file
advertisement
SM Table 1: The genes of FZB42 with known function whose transcriptions were significantly altered in response to maize root exudates at OD3.0 (Refer to experiment “Response to RE”: E-MEXP-3421). Gene FCH divIC ftsH ftsL ftsZ minC ywkC 1.7 1.5 1.7 1.7 1.6 -1.5 pbpF murB tuaB ymfM yoeB 1.5 1.6 -1.5 1.5 1.6 yjlD resA atpC atpH atpF qoxB qoxA 1.6 1.7 1.6 1.7 1.5 1.6 1.6 fliM fliP cheC cheD hag flgM 2.0 1.7 1.7 -1.5 3.6 1.7 luxS ymcA 1.7 2.5 secE secY tatAy tatCy lytA 1.7 2.0 1.6 1.6 1.5 rapA ypeB sda spoIIB sspI 1.7 1.5 1.7 -1.7 -1.7 Product 1_Cell envelope and cellular processes 1.7_ Cell division cell-division initiation protein DivIC cell division protein and general stress protein(class III heat-shock protein) FtsH cell-division protein FtsL cell-division initiation protein FtsZ cell-division inhibitor (septum placement) MinC cell division protein: attaches the chromosome to the cell pole 1.1_ Cell wall penicillin-binding protein 2C PbpF UDP-N-acetylenolpyruvoylglucosamine reductase MurB teichuronic acid biosynthesis protein TuaB required for cell shape determination inhibits in vitro activity of cell wall endopeptidases LytE and LytF, inhibits cell separation 1.4_ Membrane bioenergetics NADH dehydrogenase-like protein YjlD thiol-disulfide oxidoreductase ResA ATP synthase (subunit epsilon) AtpC ATP synthase (subunit delta) AtpH ATP synthase (subunit B) AtpF quinol oxidase polypeptide I QoxB quinol oxidase subunit II precursor QoxA 1.5_ Mobility and chemotaxis flagellar motor switch protein FliM flagellar biosynthetic protein FliP chemotaxis protein CheC chemotaxis protein CheD flagellin proteinHag negative regulator of flagellin synthesis (Anti-sigma-D factor) FlgM 1.3_ Sensors (signal transduction) s-ribosylhomocysteine lyase LuxS antagonist of biofilm repression by SinR, regulation of biofilm formation 1.6_ Protein secretion preprotein translocase subunit SecE preprotein translocase subunit SecY sec-independent protein translocase protein TatAy sec-independent protein translocase protein TatCy membrane bound lipoprotein LytA 1.8_ Sporulation response regulator aspartate phosphatase RapA sporulation protein YpeB sporulation inhibitor Sda endospore development protein SpoIIB small acid-soluble spore protein SspI cotG yabP 1.7 2.1 comS med 1.7 -1.6 gutA citM glvC appF oppA oppD oppF cysP ebrB araQ araP araN amyC mscL licA iolF rocE ykoE 2.8 2.4 2.5 1.5 1.5 1.5 1.6 1.8 1.8 1.9 2.4 2.2 1.8 1.8 1.5 2.1 4.0 -1.5 spore coat protein G (CotG) required for sporulation at a late stage 1.1_ Transformation/competence competence protein S ComS transcriptional activator protein med precursor Med 1.2_ Transport/binding proteins and lipoproteins probable glucitol transport protein GutA magnesium citrate secondary transporter CitM phosphotransferase system (PTS) maltose-specificenzyme IICB component GlvC oligopeptide transport ATP-binding protein AppF oligopeptide ABC transporter (binding protein) OppA oligopeptide ABC transporter (ATP-binding protein) OppD oligopeptide ABC transporter (ATP-binding protein) OppF sulfate permease CysP multidrug resistance protein EbrB L-arabinose transport system permease protein AraQ L-arabinose transport system permease protein AraP probable arabinose-binding protein precursor AraN maltose transport protein AmyC Large conductance mechanosensitive channel protein MscL phosphotransferase system (PTS) lichenan specific enzyme IIA component LicA inositol transport protein IolF amino acid permease RocE thiamine ABC transporter (membrane protein), thiamine uptake 2_Intermediary metabolism 2.1_ Metabolism of carbohydrates and related molecules acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase) AcoL acoL 1.5 ald ansA araB araD araL araM citB citZ galE1 galK1 galT1 gapB -2.4 1.6 1.7 1.8 2.6 2.3 1.7 2.3 1.6 5.3 4.2 1.6 alanine dehydrogenase Ald L-asparaginase AnsA L-ribulokinase AraB L-ribulose-5-phosphate 4-epimerase AraD arabinose operon protein L (AraL) arabinose operon protein M (AraM) aconitate hydratase CitB citrate synthase II CitZ UDP-glucose 4-epimerase GalE1 galactokinase GalK1 galactose-1-phosphate uridyltransferase GalT1 glyceraldehyde-3-phosphate dehydrogenase GapB glpK 1.5 glycerol kinase (ATP:glycerol 3-phosphotransferase) (Glycerokinase) GlpK glvA 5.2 maltose-6'-phosphate glucosid GlvA iolB 2.7 inositol utilization protein B (IolB) iolC 4.2 inositol utilization protein C (IolC) iolD 4.2 inositol utilization protein D (IolD) iolE 2.8 inositol utilization protein E (IolE) iolG 2.5 myo-inositol 2-dehydrogenase IolG iolI 2 inositol utilization protein I (IolI) iolS 1.7 inositol utilization protein S (IolS) lacE 1.6 phosphotransferase system (PTS) lichenan-specific enzyme IIC component LacE lacF 1.8 phosphotransferase system cellobiose-specific component LacF licH 1.6 6-phospho-beta-glucosidase LicH mdh 1.9 malate dehydrogenase Mdh odhB 2 pdhC 1.5 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex OdhB pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit) PdhC pgi 1.5 glucose-6-phosphate isomerase Pgi pgk 2.4 phosphoglycerate kinase Pgk pgm2 1.8 phosphoglyceromutase Pgm2... rpe 1.5 ribulose-5-phosphate 3-epimerase Rpe sdhB 1.5 succinate dehydrogenase (iron-sulfur protein) SdhB sucC 1.9 succinyl-CoA synthetase (beta subunit) SucC sucD 1.7 succinyl-CoA synthetase (alpha subunit) SucD ydjE 1.6 fructokinase homolog YdjE gcvPB 1.6 glycine decarboxylase (subunit 2) (glycine cleavage system protein P) GcvPB gcvT 1.8 aminomethyltransferase (glycine cleavage system protein T) GcvT gudB 1.5 NAD-specific glutamate dehydrogenase GudB iolA 2.7 methylmalonate-semialdehyde dehydrogenase IolA kbl 2.2 2-amino-3-ketobutyrate coenzyme A ligase Kbl... proA -1.6 gamma-glutamyl phosphate reductase ProA rocD rocF tdh thrB 6.5 5.4 3.2 -1.5 pabC hepT folC ywkE 1.7 2.0 1.7 1.6 scoB yngG bkdB 1.6 -1.5 1.9 bkdAA 1.7 bcd 1.8 nin pyrF pyrH cdd 1.5 -1.6 1.5 1.7 2.2_ Metabolism of amino acids and related molecules ykrL degR grpE ytxG yqjL yqeZ 1.5 1.5 1.5 1.5 1.5 2.0 yceD yceE 1.7 1.8 ornithine aminotransferase RocD arginase RocF L-threonine 3-dehydrogenase Tdh homoserine kinase ThrB 2.5_ Metabolism of coenzymes and prosthetic groups aminodeoxychorismate lyase PabC heptaprenyl diphosphate synthase component II HepT folyl-polyglutamate synthetase FolC hemK protein homolog YwkE 2.4_ Metabolism of lipids succinyl CoA:3-oxoacid CoA-transferase (subunit B) ScoB hydroxymethylglutaryl-CoA lyase homolog YngG branched-chain alpha-keto acid dehydrogenase E2 subunit (lipoamide acyltransferase) BkdB branched-chain alpha-keto acid dehydrogenase E1 subunit (2-oxoisovalerate dehydrogenase alpha) bBkdAA leucine dehydrogenase Bcd 2.3_ Metabolism of nucleotides and nucleic acids inhibitor of the DNA degrading activity of NucA (competence) Nin orotidine 5'-phosphate decarboxylase PyrF uridylate kinase PyrH cytidine deaminase Cdd 4_Other functions 4.1_ Adaptation to atypical conditions protease htpx homolog YkrL regulatory protein DegR heat-shock protein GrpE general stress protein general stress protein, putative hydrolase involved in oxidative stress resistance seine protease, resistence protein (against sublancin) 4.2_ Detoxification general stress protein, similar to tellurium resistance protein general stress protein, similar to tellurium resistance protein yceF yfhL 1.7 1.5 ctaG era yurV 1.5 2.2 1.7 xhlA 1.6 baeE baeI baeL baeN baeR difJ difI difG difF mlnH fenE srfAD srfAC 1.6 2.2 1.9 1.5 2.3 2.0 1.7 2.0 2.4 1.5 1.5 1.9 1.7 recA 1.6 priA ssb yneE 1.5 1.6 -1.5 map prpC 3.1 1.7 alaS fusA tufA lepA infA infB infC rplA rplJ rplD rpsM rpsK rplM rpsI rpsO rpmGA rpsU rpmA rplU rpsR -1.5 2.2 1.5 1.5 2.0 1.6 1.8 1.7 2.0 1.8 1.6 1.6 1.8 1.7 1.6 1.7 3.1 1.6 2.0 2.1 general stress protein, similar to tellurium resistance protein general stress protein, resistence protein (against toxic peptide SdpC) 4.6_ Miscellaneous formation of functional cytochrome C-oxidase (caa3) GTP-binding protein Era iron-sulfur cofactor synthesis protein nifU homolog YurV 4.4_ Phage-related functions phage-like element PBSX protein XhlA 4.3_ Antibiotic production malonyl-CoA-[acyl-carrier protein] transacylase BaeE enoyl-CoA-hydratase BaeI polyketide synthase BaeL hybrid NRPS/PKS BaeN polyketide synthase BaeR modular polyketide synthase of type I DifJ modular polyketide synthase of type I DifI modular polyketide synthase of type I DifG modular polyketide synthase of type I DifF polyketide synthase of type I MlnH fengycin synthetase FenE surfactin synthetase D SrfAD surfactin synthetase C SrfAC 3_Information pathways 3.3_ DNA recombination multifunctional SOS repair regulator RecA 3.1_ DNA replication primosomal protein N' PriA single-strand DNA-binding protein (Helix-destabilizing protein) Ssb sporulation protein, inhibits DNA replication, control of chromosome copy number 3.8_ Protein modification methionine aminopeptidase Map protein phosphatase PrpC 3.7_ Protein synthesis alanyl-tRNA synthetase AlaS elongation factor G FusA elongation factor Tu TufA GTP-binding protein LepA translation initiation factor IF-I InfA initiation factor (IF-2) InfB initiation factor IF-3 InfC ribosomal protein L1 (BL1) RplA ribosomal proteinL10 (BL5) RplJ ribosomal protein L4 RplD ribosomal protein S13 RpsM ribosomal protein S11 (BS11) RpsK ribosomal protein L13 RplM ribosomal protein S9 RpsI ribosomal protein S15 (BS18) RpsO 50S ribosomal protein L33 type I RpmGA ribosomal protein S21 RpsU 50S ribosomal protein L27 (BL30) (BL24) RpmA 50S ribosomal protein L21 (BL20) RplU ribosomal protein S18 RpsR trmU 1.5 ydcE 1.5 yjbH ykqC 1.5 1.6 ymdA 1.6 rpoC rpoA sigW yjbD glvR perR glpP hpr fapR glnR hrcA phoP spoIIID yqzJ 1.9 2.0 2.4 1.5 4.4 2.2 1.8 1.5 1.5 1.8 1.9 1.9 -1.5 1.5 3.6_ RNA modification tRNA (5-methylaminomethyl-2-thiouridylate) methyltransferase TrmU 3.5_ RNA synthesis RNase EndoA, MazF family toxin, cleaves cellular mRNAs at specific, but frequently occuring sites adaptor protein for ClpX-ClpP-catalyzed Spx degradation RNase J1, RNA processing, subject to Clp-dependent proteolysis upon glucose starvation RNase Y, 5' end sensitive endoribonuclease, involved in the degradation/processing of mRNA RNA polymerase (beta subunit) RpoC RNA polymerase (alpha subunit) RpoA rNA polymerase ECF-type sigma factor SigW Transcriptional regulator Spx, involved in regulation of many genes. HTH-type transcriptional regulator GlvR peroxide operon regulator PerR glycerol uptake operon antiterminator regulatoryprotein GlpP protease production regulatory protein Hpr transcription factor (Fatty acid and phospholipid biosynthesis regulator) FapR glutamine synthetase transcription repressor GlnR heat-inducible transcription repressor HrcA alkaline phosphatase synthesis transcriptional regulatory protein PhoP stage III sporulation protein D (SpoIIID) ribosome-nascent chain sensor of membrane protein biogenesis Remark: FCH: fold change. All genes listed were with a q value of no more than 0.01 and a fold change of no less than 1.5. Those with a minus value of fold change are the genes which were down-regulated by the root exudates. SM Table 2: The genes of FZB42 with putative function or encoding hypothetical protein whose transcriptions were significantly altered in response to maize root exudates at OD3.0 (Refer to experiment “Response to RE”: E-MEXP-3421). Gene FCH ykqB yqeW yyaJ ytrE yufN RBAM00714 RBAM03581 RBAM00715 yknZ ytnA ytmK 1.6 -1.5 -1.6 -1.5 1.7 -1.5 -1.5 -1.7 1.7 1.9 1.6 cimH ydjK 1.6 2.3 mrsK2 1.5 yacA 1.5 pgm1 lacG ycsN ydjL epsE RBAM02462 2.4 2.7 1.6 1.5 1.5 -1.5 ymfH yisK cysC yurP yurL -1.5 1.6 1.5 -1.9 -1.5 yabR 1.7 ycsD yusL ydbM ptb 1.8 1.6 1.5 1.7 yvgQ 1.5 Product 1_cell envelope and cellular processes 1.2_ Transport/binding proteins and lipoproteins conserved hypothetical protein YkqB conserved hypothetical protein YqeW conserved hypothetical protein YyaJ hypothetical ABC transporter ATP-binding proteinYtrE hypothetical lipoprotein YufN putative ABC transporter (ATP-binding protein) RBAM00714 putative ABC transporter ATP-binding protein RBAM03581 putative ABC transporter permease RBAM00715 putative ABC transporter permease YknZ putative amino acid permease YtnA putative amino-acid ABC transporter (extracellular binding protein) YtmK putative citrate/malate transporter CimH putative sugar transporter YdjK 1.3_ Sensors (signal transduction) putative sensor histidine kinase MrsK2 1.7_ Cell division conserved hypothetical protein YacA 2_intermediary metabolism 2.1_ Metabolism of carbohydrates and related molecules predicted phosphatase/phosphohexomutase Pgm1 putative 6-phospho-beta-galactosidase LacG putative aryl-alcohol dehydrogenase YcsN putative dehydrogenase YdjL putative exopolysaccharide biosynthesis protein EspE putative polysaccharide deacetylase RBAM02462 2.2_ Metabolism of amino acids and related molecules conserved hypothetical protein YmfH putative 5-oxo-1,2,5-tricarboxilic-3-penten aciddecarboxylase YisK putative adenylyl-sulfate kinase CysC putative glutamine-fructose-6-phosphate transaminase YurP putative sugar kinase YurL 2.3_ Metabolism of nucleotides and nucleic acids putative polyribonucleotide nucleotidyltransferase YabR 2.4_ Metabolism of lipids conserved hypothetical protein YcsD putative 3-hydroxyacyl-CoA dehydrogenase YusL putative butyryl-CoA dehydrogenase YdbM putative phosphate butyryltransferase Ptb 2.7_Metabolism of sulfur putative sulfite reductase YvgQ 3_information pathways yrrC -1.5 ydeB yvyD ybbM 2.9 1.8 3.2 yybE lacR RBAM00542 -1.7 1.5 -1.7 ybxF 2.0 yxaL 1.5 yceH 1.7 dfnY 1.7 veg 2.8 3.3_ DNA recombination conserved hypothetical protein YrrC 3.5_ RNA synthesis conserved hypothetical protein YdeB conserved hypothetical protein YvyD predicted transmembrane transcriptional regulator (anti-sigma W factor) YbbM putative HTH-type transcriptional regulator YybE putative lactose phosphotransferase system repressor protein LacR putative transcriptional regulator (GntR family)RBAM00542 3.7_ Protein synthesis conserved hypothetical protein YbxF 3.8_ Protein modification conserved hypothetical protein YxaL 4_other functions 4.2_ Detoxification putative toxic anion resistance protein YceH 4.3_ Antibiotic production hypothetical protein DifY 4.6_ Miscellaneous conserved hypothetical proteinVeg Remark: FCH: fold change. All genes listed were with a q value of no more than 0.01 and a fold change of no less than 1.5. Those with a minus value of fold change are the genes which were down-regulated by the root exudates. SM Table 3: The genes of FZB42 with unknown function whose transcriptions were significantly altered in response to maize root exudates at OD3.0 (Refer to experiment “Response to RE”: E-MEXP-3421). Gene FCH engC 1.8 Description Similar to unknown proteins from B. subtilis RBAM00434 RBAM00435 2.5 1.7 No similarity Similar to unknown proteins from other organisms RBAM00520 RBAM00685 2.3 1.5 Similar to unknown proteins from other organisms No similarity RBAM01042 RBAM01125 1.6 -1.5 Similar to unknown proteins from other organisms Similar to unknown proteins from other organisms RBAM01763 RBAM01835 -2 -1.6 Similar to unknown proteins from other organisms No similarity RBAM01886 RBAM01923 1.5 -1.5 No similarity No similarity RBAM01955 RBAM02215 1.5 1.6 Similar to unknown proteins from other organisms Similar to unknown proteins from other organisms RBAM02992 RBAM03094 1.6 1.7 No similarity Similar to unknown proteins from other organisms RBAM03224 RBAM03268 -1.6 1.9 No similarity Similar to unknown proteins from other organisms RBAM03561 RBAM03844 1.8 -1.8 No similarity No similarity RBAM03862 yaaA -1.6 1.9 No similarity Similar to unknown proteins from B. subtilis yaaR ybbR 1.6 1.5 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ybfQ ycgB 1.5 1.5 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ydcD ydjI 2.2 1.5 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yebC yfhH 1.5 1.6 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yfiT yfjT 1.5 -1.8 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yflN yheA 1.7 1.7 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yhjN yjlC 1.5 1.5 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ykyA ylbK 1.7 -1.6 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ylbN yllB 1.6 2.1 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ylqC ylqD 1.8 1.6 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ymcB yngL 2.1 2 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yodA ypbS 1.8 1.5 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ypeP ypiB 1.5 2 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ypmA ypmP 1.6 2.2 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yppF yqeY 1.5 2.5 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yqhY yqkC 1.5 1.8 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yqxD yqzC 1.5 1.7 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yrdA yrkF 1.8 1.9 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yrrK yrzL 1.6 1.6 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yubD yukE 2.1 1.7 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yviA yvqI 1.5 1.5 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ywcI ywlA -4 1.6 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis ywqB yxjC -1.6 1.9 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis yxxF yydA -1.5 -1.6 Similar to unknown proteins from B. subtilis Similar to unknown proteins from B. subtilis Remark: FCH: fold change. All genes listed were those with a q value of no more than 0.01 and a fold change of no less than 1.5. Those with a minus value of fold change are the genes which were down-regulated by the root exudates. SM Table 4: The primers used for real-time PCR Oligo Name baeI1_fr dfnJ1_fr glvA1_fr hag1_fr iolA1_fr iolD1_fr ptb1_fr sigW1_fr ydbM1_fr yfjT1_fr Oligo Sequence (5‘ – 3‘) CACTTGGTGACGCCGTTTC GTCGGCATGGGAGAGGAA CGGATGATATGGTGAAAAAATCAA GCTGAGGGTGCATTAAACGAA AGCGCGTGCAAGCGTTA AGCAGGTGGAGCAGGAATACA GGGAACCCTATGCCGAAAG AGCAGAAGGGCTGACGATGT GCCTGAACGGACCGATTAAA GACCCTGAATCAACGGACGTT Length (nt) 19 18 24 21 17 21 19 20 20 21 baeI2_rev dfnJ2_rev glvA2_rev hag2_rev iolA2_rev iolD2_rev ptb2_rev sigW2_rev ydbM2_rev yfjT2_rev CGTGCATGATTAACTCCTTCTCA GGGCCGGTTTATGATAGACTTG TTCCCGCCCTTCCATGA CGTTAGCCGCTTGTGTAGCA CTTCAAGGTGGGCGTCATTT GCGGGACACGGGCTTTA CGCCTCCATTTTCGGATTAA ACGGCGTCTTCAGGGAGAA GCTCCATTTCCCCGATACG GACCCTGAATCAACGGACGTT 23 22 17 20 20 17 20 19 19 21
