode
part of a structural component of the organism from which the genomic DNA derived, and
that it be spliced into the vector so that its natural reading frame is correctly fused to that of
the host coat protein gene. Because of the randomness of the genomic inserts, only a minority
of the clones in the NPL meet these requirements; the remainder display no guest peptide at
all, or display a random peptide encoded by a non-natural reading frame. Despite the relative
scarcity of clones displaying natural peptide fragments, NPLs can be a rich source of natural
peptide epitopes that can be accessed by affinity selection (AffinitySelection.doc).
To construct an NPL, we ligate randomly fragmented genomic DNA with linkers containing
restriction enzyme recognition sites. The linker-ligated genomic DNA fragments and vector
are then digested with appropriate restriction enzymes, ligated, electroporated into E. coli
cells, and propagated.
Random fragmentation of insert DNA by DNAse I
1. Perform a pilot experiment to determine the appropriate concentration of DNAse I
necessary to digest genomic DNA to a fragment size range of approximately 100–1000
base pairs.
1.1. Prepare fresh 10× DNAse I buffer
500 mM Tris pH 7.8
10 mM MnCl2
1 mg/ml nuclease-free BSA
1.2. Prepare a series of six digestion tubes containing 25 µl of 100 µg/ml genomic DNA in
1× DNAse I buffer, on ice.
NOTE: Although we have not constructed any cDNA NPLs to date, we assume that
cDNA could be substituted for genomic DNA in this procedure.
1.3. Prepare six 3:4 fold serial dilutions of DNAse I (Boehringer-Mannheim; molecular
biology grade) from 1.0 to 0.237 U/ml in 1× DNAse I buffer.
NOTE: these concentrations may need to be adjusted depending on the source and
purity of the DNA to be digested.
1.4. Add 8.75 µl of diluted, ice cold DNAse I to each of the digestion tubes, vortex gently,
immediately transfer to a 15º water bath, and incubate for exactly 10 min.
1.5. Stop the reactions by adding 4 µl 250 mM EDTA (stdpreps.doc) and heating 10 min
at 68º.
1
1.6. Add 5.6 µl 70/75BPB (stdpreps.doc) to each digestion and run 14 µl on a 7% (19:1
monomer:bisacrylamide) polyacrylamide gel (1× TBE, stdpreps.doc; 1 mm thickness)
to determine fragment size range, using standard procedures [Sambrook, 1989 #528].
2. Based on results of the pilot experiment, perform a scaled-up DNAse I digestion of 50–
150 µg DNA (at a concentration of 100 µg/ml, as in the pilot experiment) following
exactly the procedures described in Section 1, and using the appropriate DNAse I
concentration to yield fragments of ~100–1000 base-pairs. Run 12 µl of the digested
DNA (plus 2 µl 70/75/BPB) on a 7 % polyacrylamide gel as described in Section 1.6, to
confirm that the DNA fragments fall approximately within the correct size range.
3. Dilute the DNAse I digested DNA ~6-fold in water, extract with neutralized phenol
(stdpreps.doc) and chloroform, dialyze in a Slide-a-Lyzer (Pierce; 10,000 mw cut-off; 3–
15 ml sample volume) against four changes of 500 ml TE (stdpreps.doc), concentrate to
~100 µl on a Centricon 30-kDa ultrafilter (Amicon), and quantify by spectrophotometry.
The final yield is typically ~2/3 the quantity of starting material.
Blunt-end polishing of fragmented DNA
4. Polish 50–100 µg DNAse I digested DNA fragments, at a concentration of ~120 µg/ml,
with T4 DNA polymerase (Boehringer Mannheim, ~2 U per g DNA) in the presence of
500 M dNTPs and buffer (final concentration = 50 mM Tris-HCl, 15 mM (NH4)2SO4, 7
mM MgCl2, 0.1 mM EDTA , 10 mM ß-mercaptoethanol, 0.2 mg/ml BSA, pH 8.8), at 15º
for 1 hour. After 10 min incubation at 75º to inactivate T4 DNA polymerase, cool the
reaction mixture to room temp, add ~1.67 U DNA polymerase I Klenow fragment,
exonuclease minus (Promega) per µg DNA, and incubate at 37º for 1 hour. Extract with
neutralized phenol and chloroform, vacuum evaporate for ~30 min to remove residual
chloroform, then wash with 5–10 ml TE and concentrate to ~80 l on a Centricon 30-kDa
ultrafilter (Amicon), and quantify by spectrophotometry. The final yield is typically ~2/3
the quantity of starting material.
Preparation of linker-ligated insert DNA
5. Polished insert DNA fragments are ligated to blunt-end, hairpin linkers containing
restriction enzyme sites for insertion into the desired vector, and appropriate coding
sequence to preserve the host protein reading frame and leader sequence. The sequences
of the hairpin linkers we use for cloning into the f88-4 vector (vectors.doc) are as follows:
Hind III Linker
S F A A
A C CTCCGTGCACCGAAGCTTTGCCGCT3’
T
A A GAGGCACGTGGCTTCGAAACGGCGA 5’
Pst I Linker
A
5’CGCTGCAGGACCTGGTTCCG AT
3’GCGACGTCCTGGACCAAGGC A
C
2
For cloning into the fuse5 vector (vectors.doc) we use the following linkers:
Sfi I Left Linker
D G A
A C CTCCGTGCACCGGGCCGACGGGGCC3’
T
A A GAGGCACGTGGCCCGGCTGCCCCGG 5’
Sfi I Right Linker
A
5’GGCCGCTGGGGCCACCTGGTTCCGC AT
CA
5.1. Ligate hairpin linkers (5-fold molar excess termini) to ~30 µg polished DNA
fragments, at a concentration of ~120 µg/ml, overnight at 16º in buffer (final
concentration = 66 mM TrisHCl, 5 mM MgCl2, 1 mM DTE, 1 mM ATP, pH 7.5)
with 0.75-1.0 Weiss Units T4 DNA ligase (Boehringer Mannheim) per g DNA
fragments.
5.2. After 15 min incubation at 68º to inactivate the ligase, add 1/10 volume 10×
buffer (500 mM TrisHCl, 100 mM MgSO4, 1 mM DTT) and 0.75–1.0 U exonuclease
III per g original DNA fragments directly to the ligation mixture. Incubate at 37º for
30 min. This step digests unligated DNA fragments without harming linker-ligated
DNA fragments, which are protected by the hairpin linkers.
5.3. Add EDTA to a final concentration of 8.3 mM, 1/10 volume 10X buffer (670
mM KH2PO4, 100 mM ß-mercaptoethanol, pH 7.9) and 1 U exonucleaseVII
(GibcoBRL) per g original DNA fragments. Incubate at 37º for 90 min. This step
removes residual single stranded DNA generated by the exonuclease III digestion.
5.4. Extract the remaining double stranded, linker-ligated DNA once with
neutralized phenol and twice with chloroform; vacuum evaporate briefly, concentrate
on a Centricon 30-kDa ultrafilter (Amicon), and quantify by spectrophotometry. A
typical yield is ~1.5× the quantity of original DNA fragments.
Final preparation of insert DNA
6. Digest insert DNA (~40 µg), with 100 U of restriction enzymes (Hind III and Pst I or
Sfi I, as appropriate) per µg DNA fragments in buffer (final concentration = 6 mM
TrisHCl, 6 mM Mg Cl2, 50 mM NaCl, 1 mM DTT, pH 7.5) supplemented with 1 mg/ml
BSA, in a total volume of 5 ml at 37º for 4–18 hours. Extract the DNA once with
neutralized phenol, twice with chloroform, then wash with 5–10 ml TE, vacuum evaporate
briefly, and concentrate on a Centricon 30-kDa ultrafilter (Amicon) to ~80 l.
7. To remove short fragments released by restriction digestion, purify the restriction
digested DNA fragments by polyacrylamide gel electrophoresis on a 7% gel (19:1
monomer:bisacrylamide; 1× TBE; 1 mm thickness) in a single preparative lane (8.5 cm
wide) using standard procedures [Sambrook, 1989 #528]. Excise the portion of the gel
3
containing insert DNA 65 bp or longer, and recover the DNA by electroelution. For this
purpose we use 4-6 Centricon 30-kDa ultrafilters and an Amicon Centrilutor apparatus,
following the manufacturer’s instructions.
Preparation of Primary Library
8. We have successfully constructed NPLs in both the f88 and fuse5 vectors
(vectors.doc).
8.1. Prepare f88 or fuse5 vector RF (RFmaxiprep.doc) and cleave with HindIII and
PstI (f88cleavage.doc) or Sfi I (VectorCleavage.doc), as appropriate. Treat the
cleaved vector with calf intestinal alkaline phosphatase (CIP) by standard procedures
[Sambrook, 1989 #528]. This step is not absolutely necessary, but we have found that
this treatment substantially reduces the background of non-recombinant vector in the
library.
8.2. Ligate 180 µg vector with ~20 µg insert DNA as described in
LibraryConstruct.doc, Step 1.
8.3. Process the ligation mixture, electroporate and propagate the library as
described in LibraryConstruct.doc, Steps 6-12.
4