Supplementary Methods
Mutation screening and testing of controls. Human CKIδ was screened for mutations
by dHPLC and direct sequencing of genomic DNA from the initial proband. Fifty µl PCR
reactions were performed with 100 ng of genomic DNA and 10 pmol of each forward and
reverse primer. The primers were designed outside the splice sites so intronic sequence of
at least 100 base pairs flanking each exon boundary could be obtained. PCR reactions
were performed with the following protocol: 94°C-3 min, (94°C-30 sec, 60°C-30 sec,
72°C-30 sec) X 40, 72°C-3 min, and 15°C-hold. The PCR products were purified using
the PCR96 Cleanup Plate (Millipore) and were sequenced. For dHPLC mutation detection,
10 µl of the PCR products were analyzed by the WAVE nucleic acid fragment analysis
system (Transgenomic, Omaha, NE).
Cloning, Expression, and Purification of Recombinant Casein Kinase I δ. Human
CKIδ was subcloned into the pET32 Xa/LIC T7 expression vector (Novagen). To avoid
autophosphorylation during subsequent in vitro kinase assays, a truncated construct
terminating at residue 317 was also cloned. The threonine residue at position 44 was
substituted with an alanine residue by QuikChange Site-directed Mutagenesis
(Stratagene).
Recombinant proteins were purified using S-protein agarose (Novagen) as outlined
in the manufacturer’s protocol. 50% slurry was regenerated using 30 mM HEPES, pH 7.5
and stored at 4°C for one week. Protein concentration was determined by Western
blotting with α-His (1:1000, Novagen) and verified by silver staining.
Generation of Fly Stocks. The UAS-hCKIδ transgenic flies were generated by
subcloning the human wild-type and CKIδ-T44A cDNA into the region between the Not I
and BglII sites of the pUAST vector. Plasmids were then injected into w embryos to
generate transformants. The transgenic flies were also sequenced with human CKIδ
specific primers to confirm the presence of the mutant or wild-type sequence. The timUAS-Gal4 strain has been described before 1.
Semi quantitative RT-PCR for fly head. RNA was extracted from fly heads using
TRIzol, as per manufacturer’s instructions. Two micro-grams of RNA was used to
synthesize cDNA using the Superscript III first strand synthesis system (Invitrogen).
After an initial 10 fold dilution of the cDNA reaction mixture, serial dilutions of 2 fold
were used for the semi quantative PCR reaction. Primers used for hCK1
were:
FP – 5’ CCATCGAAGTGTTGTGTAAAGG 3’
RP – 5’GAGGTGTTAGCCGTGTGTGA 3’
Primers used for Drosophila β-tubulin were:
FP – 5’ ACAGCTTGCCGTCTCTAGCTGCG 3’
RP – 5’ CATCACCTCCGCCCACGGTCTTG 3’
Engineering of BAC constructs for generating transgenic mice. Human BAC:RP 111376P16 containing the entire CKIδ gene on a 190-kb genomic insert (accession number
AC129510) was obtained from CHORI (Children’s Hospital Oakland Research Institute).
pKD46 was a gift from Dr. Mario Capecchi, (University of Utah) and pML4 from Dr.
Amanuma (National Institute for Environmental Studies, Japan). RP11-1376P16
containing the human mutation was generated by ET-cloning as described elsewhere with
modification 2,3. A linear PCR fragment containing a streptomycin/kanamycin counter
selection gene was amplified from vector pML4. The primers for this reaction were
designed so that 20 nucleotides would anneal to the streptomycin/kanamycin gene and an
additional 50 nucleotides homologous to sequences flanking the mutation site (nucleotide
position 39683–39733 and 39734-39784 respectively) (Figure4 a). This PCR product was
transferred into the RP11-1376P16 BAC by homologous recombination in DH10B
Escherichia coli strain that already contained the plasmid pKD46 4. The counter selection
gene was than removed by a second recombination event using an oligonucleotide
(position 39683–39784) that carried the mutation (A-to-G) at the center. The ET-Cloning
procedure was employed to introduce an internal ribosome entry site (IRES) followed by
an enhanced green fluorescent protein gene (IRESEGFP) marker to the CKIδ carboxy
terminus. Translation results in generation of both CKIδ and GFP. All relevant segments
generated by PCR and recombination were sequenced in order to confirm accuracy.
Detailed mappings were carried out for the modified BACs to ensure that correct
constructs were obtained.
Generation of CK1δ knock out mice. CK1δ knockout mice were generated from mouse
embryonic stem cell line TEA20 (Baygenomics). The gene trap vector contained a
promoterless β-geo reporter construct (a fusion of the β-galactosidase and neomycin
resistance genes) and was inserted between exon 4 and exon 5. The resulting insertional
mutation creates a fusion transcript which contains exons upstream of the insertion joined
to the β-geo marker (Supplementary figure 1). CK1δ knockout mice were generated by
interbreeding the offspring of chimeric mice that were identified by PCR genotyping and
were transmitting the targeted allele through the germ line. Heterozygous CK1δ+/- mice
were phenotypically normal and fertile. The lengths of the free running periods had no
significant difference from wild type mice (23.8h+/-0.2, vs 23.78h+/-0.12).
When CK1δ+/- was intercrossed, CK1δ-/- mice died around the second postnatal
day and no CK1δ-/- offspring survived past 5 days. The weight of postnatal knock out
mice was clearly lighter than wild-type and heterozygous mice (1.22g+/-0.03; n=5 vs
2.33g+/0.14; n=10). No pronounced defect was found on the body surface. When
embryos of intercrossed CK1δ+/- mice at E15.5 were analyzed, CK1δ-/- embryos were
not grossly different from wild-type mice. However, they were smaller than wild type
and heterozygous littermates (0.266g+/-0.016; n=4 vs 0.486g+/-0.03;
n=10)(Supplementary figure 1). The homozygous ratio is as expected, suggesting that
loss of CK1δ function affects normal embryonic development and leads to postnatal
death.
1.
Blau, J. & Young, M.W. Cycling vrille expression is required for a functional
Drosophila clock. Cell 99, 661-71 (1999).
2.
Zhang, Y., Buchholz, F., Muyrers, J.P. & Stewart, A.F. A new logic for DNA
engineering using recombination in Escherichia coli. Nat Genet 20, 123-8 (1998).
3.
Narayanan, K., Williamson, R., Zhang, Y., Stewart, A.F. & Ioannou, P.A.
Efficient and precise engineering of a 200 kb beta-globin human/bacterial artificial
chromosome in E. coli DH10B using an inducible homologous recombination system.
Gene Ther 6, 442-7 (1999).
4.
Datsenko, K.A. & Wanner, B.L. One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-5 (2000).