PHYTOTHERAPY RESEARCH
Phytother. Res. 28: 363-371 (2014)
Published online 23 April 2013 in Wiley Online Library
(wileyonlinelibrary.com) DOI: 10.1002/ptr.5003
Momordica charantia Ameliorates Insulin
Resistance and Dyslipidemia with Altered Hepatic
Glucose Production and Fatty Acid Synthesis and
AMPK Phosphorylation in High-fat-fed Mice
Chun-Ching Shih,1* Min-Tzong Shlau,2 Cheng-Hsiu Lin3 and Jin-Bin Wu4
1
Graduate Institute of Pharmaceutical Science and Technology, Central Taiwan University of Science and Technology, No.666, Buzih
Road, Beitun District, Taichung City 40601, Taiwan, ROC
2
College of Health Science, Central Taiwan University of Science and Technology, No.666, Buzih Road, Beitun District, Taichung City
40601, Taiwan, ROC
3
Department of Internal Medicine, Fong-Yuan Hospital, Department of Health, Executive Yuan, No.100, An-Kan Road, Fongyuan
District, Taichung City 42055, Taiwan, ROC
4
Graduate Institute of Pharmaceutical Chemistry, China Medical University, Taichung, Taiwan, ROC
Momordica charantia Linn. (Cucurbitaceae) fruit is commonly known as bitter melon. C57BL/6J mice were firstly
divided randomly into two groups: the control (CON) group was fed with a low-fat diet, whereas the experimental group was fed a 45% high-fat (HF) diet for 8 weeks. Afterwards, the CON group was treated with vehicle, whereas the HF group was subdivided into five groups and still on HF diet and was given orally M. charantia
extract (MCE) or rosiglitazone (Rosi) or not for 4 weeks. M. charantia decreased the weights of visceral fat and
caused glucose lowering. AMP-activated protein kinase (AMPK) is a major cellular regulator of lipid and
glucose metabolism. MCE significantly increases the hepatic protein contents of AMPK phosphorylation by
126.2-297.3% and reduces expression of phosphenolpyruvate carboxykinase (PEPCK) and glucose production.
Most importantly, MCE decreased expression of hepatic 11beta hydroxysteroid dehydroxygenase (11beta-HSD1)
gene, which contributed in attenuating diabetic state. Furthermore, MCE lowered serum triglycerides (TGs) by
inhibition of hepatic fatty acid synthesis by dampening sterol response element binding protein 1c and fatty acid
synthase mRNA leading to reduction in TGs synthesis. This study demonstrates M. charantia ameliorates diabetic
and hyperlipidemic state in HF-fed mice occurred by regulation of hepatic PEPCK, 11beta-HSD1 and AMPK
phosphorylation. Copyright © 2013 John Wiley & Sons, Ltd.
Keywords: Momordica charantia; 11beta hydroxysteroid dehydroxygenase; phosphoenopyruvate carboxykinase.
Abbreviations: AMPK, AMP-activated protein kinase; apo-C-III, apolipoprotein C-III; BAT, brown adipose tissue; CON, control; FAS, fatty acid synthase;
FFA, free fatty acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GLUT4, glucose transporter; G6Pase,
glucose-6-phosphatase; HF, high-fat control; 11beta HSD1, 11beta hydroxysteroid dehydrogenase 1; MCE, Momordica charantia
extract; PEPCK, phosphenolpyruvate carboxykinase; PPARa, peroxisome proliferator-activated receptor a; PPARg, peroxisome
proliferator-activated receptor g; Rosi, rosiglitazone; RT-PCR, reverse transcription-polymerase chain reaction; SREBP-1c, sterol regulatory element
binding protein 1c; TC, total cholesterol; TG, triglyceride; WATs, white adipose tissues.
INTRODUCTION
Currently, the incidence of diabetes mellitus has reached
epidemic proportions worldwide, and it is expected to increase to over 300 million by 2025. Therefore, the prevention and control of diabetes have become a major
health care focus. Type 2 diabetes, which accounts for
more than 90-95% of all diabetes, is characterized by
the majority of metabolic defect known as insulin resistance. Insulin resistance is tightly associated with
dyslipidemia, obesity and stroke (Reaven and Laws,
1994). Both genetic and environmental factors play an
* Correspondence to: Chun-Ching Shih, Graduate Institute of Pharmaceu- tical
Science and Technology, College of Health Science, Central Taiwan University of
Science and Technology, No.666, Buzih Road, Beitun District, Taichung City 40601,
Taiwan.
E-mail: ccshih@ctust.edu.tw
Copyright © 2013 John Wiley & Sons, Ltd.
important role in Type 2 diabetes. Of particular importance may be proportion of fat in the diet.
Momordica charantia Linn. (Cucurbitaceae), also is
referred to as bitter melon, and has been used as a traditional anti-diabetic remedy for many years in countries. It
contains biologically active chemicals including glycosides, saponins, alkaloids, triterpenes, proteins and steroids. The hypoglycemic chemicals are saponins known as
charantins and alkaloids (Raman and Lau, 1996). The
isolated phytochemicals (charantins, a polypeptide-p,
momordin Ic, oleanolic acid 3-O-monodesmoside and
oleanolic acid 3-O-glucuronide) have shown hypoglycemic activity (Matsuda et al., 1998). Recently, in both L6
myotubes and 3T3-L1 adipocytes, triterpenoids isolated
from M. charantia including four cucurbitane glycosides
and stereochemistry stimulated GLUT4 translocation to
the cell membrane, which associated with increased activity of AMP-activated protein kinase (AMPK); moreover,
these compounds and their aglycones exhibited beneficial
to diabetes and obesity (Tan et al., 2008).
Received 16 December 2012
Revised 23 March 2013
Accepted 25 March 2013
364
C.-C. SHIH ET AL.
Although many studies conducted by others and ours
revealed that M. charantia extract (MCE) had hypoglycemic activity and improved biochemical levels and insulin resistance in different animal models (Chen et al.,
2003; Shih et al., 2008; Sridhar et al., 2008; Shih et al.,
2009), it is now clear that M. charantia not only activated
AMPK in both L6 myotubes and 3T3-L1 adipocyte (Tan
et al., 2008) but also increased skeletal muscle insulinstimulated IRS-1 tyrosine phosphorylation in HF-fed rats
(Sridhar et al., 2008). Whether M. charantia activated
hepatic AMPK in HF-fed mice and could ameliorate insulin resistance and regulate target gene expression is not
fully understood.
The C57BL/6J mice on high-fat (HF) diet will develop
severe obesity, hyperglycemia and hyperlipidemia (Petro
et al., 2004). AMPK is a major cellular sensor regulator of
lipid and glucose metabolism. Thus, the present study was
to evaluate the effects and mechanisms of MCE-mediated
glucose and lipid lowering on AMPK activity and related
gene expressions in the liver tissue of HF-fed mice.
Phosphorylation of Thr 172 of a subunits is essential for
AMPK activity (Stein et al., 2000). Activation of the
AMPK results in increased lipid and glucose catabolism
(Foretz et al., 2006; Viollet et al., 2009) and fatty
acid metabolism, whereas reduced glucose production.
Glucocorticoids are involved in several physiological
influences on carbohydrate and lipid metabolism. The activities of phosphenolpyruvate carboxykinase (PEPCK)
are influenced by 1beta hydroxysteroid dehydrogenase
1 (11b-HSD1). Moreover, the related gene expression including PEPCK, 11beta HSD1, sterol regulatory elements
binding protein-1c (SREBP-1c) and fatty acid synthase
(FAS) were also investigated.
MATERIALS AND METHODS
Preparation of extract and HPLC analysis. M. charantia
fruits were purchased from the local market in August
2010. The sort was identified by Professor Chao-Lin
Kuo with voucher specimens (CMU-CP080002-CMUCP08021) deposited in the China Medical University,
Taiwan. 50 kg fresh whole fruit of pearl M. charantia
(including pulp and seed) was washed thoroughly and
cut into small pieces, and then extracted with 50 L ethanol
(80% in water) by 2 h reflux. After filtration, the ethanol
extract was concentrated under reduced pressure to
10 L and no ethanol remaining, followed by partitioned
with 10 L chloroform. The chloroform layer was concentrated under reduced pressure, and the chloroform layer
extract (33.0 g) was obtained for experiment. The extract
consisted of compounds identified as tormentic acid,
maslinic acid and ursolic acid. The isolation procedure
and analysis condition of compounds were successfully
determined by HPLC according to our team partner's
procedure (Ho et al., 2008). Briefly, HPLC was performed
on a Shimadzu 10A system equipped with one pump
(LC-10AT Shimadzu Japan) and a RI spectrophotometric detector (RID - 10A, Shimadzu, Japan). The
HyPURITY C-18 column (5 mm, 4.6 Â 250 mm) was
eluated at a rate of 0.5 L/min with a solvent of A-B
(A, Methanol; B, 0.15% acetic acid aqueous; A: B = 85:
15, v/v). Between each sample injection and the last run,
the system was reconditioned for another
Copyright © 2013 John Wiley & Sons, Ltd.
40 min. Tormentic acid, maslinic acid and ursolic acid
were resolved and eluted at 9.02, 17.42 and 33.46 min,
respectively. The sample analysis was determined within
40 min. The total contents of three triterpenes were 0.69%
(tormentic acid 0.30%, maslinic acid 0.25% and ursolic
acid 0.14%, respectively). The ex- tract was diluted and
adjusted, then was administrated orally to mice in a
volume of C1: 0.1, C2: 0.2 and C3: 0.4 g/kg bodyweight,
respectively.
Animal model and treatment. All animal procedures were
approved by the Institutional Animal Care and Use
Committee of Central Taiwan University of Science and
Technology (IACUC Approval No: 97-CTUST-5). The
study contained two parts of including part 1: Oral glucose
tolerance test (OGTT). The ICR normal mice
(n = 5 or 6) were fasted for 15-18 h but were allowed
access to 0.2 g/kg, 0.5 g/kg, 1.0 g/kg MCE, or an equivalent amount of vehicle (water) was given orally 30 min
before an oral glucose load (1 g/kg body weight). Blood
samples were collected at the time of the glucose administration (0) and every 30 min until 3 h after glucose
administration to determine the glucose levels. The part 2
animal study: male C57BL/6J mice (5 weeks old) were
obtained from the National Laboratory Animal Breeding
and Research Center, National Science Council. Mice
were housed in an air-conditioned room at 22 Æ 3 1C with
12 h of light and tap water ad libitum. After a 1-week
acclimation period, the mice were divided randomly
into two groups. The control (CON) group (n = 9) was fed
low-fat diet (Diet 12450B, Research Diets, Inc., New
Brunswick, NJ, USA), whereas the experimental group
was fed a 45% HF diet (Diet 12451, Research Diets, Inc.,
New Brunswick, NJ, USA) for 12 weeks. The low-fat diet
was composed of protein 20%, carbo- hydrate 70% and fat
10%, whereas HF diet was com- posed of protein 20%,
carbohydrate 35% and fat 45%
(of total energy, % kcal). After the first 8 weeks, the
HF-treated mice were further randomly subdivided into
five groups (n = 9) and were administrated by gavages
with or without MCE or rosiglitazone (Rosi) for
4 weeks, while the mice were still on the HF diet. During
the last 4 weeks, the CON and HF control mice were
treated with vehicle only. The other groups were received
MCE (including 0.1, 0.2, 0.4 g/kg/day extracts), or
rosiglitazone 10 mg/kg, respectively (n = 9). Rosiglitazone
(GlaxoSmithKline Product No: BRL49653 C) was
dissolved in 1% methylcellulose and administered by oral
gavage between 8 AM and 9 AM. The body weight was
measured weekly throughout the study. The dietary design lasted for 12 weeks. The compositions of the experimental diets are shown as described (Shih et al., 2008).
At the end of the experiment, the mice were sacrificed
by carbon dioxide inhalation. The liver tissue, skeletal
muscle and white adipose tissues (WATs) (including
epididymal, mesenteric and retroperitoneal WAT) and
interscapular brown adipose tissue (BAT) were dissected
and weighed and immediately kept at À80 1C until use.
Visceral fat was defined as the sum of epididymal and retroperitoneal WAT. The collected blood was kept at 25 1C
for 5 min for coagulation, and then the plasma was
obtained from the coagulated blood by centrifugation at
1600 Â g for 15 min at 4 1C. The separation of the plasma
was finished within 30 min. Aliquots of the supernatant
Phytother. Res. 28: 363-371 (2014)
365
REGULATION OF HEPATIC 11BETA-HSD1, PEPCK AND AMPK PHOSPHORYLATION
were obtained for total cholesterol (TC), triglyceride (TG)
and free fatty acid (FFA) assay and immediately
frozen at À80 1C until use.
Analysis of fasting blood glucose and biochemical
parameters. Blood samples were collected from the retroorbital sinus of fasting mice, and the glucose level was
measured by the glucose oxidase method (Model 1500;
Sidekick Glucose Analyzer; YSI Incorporated, Yellow
Springs, USA). The concentrations of TG, TC and FFA
were measured using commercial assay kits according
to the manufacturer's directions (Triglycerides-E test,
Cholesterol-E test and FFA-C test, Wako Pure Chemical,
Osaka, Japan).
Analysis of adipocytokine levels. The levels of insulin and
leptin were measured by ELISA using a commercial assay kit according to manufacturer's directions
(mouse insulin ELISA kit, Sibayagi, Gunma, Japan
and mouse leptin ELISA kit, Morinaga, Yokohama,
Japan).
Histology analysis of epididymal WAT. Small pieces of
epididymal WAT were fixed with formalin (200 g/kg)
neutral buffered solution and embedded in paraffin.
Sections (8 mm) were cut and stained with hematoxylin
and eosin. For microscopic examination, a microscope
(Leica, DM2500) was used, and the images were taken
using a Leica Digital camera (DFC-425-C) at 10 (ocular)
 40 (object lens) magnification.
Analysis of relative quantitation of mRNA indicating gene
expression. Total RNA from the epididymal WAT and
liver was isolated with a Trizol Reagent (Molecular
Research Center, Inc., Cincinnati, OH, USA)
according to the manufacturer's directions. The integrity
of the extracted total RNA was examined by 2% agarose
gel electrophoresis, and the RNA concentration was
determined by the ultraviolet light absorbency at 260 nm
and 280 nm (Spectrophotometer U-2800A, Hitachi). The
quality of the RNA was confirmed by ethidium bromide
staining of 18S and 28S ribosomal RNA after electrophoresis on 2% agarose gel containing 6% formaldehyde.
Total RNA (1 mg) was reverse transcribed to cDNA in a
reaction mixture containing buffer, 2.5 mM dNTP
(Gibco-BRL, Grand Island, NY), 1 mM of the oligo (dT)
primer, 50 mM dithiothreitol, 40 U Rnase inhibitor (GibcoBRL, Grand Island, NY) and 5 mL Moloney murine
leukemia virus reverse transcriptase (Epicentre, Madison,
WI, USA) at 37 1C for 1 h, and then heated at 90 1C for 5
min to terminate the reaction. The polymerase
chain reaction (PCR) wasR performed in a final 25 mL
containing 1U Blend Taq -Plus (Toyobo Co., Osaka,
Japan), 1 mL of the RT first-strand cDNA product,
10 m of each forward (F) and reverse (R) primer, 75 mM TrisHCl (pH 8.3) containing 1 mg/L Tween 20,
2.5 mM dNTP and 2 mM MgCl2. Preliminary experiments
were carried out with various cycles to determine the
nonsaturating conditions of the PCR amplification for all
the genes studied. The primers are shown in Table 1.
The products were run on 2% agarose gels and stained with
ethidium bromide. The relative density of the band was
evaluated using AlphaDigiDoc 1201 software (Alpha
Innotech Co., San Leandro, CA, USA). All the measured
PCR products were normalized to the amount of cDNA of
GAPDH in each sample.
Western immunoblotting analysis of phospho-AMPK
(Thr172) proteins. Protein extractions and immunoblots for
the determination of AMPK phosphorylation were carried
out on frozen liver tissue from mice according
to a previous report (Shen et al., 2005). Briefly, liver
samples (0.1 g) were powdered under liquid nitrogen
Table 1. Primers used in this study
Gene
Accession number
Forward primer and reverse primer
PCR product (bp)
Annealing temperature (1C)
Skeletal muscle
Glut4
M25482
F: ACTGGCGCTTTCACTGAACT
R: CGAGGCAAGGCTAGATTTTG
106
55
Liver
apo C-III
NM_023114.3
F: CAGTTTTATCCCTAGAAGCA
R: TCTCACGACTCAATAGCTG
F: ACCTCTGTTCATGTCAGACC
R: ATAACCACAGACCAACCAAG
F: CTACAACTTCGGCAAATACC
R: TCCAGATACCTGTCGATCTC
F: GAACAACTAAAGCCTCTGAAAC
R: TTGCTCGATACATAAAACACTC
F:AAGCAGAGCAATGGCAGCAT
R: GAGCAATCATAGGCTGGGTCA
F: TGGAAAGATAACTGGGTGAC
R: TGCTGTCGTCTGTAGTCTTG
F: GGCTGTTGTCTACCATAAGC
R: AGGAAGAAACGTGTCAAGAA
F: TGTGTCCGTCGTGGATCTGA
R: CCTGCTTCACCACCTTCTTGA
349
47
352
55
330
52
350
50
300
50
240
50
219
50
99
55
PPARa
NM_011144
PEPCK
NM_011044.2
G6Pase
NM_008061.3
11b-HSD1
NM_008288.2
FAS
NM_007988
SREBP1c
NM_011480
GAPDH
NM_031144
Copyright © 2013 John Wiley & Sons, Ltd.
Phytother. Res. 28: 363-371 (2014)
366
C.-C. SHIH ET AL.
and homogenized for 20 s in 500 mL buffer containing 20
mM Tris-HCl (pH 7.4 at 4 1C, 2% SDS, 5 mM EDTA,
5 mM EGTA, 1 mM DTT, 100 mM NaF, 2 mM
sodium vanadate, 0.5 mM phenylmethylsulfonyl fluoride,
10 mg/mL leupeptin and 10 mL/mL pepstatin. 40 mg
of each homogenate was mixed with an equal amount of
2 Â standard SDS sample loading buffer containing
125 mM Tris-HCl (pH 6.8), 4% SDS, 20% glycerol,
10% b-mercaptoethanol and 0.25% bromophenol blue,
and boiled for 10 min before electrophoresis. Proteins were
separated by 12% SDS-PAGE according to the method of
Laemmli (1970) and transferred by electroblotting onto
PolyScreen PVDF transfer mem- brane (NEN) using
semi-dry transfer cell (Bio-Rad)
according to the manufacturer's manual. The membrane
was then treated sequentially with blocking solution
(phosphate-buffered saline containing 5% non-fat skim
milk), with appropriate dilution of anti-phospho-AMPKa
(Thr 172) antibody (Abcam Inc, USA), and with anti(G6PD) G6PD (glucose 6 phosphate dehydrogenase antibody; Abcam Inc, USA) conjugated to peroxidase
(Zymed). Finally, the membrane was soaked in a chromogen/substrate solution (TMB single solution; Zymed) for
color development.
Body weight and tissue weight
Statistical analysis. Data were expressed as mean Æ S.E.
values. Whenever possible, data were subjected to analysis of variance, followed by Dunnett's multiple range test,
using SPSS software (SPSS Inc., Chicago, IL, USA).
p < 0.05 was considered to be statistically significant.
Plasma glucose levels and homeostasis model
assessment for insulin resistance
RESULTS
All group mice started with similar mean body weights
(20.37 Æ 0.65 g). At week 12, the body weight and body
weight gain of the HF group are significantly greater than
the CON group (p < 0.05, p < 0.05, respectively).
There is no statistical difference on the body weight in
all the MCE- and Rosi-treated groups compared with the
vehicle-treated HF group (Fig. 2A), and all the
MCE-treated groups showed a significant reduction in
body weight gain over 4 weeks compared with the HF
group (Table 2). At week 12, the weights of absolute adipose tissue (epididymal, mesenteric, retroperitoneal WAT
and visceral fat) were markedly greater in the HF group
than in the CON group (epididymal WAT 181.8%,
mesenteric WAT 101.1%, retroperitoneal WAT 215.4%
and visceral fat 190.8%). Treatment with C2, C3
and Rosi significantly decreased the weights of absolute
epididymal WAT, and C1, C2, C3 and Rosi significantly
decreased the weights of absolute mesenteric, retroperitoneal WAT and visceral fat weights compared with the
HF group (Table 2, Fig. 2B). There were no significant
differences among the groups in the liver and spleen
weights (Table 2).
At week 12, the levels of glucose and insulin resistance
scores were significantly greater in the HF group than in
the CON group. Treatment with C1, C2, C3 and Rosi
showed a significant reduction in glucose levels (p < 0.01,
p < 0.01, p < 0.001, p < 0.001, respectively) (Fig. 2C) and
insulin resistance scores (Table 2) compared with the
HF group.
OGTT
As shown in Fig. 1, treatment with 0.2, 0.5 and 1.0 g/kg
MCE significantly decreased blood glucose levels at
30, 60, 90, 120 and 180 min glucose-loading when compared with the control.
CON
Extract of Momordica charantia (0.2 g/kg)
Extract of Momordica charantia (0.5 g/kg)
Extract of Momordica charantia (1.0 g/kg)
Plasma lipid
The levels of FFA, TC and TG were greater in the HF
group than in the CON group. Treatment with C3 and Rosi
decreased the concentrations of FFA and TC. Treatment
with C1, C2, C3 and Rosi decreased the TG
levels compared with the HF group (p < 0.05, p < 0.05,
p < 0.001, p < 0.05, respectively) (Table 2, Fig. 2D).
200
Glucose (mg/dl)
Leptin and insulin concentration
***
***
***
160
***
***
***
***
***
***
120
**
***
***
**
**
***
At week 12, the concentrations of leptin and insulin were
greater in the HF group than in the CON group. All the
MCE- and Rosi-treated groups significantly decreased
the levels of leptin and insulin compared with the HF
group (Table 2).
80
0
30
60
90
120
180
min
Figure 1. Effects of extract of Momordica charantia on oral glucose
tolerance in normal mice. Animals in all groups received oral glucose
30 min after the extract administration. Blood samples were collected
and centrifuged at 3000 rpm for 10 min. Each point is the
mean Æ S.E. of five or six separate mice. * p < 0.05, ** p < 0.01,
*** p < 0.001 significantly different compared with the control
group in the same time.
Copyright © 2013 John Wiley & Sons, Ltd.
Epididymal WAT histology
Feeding the HF diet induced hypertrophy of the adipocytes (Fig. 3B) compared with the CON group (Fig. 3A) in
epididymal WAT. All the MCE-treated groups de- creased
the hypertrophy compared with the HF group
(Fig. 3C-3E). The results obtained from the other mice
are similar to those shown in Fig. 3.
Phytother. Res. 28: 363-371 (2014)
367
REGULATION OF HEPATIC 11BETA-HSD1, PEPCK AND AMPK PHOSPHORYLATION
Con
HF
HF+ C1 0.1 g/Kg/day C2
HF+ 0.2 g/Kg/day C3 0.4
HF+ g/Kg/day
HF+ Rosi 0.01 g/Kg/day
A
B
3.0
36
b
a
32
a
a
a
Visceral fat Weight (g)
Body Weight (g)
a
28
24
20
16
week 0
2.5
2.0
c
c
d
1.0
0.5
0.0
Week 8
Week 9
Week 10 Week 11 Week 12
Control
HF
HF+C1 HF+C2 HF+C3 HF+Rosi
0.1
0.2
0.4
0.01 (g/Kg/day)
D
C
180
180
b
150
d
120
d
e
e
90
60
Triglyceride levels (mg/dL)
Plasma glucose levels (mg/dL)
c
1.5
150
b
120
c
c
c
e
90
60
Control
HF
HF+C1 HF+C2 HF+C3 HF+Rosi
0.1
0.2
0.4
Control
0.01 (g/Kg/day)
HF
HF+C1 HF+C2 HF+C3 HF+Rosi
0.1
0.2
0.4
0.01 (g/Kg/day)
Figure 2. Effects of extract of Momordica charantia on (A) Body weight, (B) Visceral fat weight, (C) Plasma glucose levels and (D) Triglyceride
levels at week 12. Mice were fed with 45% high-fat diet (HF) or low-fat diet (CON) for 12 weeks. After 8 weeks, the HF mice were treated with
vehicle (water), or C1, C2, C3, extracts of Momordica charantia, or Rosi: rosiglitazone (0.01 g/kg body weight) accompanied withd HF diet for
4 weeks. All values are means Æ S.E. (n=9). a p < 0.05, b p < 0.001 compared with the control (CON) group; c p < 0.05, p < 0.01,
e
p < 0.001 compared with the high-fat + vehicle (distilled water) (HF) group.
The target gene expressions in liver tissue and skeletal
muscle
As shown in Fig. 4 and Table 2, at week 12, the mRNA
levels of apo-C-III, G6Pase, PEPCK, 11b-HSD1,
SREBP1c and FAS were higher, whereas PPARa and
GLUT4 were lower in the HF group than in the CON
group. Treatment with C1, C2, C3 and Rosi significantly
decreased the mRNA level of apo-C-III, PEPCK, 11bHSD1, SREBP1c and FAS, whereas increased GLUT4
expression. The G6Pase mRNA level was lower in C2- and
C3-treated groups, whereas PPARa expression was
greater in the C2- and C3-treated groups than in the HF
group.
The phospho-AMPK (Thr172) protein contents in liver
tissue
At week 12, the contents of phospho-AMPK protein were
lower in the HF group than in the CON group
(p < 0.05). Following treatment, the liver contents of
phospho-AMPK protein increased in the C1-, C2-, C3and Rosi-treated groups compared with the HF group
(p < 0.01, p < 0.001, p < 0.001, p < 0.001, respectively)
(Fig. 4G). Clearly, there was a dose-dependent increase
Copyright © 2013 John Wiley & Sons, Ltd.
in the contents of liver AMPK phosphorylation; the extents of increase were 126.2%, 186.2% and 284.3%.
DISCUSSION
The present study demonstrated that HF feeding to
C57BL/6J mice caused insulin resistance, increased the
plasma TGs, TC and body weight. Following treatment
with MCE for 4 weeks along with HF diet could decrease blood glucose, white adipose mass, plasma lipids
and improve insulin resistance. These findings were consistent with results on lowering blood lipids and glucose
concentrations (Chen et al., 2003). Moreover, our results
show that MCE also improved hepatic lipid metabolism
and more beneficial profile of circulating adipocytokines
with decreased leptin levels. Consistent with in vitro
studies (Tan et al., 2008) implicating the AMPK phosphorylation, we observed that MCE was able to increase
hepatic AMPK phosphorylation in mice.
The present study showed that MCE exerted its ef- fects
similar to insulin sensitizers. The insulin resistance
score is significantly decreased. Since MCE resulted in
utilization of insulin, it was hypothesized that additional
mechanism of glucose lowering / insulin sensitization may
be responsible for this effect. To understand the
Phytother. Res. 28: 363-371 (2014)
368
C.-C. SHIH ET AL.
Table 2. Effects of Momordica charantia extract on absolute tissue weight, blood profiles and semiquantative RT-PCR analysis for
expression in liver and skeletal muscle tissue
Parameter
CON
HF
Dose (g/kg/day)
Absolute tissue weight (g)
HF + C1
HF + C2
HF + C3
HF + Rosi
0.1
0.2
0.4
0.01
0.935 Æ0.117e
0.264 Æ 0.033f
0.290 Æ0.054e
0.175 Æ 0.012
0.917 Æ 0.049
0.096 Æ 0.013
0.07 Æ 0.53
EWAT
MWAT
RWAT
BAT
Liver (g)
Spleen
Weight gain (g)
Blood profiles
0.567 Æ 0.047
0.371 Æ 0.026
0.208 Æ 0.024
0.087 Æ 0.006
0.881 Æ 0.018
0.087 Æ 0.013
À0.90 Æ 0.19
1.597 Æ 0.281c
0.745Æ 0.134c
0.656 Æ 0.113c
0.129 Æ 0.030
0.983 Æ 0.033
0.110 Æ 0.022
0.54 Æ 0.36a
1.112 Æ 0.088
0.453 Æ 0.031e
0.400 Æ 0.030d
0.114 Æ 0.009
0.979 Æ 0.030
0.097 Æ 0.012
À1.01 Æ 0.31d
1.071 Æ 0.111d
0.463 Æ 0.021e
0.396 Æ 0.042d
0.120 Æ 0.008
0.974 Æ 0.036
0.092 Æ 0.037
À1.13 Æ 0.23d
1.026 Æ 0.129d
0.445 Æ 0.025e
0.397 Æ 0.060d
0.124 Æ 0.008
0.911 Æ 0.029
0.102 Æ 0.013
À1.25 Æ 0.47e
FFA (meq/L)
TC (mg/dL)
Leptin (mg/mL)
Insulin (mg/L)
Insulin resistance
Liver
0.898 Æ 0.193
97.7 Æ 7.7
1.24 Æ 0.35
0.586 Æ 0.032
3.14 Æ 0.32
1.240 Æ 0.060a
146.0 Æ 8.2c
4.22 Æ 1.22b
0.902 Æ 0.116a
7.05 Æ 0.36c
1.051 Æ
129.5 Æ
2.20 Æ
0.637 Æ
4.09 Æ
1.065 Æ
129.8 Æ
2.07 Æ
0.630 Æ
3.82 Æ
0.887Æ
113.3 Æ
1.85 Æ
0.600 Æ
3.35 Æ
3.24 Æ 1.61
0.53 Æ 0.14c
0.58 Æ 0.06
1.87 Æ 0.53e
3.04 Æ 0.53f
-
2.72 Æ 0.34
1.39 Æ 0.27a
2.88 Æ 0.19d
3.44 Æ 0.32e
3.86 Æ 0.50f
3.35 Æ0.31f
PPARa
Skeletal muscle
GLUT4
0.027
5.4
0.83d
0.039d
0.41d
0.028
3.9
0.69d
0.062d
0.48e
0.139d
7.2d
0.45e
0.024d
0.20f
0.884Æ0.031e
108.3 Æ 4.2e
1.89 Æ 0.56e
0.564 Æ0.023d
3.25 Æ 0.18f
All values are means Æ S.E. (n = 9).
a
p < 0.05, bp < 0.01,
c
p < 0.001 compared with the control (CON) group;
d
p < 0.05, ep < 0.01,
f
p < 0.001 compared with the high-fat + vehicle (distilled water) (HF) group. C1, C2, C3, extracts of Momordica charantia. BAT, brown
adipose tissue; EWAT, epididymal white adipose tissue; RWAT, retroperitoneal white adipose tissue; MWAT, mesenteric white adipose
tissue; EWAT + RWAT, visceral fat; FFA, plasma free fatty acid; TC, total cholesterol. The homeostasis model assessment for insulin resistance (HOMA-IR) was used to calculate insulin resistance, according to the following formula: (milligrams of glucose per deciliter  microunits
of insulin per milliliter) Ä 405. Higher numbers indicate greater insulin resistance. Total RNA (1 mg) isolated from tissue was reverse transcripted
by MMLV-RT, 10 mL of RT products was used as templates for PCR. Signals were quantitated by image analysis; each value was normalized
by GAPDH.
mechanism of glucose lowering as well as insulin lowering, mRNA of key transcription factor that included many
genes, PEPCK, 11b-HSD1 and G-6Pase in the liver was
quantitated.
The study was designed to clarify the mechanism of
anti-diabetic effect of MCE and compare with the
marketed drug, rosiglitazone, which lowers plasma glucose primarily by insulin sensitization. In this study, MCE
also increased skeletal muscular GLUT4 mRNA levels.
The data presented here agree with previous data
(Shih et al., 2009), suggesting that MCE acts to increase
insulin sensitivity, thereby promoting glucose uptake in
peripheral tissues. In addition, hepatic glucose
overproduction is a crucial factor in diabetic hyperglycemia. Hepatic gluconeogenesis accounts for approximately
60-97% of the hepatic glucose production. PEPCK is a
key rate-limiting enzyme of gluconeogenesis. Previous
studies also showed that HF diet consumption can
upregulate PEPCK expression in mice. In the present
study, the PEPCK expression increased to a level under a
condition of HF diet. Following treatment with MCE, the
PEPCK expression restored to a level similar to the
CON group. Based on our findings described above,
MCE caused glucose lowering both by inhibiting hepatic
glucose production via decreasing PEPCK expression (Fig.
4A), and by insulin sensitization. In addition, AMPK
Copyright © 2013 John Wiley & Sons, Ltd.
activation is known to reduce hepatic gluconeogenesis and
PEPCK and glucose-6-phosphatase expression, thus
resulting in reduced glucose levels (Sun et al., 2002). This
is consistent with others studies implicating that MCE
exerted hypoglycemic activity partly by inhibition of
glucose-6-phosphatase in liver (Shibib et al., 1993). In this
study, MCE significantly increased contents of phosphoAMPK, whereas PEPCK expressions were significantly
decreased in the liver of all MCE- and rosi-treated mice.
Therefore, this might also indicate that MCE by AMPK
activation leads to decreased PEPCK expression, which
regulates hepatic glucose production, thus resulting in
causing lowering of glucose levels.
The identification of AMPK phosphorylation as a
likely mechanism is particularly interesting in relation
to diabetes and obesity because activation of AMPK
inhibits lipid synthesis and can improve insulin action
(Foretz et al., 2006; Viollet et al., 2009). Based on a number of studies showing that AMPK regulates a variety of
different metabolic disorders, it is widely recognized as a
useful and safe target for the treatment of metabolic disorders such as T2D and dyslipidemia (Foretz et al., 2006;
Viollet et al., 2009). Hence, our findings of activation of
hepatic AMPK by this fruit extract implicate this extract
with therapeutic potential for insulin resistant states by
targeting AMPK.
Phytother. Res. 28: 363-371 (2014)
REGULATION OF HEPATIC 11BETA-HSD1, PEPCK AND AMPK PHOSPHORYLATION
A
B
C
D
E
F
369
Figure 3. Effects of Momordica charantia on epididymal white adipose tissue morphology in the (A) Low-fat (LF), (B) High-fat (HF), (C) HF+C1,
(D) HF+C2, (E) HF+C3, or (F) HF+Rosi groups. Pictures of hematoxylin and eosin-stained sections of epididymal adipocytes from mice fed with C1,
C2 and C3 represent smaller sizes of adipocytes than in mice fed with vehicle-treated high-fat diet. Mice were fed with 45% high-fat diet (HF) or lowfat diet (CON) for 12 weeks. Each presented is typical and representative of nine mice.
Magnification: 10 (ocular) Â 40 (object lens). C1: 0.2, C2: 0.2 and C3: 0.4 g/kg bodyweight) extracts of Momordica charantia; Rosi:
rosiglitazone (0.01 g/kg body weight). This figure is available in colour online at wileyonlinelibrary.com/journal/ptr.
Another mechanism that could play a role in antidiabetic effect of MCE was also examined. 11b-HSD1 is
an enzyme that converts an inactive stress hormone, 11dehydrocorticosterone (in rodents), into active hor- mone,
corticosterone (in rodents), and 11b-HSD1
knockout mice (Koeilevtsev et al., 1997) are protected
from developing insulin resistance on HF diet. This enzyme is highly expressed in tissues such as liver and adipose tissue. Moreover, selective inhibition of 11b-HSD1
has been shown to improve hepatic insulin sensitivity
in hyperglycemic KKAy mice (Alberts et al., 2003).
Overexpression of 11b-HSD1 causes insulin resistance
(Alberti et al., 2007). Thus, compounds that decrease
11b-HSD1 may impart anti-diabetic effects and promote
insulin sensitivity. The data showed in Figure 4 that the
MCE-treated group caused a decrease of 11b-HSD1
mRNA in the liver. Therefore, in addition to downregulation of PEPCK, a decrease of 11b-HSD1 also contributes to the insulin sensitizing effect of MCE. Furthermore,
in the liver, glucocorticoids up-regulate the expression of
PEPCK, which controls gluconeogenesis. Thus, the
expression of PEPCK in MCE-treated mice may be
Copyright © 2013 John Wiley & Sons, Ltd.
repressed by the decreased levels of glucocorticoids from
the inhibition of 11b-HSD1 by MCE thus causing a decrease in glucose levels. The target levels for MCE should
be further identified.
With morhormetric analysis of WAT histology, it was
found that the size of white adipocytes was considerably
smaller in MCE-treated mice than in HF mice. Adipocyte size could be influenced by circulating TG.
Although the hepatic TG was not measured in the present study, based on the previous study, one could know
that liver lipid is reduced by bitter melon supplementation (Ahmed et al., 2001; Senanayake et al., 2004).
Because the liver is a major target tissue for lipid and lipoprotein metabolism, MCE may be able to mobilize fat
from adipose tissue by increasing fat catabolism in the
liver. This is supported by the present study showing that
decreased triacylglycerol synthesis in liver effec- tively
decreased adipose tissue mass, resulting in the regulation
of visceral obesity.
The second aim of this study was to clarify the mechanism of TG lowering. Following treatment with MCE, TGs
lowering occurred. Fibrates, which is PPARa
Phytother. Res. 28: 363-371 (2014)
370
C.-C. SHIH ET AL.
A
B
C
D
E
F
G
Figure 4. Semiquantative RT-PCR analysis for (A) apo C-III, (B) G6Pase, (C) PEPCK, (D) 11b-HSD1, (E) SREBP1c and (F) FAS mRNA expression and (G) Western blotting for the phospho-AMPK (Thr172) protein contents in cliver tissue of the mice by oral gavage extracts of
bitter melonefor 4 weeks. All values are means Æ S.E. (n=9). a p < 0.05, b p < 0.01, p < 0.001 compared with the control (CON) group;
d
p < 0.05, p < 0.01, f p < 0.001 compared with the high-fat + vehicle (distilled water) (HF) group. Total RNA (1 mg) isolated from tissue
was reverse transcripted by MMLV-RT, 10 mL of RT products was used as templates for PCR. Signals were quantitated by image analysis;
each value was normalized by GAPDH. Protein was separated by 12% SDS-PAGE detected by Western blot. C1, C2, C3, extracts of
Momordica charantia.
agonists, reduce the expressions of the gene encoding for
apo C-III resulting in hypotriglyceridemic effect (Staeles
et al., 1988). The study showed that MCE exhibited reducing hepatic apo-C-III expression corroborating a potential role in TGs metabolism. SREBP-1c plays an
important role in the response to activation of lipogenic
enzyme expression, fatty acid synthesis and TG accumulation (Shimano et al., 1999). FAS is the key enzyme in
fatty acid synthesis (Wakil, 1989). Following treatment
with MCE, circulating TGs lowering occurred as a result of
down-regulation of SREBP1c, which up-regulates a
number of lipogenic genes (Shimano et al., 1999). In
PPARa-deficient mice, dysregulation of SREBPmediated lipogenic genes was noticed (Patel et al., 2001),
Copyright © 2013 John Wiley & Sons, Ltd.
suggesting the role of PPARa in SREBP-mediated regulation of lipogenic genes. The present studies further confirm MCE's lipid-lowering effects partly via regulation of
genes expressions involved in lipid synthesis. The results
suggest that the major target of MCE is the enzyme
AMPK. MCE activates AMPK and results in decreased
SREBP1c expression in the liver, with consequent reduced expression of enzymes regulating fatty acid synthesis, including FAS, also leading to decreased fatty acid
synthesis.
In conclusion, our study demonstrated that MCE exerts
anti-diabetic properties in HF-fed mice as a result of
increased hepatic protein contents of AMPK
phosphorylation and decreased hepatic glucose
Phytother. Res. 28: 363-371 (2014)
371
REGULATION OF HEPATIC 11BETA-HSD1, PEPCK AND AMPK PHOSPHORYLATION
production, and the decreased expression of 11b-HSD1,
which contributed in attenuating diabetic state. More- over,
MCE lowered circulating TGs by down-regulating genes of
fatty acid synthesis, including SREBP1c and FAS mRNA,
thus resulting in reduction in TGs synthesis.
This study first demonstrated M.charantia exhibited antidiabetic and anti-hyperlipidemic activity by different
mechanism in liver tissue.
Acknowledgements
This work was supported in part by a grant CTU97-9-1 from the Central
Taiwan University of Science and Technology.
Conflict of Interest
The authors have declared that there is no conflict of interest.
REFERENCES
Ahmed I, Lakhani MS, Gillett M, John A, Raza H. 2001.
Hypotriglyceridemic and hypocholesterolemic effects of antidiabetic Momordica charantia (karela) fruit extract in
streptozotocin-induced diabetic rats. Diabetes Res Clin Pract
51: 155-161.
Alberti L, Girola A, Gilardini L, et al. 2007. Type 2 diabetes and
metabolic syndrome are associated with increased expression of
11beta hydroxysteroid dehydrogenase 1 in obese subjects.
Int J Obes (Lond) 31: 1826-1831.
Alberts P, Nilsson C, Selen G, et al. 2003. Selective inhibition of
11b-hydroxysteroid dehydrogenase type 1 improves hepatic
insulin sensitivity in hyperglycemic mice strains. Endocrinology
144: 4755-4762.
Chen Q, Chan LLY, Li ETS. 2003. Bitter melon (Momordica
charantia) reduces adiposity, lowers serum insulin and normal- izes
glucose tolerance in rats fed a high fat diet. J Nutr 133:
1088-1093.
Foretz M, Taleux N, Guigas B, et al. 2006. Regulation of energy
metabolism by AMPK: a novel therapeutic approach for the
treatment of metabolic and cardiovascular diseases. Med SCI
(Paris) 22: 381-388.
Ho HA, Lin WC, Kitanaka S, Chang CT, Wu JB. 2008. Analysis of
bioactive triterpenes in Eriobotrya japonica Lindl. by highperformance liquid chromatography. J Food Drug Anal 16:
41-45.
Koeilevtsev Y, Holmes MC, Burchell A, et al. 1997. 11bhydroxysteroid dehydrogenase type 1 knockout mice show
attenuated glucocorticoid-inducible responses and resist
hyperglycemia on obesity or stress. Proc Natl Acad Sci USA
94: 14924-14929.
Laemmli UK. 1970. Cleavage of structure proteins during the
assembly of the head of bacteriophage T4. Nature 227:
680-685.
Matsuda H, Li Y, Murajami T, Matsumura N, Yamahara J,
Yoshikawa M. 1998. Antidiabetic principles of natural medi- cines,
Part III. Structure-related inhibitory activity and action mode of
oleanolic acid glycosides on hypoglycemic activity.
Chem Pharm Bull (Tokyo) 46: 1399-1403.
Patel DD, Knight BL, Wiggins D, Humphreys SM, Gibbons GF.
2001. Disturbances in the normal regulation of SREBP- sensitive
genes in PPAR alpha-deficient mice. J Lipid Res 42:
328-337.
Petro AE, Cotter J, Cooper DA, Peters JC, Surwit SJ, Surwit RS.
2004. Fat, carbohydrate and calories in the development of diabetes and obesity in the C57BL/6J mouse. Metabolism 53:
454-457.
Raman A, Lau C. 1996. Anti-diabetic properties and phytochemistry
of Momordica charantia L. (Cucurbitaceae). Phytomedicine 2:
349-362.
Copyright © 2013 John Wiley & Sons, Ltd.
Reaven GM, Laws A. 1994. Insulin resistance, compensatory
hyperinsulinemia, and coronary heart disease. Diabetologia
37: 948-952.
Senanayake GVK, Maruyama M, Shibuya K, et al. 2004. The effects of bitter melon (Momordica charantia) on serum and liver
triglyceride levels in rats. J Ethnopharmacol 91: 257-262.
Shen QW, Jones CS, Kalchayanand N, Zhu MJ, Du M. 2005. Effect of dietary alpha-lipoic acid on growth, body composition,
muscle pH, and AMP-activated protein kinase phosphorylation
in mice. J Anim Sci 83: 2611-2617.
Shibib BA, Khan LA, Rahman R. 1993. Activity of Coccinia indica
and Momordica charantia in diabetic rats: depression of the hepatic
gluconeogenic enzymes glucose-6-phosphatase and fructose-1, 6bisphosphatase and elevation of both liver and red-cell shunt
enzyme glucose-6-phosphate dehydrogenase.
Biochem J 292: 267-270.
Shih CC, Lin CH, Lin WL. 2008. Effects of Momordica charantia on
insulin resistance and visceral obesity in mice on high-fat diet.
Diabetes Res Clin Pract 81: 134-143.
Shih CC, Lin CH, Lin WL, Wu JB. 2009. Momordica charantia extract on insulin resistance and the skeletal muscle GLUT4 protein in fructose-fed rats. J Ethnopharmacol 123(1): 82-90.
Shimano H, Yahagi N, Amemiya-Kudo M et al. 1999. Sterol regulatory element-binding protein-1 as a key transcription factor for
nutritional induction of lipogenic enzyme genes. J Biol Chem
274: 35832-35839.
Sridhar MG, Vinayagamoorthi R, Arul Suyambunathan V, Bobby Z,
Selvaraj N. 2008. Bitter goud (Momordica charantia) improves
insulin sensitivity by increasing skeletal muscle insulin- stimulated
IRS-tyrosine phosphorylation in high-fat-fed rats.
Br J Nutr 99: 806-812.
Staeles B, Dallongeville J, Auwerx J, Schoonjans K, Leitersdorf E,
Fruchart JC. 1988. Mechanism of action of fibrates on lipid
and lipoprotein metabolism. Circulation 98: 2088-2093.
Stein SC, Woods A, Jones NA, Davison MD, Carling D. 2000. The
regulation of AMP-activated protein kinase by phosphorylation.
Biochem J 345: 437-443.
Sun Y, Liu S, Fergusort S, et al. 2002. Phosphoenolpyruvate
carboxykinase overpression selectively attenuates insulin signaling and hepatic insulin sensitivity in transgenic mice. J Biol
Chem 277: 23301-23307.
Tan M-J, Ye J-M, Turner N, et al. 2008. Antidiabetic activities of
triterpenoids isolated from bitter melon associated with activation of the AMPK pathway. Chem Biol 15: 263-273.
Viollet B, Lantier L, Devin-Leclerc J, et al. 2009. Targeting the
AMPK pathway for the treatment of Type 2 diabetes. Front
Biosci 14: 3380-3400.
Wakil S. 1989. Fatty acid synthase, a proficient multifunctional
enzyme. Biochemistry 28: 4523-4530.
Phytother. Res. 28: 363-371 (2014)