SUPPORTING METHODS
Analysis of alanine and aspartate transaminase activity. ALT and AST levels in the blood
were analyzed by an outside service center, Antech Diagnostics (Memphis, Tennessee).
Statistical analysis. Data are expressed as mean of +/- standard error of the mean. Statistical
significance at p< 0.05 was determined using student’s T test analysis.
In vitro IFNγ induction in a co-culture of splenocytes and hepatocytes. One million
NTCT1649 hepatocyte cells (ATCC, Manassas, VA) were co-incubated with or without 2x106
splenocytes in the presence or absence of IL12 (50 ng/mL) in a 6 well-plate. Supernatant was
obtained at the indicated times and was analyzed via ELISA.
Quantitative real-time PCR. Samples were prepared and processed as previously described
(47) The forward and reverse primer sequences (5’-3’) for the control gene and candidate genes
are as follows respectively: Gapdh: CCAGCCTCGTCCCGTAGAC,
CGCCCAATACGGCCAAA; IFNγ: CTGCTGATGGGAGGAGATGTCT,
TGCTGTCTGGCCTGCTGTTA; mIL30: GGCCATGAGGCTGGATCTC,
AACATTTGAATCCTGCAGCCA; and mEBI3: TGAAACAGCTCTCGTGGCTCTA,
CACGGCCACGGGATACC. Normalized data of IL30 expression in human liver samples from
reference 36 were downloaded from Oncomine™ (Compendia Bioscience, Ann Arbor, MI).
In vitro IL30 induction with rIL12, and rIFNγ, in Macrophage, Dendritic and Monocyte
Cells. Preparation of BMDM and DC was conducted according to methods establish by Lutz et
al (46). The following cytokines were used: rGMCSF (20ng/ml, Antigenix America, Hunington
Station, NY), rIFNγ, and rIL12 (50 ng/well, R & D System). To detect IL12-mediated IL30
induction, 5x105 cells per well were seeded in 750 µl of heat-inactivated RPMI media and
incubated 72 hours with rIL12. To detect IFNγ-mediated IL30 induction, 5x105 cells per well
cells were seeded in 250 µl of heat-inactivated RPMI media and incubated 24 h with 50 ng of
rIFNγ. To compare IL30 induction among wildtype , IFNγ-/-, and IFNγR1-/- splenocytes,
splenocytes from these mice were seeded in a 24-well plate at 5x105 cell per well in 750 µl of
heat-inactivated RPMI media and incubated for 72 h rIL-12 or IFNγ.
Gene constructs. The gene clones used in this study include IL12, IL27, IFNγ, IL30, EBI3, and
luciferase. IL12 was obtained from Valentis, Inc. via a MTA. IL27 is a generous gift from Dr.
Masatoshi Tagawa (Chiba Cancer Center Research Institute, Japan). From this plasmid, both
subunits of IL27 were subcloned to our control vector pVC1157 to yield the pIL27 encoding
gene construct; the IL30 unit was subcloned to pVC1157 to yield pIL30 encoding construct; and
EBI3 was subcloned to pDSRed-Express-N1 to yield pEBI3 encoding construct. Murine IFNγ
was amplified from murine spleen cells by RT-PCR using the forward and backward primers 5’ATGAACGCTACACACTGCAT-3’and 5’-TCAGCAGCGACTCCTTTC-3’, respectively. The
DNA fragment was cloned into the same expression vector as for IL12. All new clones were
confirmed by sequence and biological activity analyses.
To determine if IL12 signaling-mediated induction of IL30 is STAT1 dependent,
different STAT1 binding sites were removed from IL30 promoter. The IL30 promoter fragment
(4.3 kb) was divided into two fragments for easy amplification from mouse genomic DNA using
GeneAmp XL PCR kit (Applied Biosystems, Foster city, CA). The 2 kb fragment, proximal to
transcription starting site and with two proximal STAT1 binding sites (referred to as STAT1
binding site ‘b’ and ‘c’), was amplified with primers 5’-
ACTCGAGTTTCAAGGGGCATGGTGT-3’ and 5’-AAAGCTT
CAGCCATCTCCTGGGTAGG-3’, cloned into a TA cloning vector, and sub-cloned into the
firefly luciferase pGL3-basic vector (LSU304). The STAT1 binding site ‘b’ was removed from
LSU304 using a full plasmid DNA PCR-based mutagenesis procedure (LSU377) with the
following primers and DNA polymerase: 5’-gGaattccGCTTCCAGGACTTGCTATTT-3’/5’GGAATTCCAGGGAAGCTGGAGCAGAA-3’ and the PfuTurbo® (Stratagene, La Jolla, CA).
The distal IL30 promoter fragment (approximately 2.3 kb) containing the most distal STAT1
binding sites ‘a’ was PCR amplified with primers 5’CTCGAGCCAGAGAGTGATTTTCAAGGG-3’ and 5’CTCGAGCAACCAAAAGCACCCACTTATC-3’, ligated to LSU304, yielding plasmid
LSU381 which contains all three STAT1 binding sites. The same distal fragment of IL30
promoter region without the distal STAT1 binding site ‘a’ was also amplified using primer 5’ctcgagAGCTGCGTGCCTTGTTTG-3’ and 5’-CTCGAGCAACCAAAAGCACCCACTTATC3’ and ligated to LSU304 or LSU377 clones to yield LSU382 and LSU385, respectively. STAT1
binding site ‘a’ is absent in LSU382 while ‘b’ is absent in LSU385.
In vitro transfection and reporter gene assay. Plasmid DNA containing luciferase gene was
mixed with resuspended Raw264.7 cells (2 µg DNA for each 1x106 cells) and electroporated
with one 150-volt and 75-msec pulse. Transfected cells were treated without or with recombinant
IFNγ (R&D System, Minneapolis, MN; 100 ng per well), IL27 (R&D System; 20 ng per well),
or a combination for 24 hours. Luciferase activity was determined from cell lysates using
LumiCount (PerkinElmer, Downers Grover, IL).
In vivo ConA model. In the acute studies, mice were injected in the tail vein with 20 mg/kg of
ConA (Sigma) via tail. 72 hours prior to the ConA administration, a one-time treatment of 4 ug
of either control or IL30- DNA encoding plasmid was injected into the mice followed by
electroporation. Liver tissue was harvested 24 hours post ConA administration; fixed, paraffinembedded, and 5 um slides were stained for HE. In the chronic model of liver fibrosis, mice were
treated with 8 mg/kg of ConA via tail vein once a week for 6 weeks. Last three weeks mice were
treated once a week with 4 ug of either control or IL30- DNA encoding plasmid was injected
into the mice followed by electroporation. Liver tissue was harvested 1 week post last ConA
administration. Tissue was paraffin embedded, stained, and 5 um slides were stained for αSMA
and Mason’s Trichrome Staining.
Immunohistochemistry for IL30 and Mason’s Trichrome staining. Paraffin-embedded
unstained slides of liver tissue sections from patients that suffer from cirrhosis, hepatocellular
carcinoma, or from healthy patients were deparaffinized, heat-induced antigen retrieval in pH 6.0
citrate buffer, blocked with 4% fish gelatin, then incubated with isotype or primary IL30
(LifeSpan Biosciences, Seattle, WA) at 5 ug/ml overnight at 4C in fish gelatin blocking buffer,
followed by MACH 4 universal HRP polymer detection (Biocare Medical, Concord, CA).
Tissue from patients was approved from the appropriate institutional review committee. These
tissues were not obtained from executed prisoners or other institutionalized persons.
Mason’s Trichrome staining was performed according the manufacturer’s instructions
(Diagnostic Biosystems, Pleasanton, CA). Percentage of area affected on the micrographs was
quantified via using Nikon NIS Elements automated analysis software (Melville, NY).