Supplemental Figure 1. Analysis of Stat1 mRNA following
chrysarobin treatment. FVB mice received a single topical
treatment with either 0.2 mL acetone (Ace) or 220 nmol CHRY in
0.2 mL acetone. Epidermal mRNA was isolated from individual
mice (n=3-5/group) and the values shown represent the mean ±
SEM. *Indicates value was significantly different from the acetone
control group (Mann-Whitney U-test, p<0.05).
Supplemental Figure 2. Effect of Stat1 deficiency on epidermal proliferation
following topical application of TPA. Stat1+/+ or Stat1-/- mice received either TPA (3.4,
6.8, or 13.6 nmol) in 0.2 mL acetone or vehicle alone 2x/week for 2 weeks. Epidermal
thickness and labeling index (LI) were determined as described in the Materials and
Methods. (A) Representative BrdU (left) and H&E (right) stained skin sections from
acetone and TPA treated mice. (B) Quantitation of epidermal LI and thickness. Values in
(B) represent mean ± SD.
Supplemental Figure 3. Effect of Stat1 deficiency on epidermal proliferation
following topical application of CHRY. Stat1+/+ or Stat1-/- mice received either CHRY
(100, 220, or 440 nmol) in 0.2 mL acetone or vehicle alone 1x/week for 4 weeks.
Epidermal thickness and labeling index were determined as described in Materials and
Methods. (A) Representative BrdU (left) and H&E (right) stained skin sections from
acetone and CHRY treated mice. (B) Values represent mean ± SD. *Indicates value is
significantly different than the value for the Stat-/- mice (Student’s t-test, p<0.05).
Supplemental Figure 4. Impact of Stat1 deficiency on Cox-2 expression and
prostaglandin E2 (PGE2) levels following tumor promoter treatment. (A) Stat1+/+ or
Stat1-/- mice received either acetone (Ace) or 6.8 nmol TPA 2x/week for 2 weeks, or 220
nmol CHRY 1x/week for 4 weeks and were sacrificed at the indicated time points after the
last treatment. Cox-2 protein levels were evaluated by Western blot. Graphs to the right
of the Western blot represent the quantitation of relative Cox-2 protein levels using actin as a loading control. (B) Stat1+/+ or Stat1-/- mice received either four applications of
TPA (6.8 nmol 2x/week for 2 weeks) or a single dose of CHRY (220 nmol) in 0.2 mL
acetone. At the indicated times after the last treatment, the dorsal skin was excised and
snap frozen with liquid nitrogen. Frozen epidermis was chipped into PGE2 lysis buffer.
PGE2 was measured according to the manufacturer’s instructions (Prostaglandin E2 EIA
Kit – Monoclonal; Cayman Chemical, Ann Arbor, MI).
Supplemental Figure 5. Analysis of inducible nitric oxide synthase
(iNos) mRNA expression in response to tumor promoter treatment.
Stat1+/+ or Stat1-/- mice received either (A) TPA (6.8 nmol 2x/week for 2
weeks) or (B) CHRY (220 nmol 1x/week for 4 weeks) in 0.2 mL acetone.
The mRNA data is expressed as mean ± SD from epidermis of 3-5
individual mice per group. *Indicates that the values were significantly
different (Mann-Whitney U-test, p<0.05).
Supplemental Table 1. Primers for RT-qPCR analysis of gene expression
Gene
Forward Primer Sequence
Reverse Primer Sequence
Cox-2
IRF-1
IFN
iNOS
Stat1
CAAGACAGATCATAAGCGAGGA
AATTCCAACCAAATCCCAGG
TGAACGCTACACACTGCATCTTGG
TGAAGAAAACCCCTTGTGCT
TCCCGTACAGATGTCCATGAT
GAPDH
TGTTCCAGAGACGGCCGCATCTTC AATGGCAGCCCTGGTGACCAGGC
GGCGCAGTTTATGTTGTCTGT
AGGCATCCTTGTTGATGTCC
CGACTCCTTTTCCGCTTCCTGAG
TTCTGTGCTGTCCCAGTGAG
CTGAATATTTCCCTCCTGGG