Kristen Marten BMS 110, 2008 October 6, 2008 The Isolation of Homo Sapiens XPC Homolog from Tetrahymena DNA Kristen Marten Megan Boxx Fall 2008 Abstract: Homo Sapien XPC is an important gene used to repair damages in DNA sequences. An XPC homolog has been found in the organism Tetrahymena. Tetrahymena is a model organism used in biomedical research. Studies of XPC show it is important in recognizing lesions on DNA. In this lab, my lab partner and I are attempting to isolate XPC from Tetrahymena. We will do this process by finding the amino acid sequence and then actually isolating the DNA. Then, we will perform a polymerase chain reaction, or PCR, to amplify the coding sequence of T.t. XPC and make many copies of it. After the PCR, we will separate and purify the DNA through gel electrophoresis. Following the electrophoresis step, my lab partner and I will clean and quantify the product and then TOPO clone the product to transform it into E. coli. Our next step is to construct a plasmid map and design a restriction enzyme digestion. Finally, my lab partner and I will purify the plasmid and complete the restriction enzyme digest. Through this we will help find out what Homo Sapien XPC does in Tetrahymena and how important it is to the organism. . Introduction: There are many different types of genes found in DNA that all have different uses and levels of importance. In our study of Tetrahymena, we attempted to isolate the homolog gene for Homo Sapien XPC from the DNA. After we isolated the DNA, we produced many copies of the gene. Homo Sapien XPC is a gene that is thought to be among one of the many proteins to recognize DNA damage during genomic repair (Wang, 2005). It helps to eliminate lesions that disfigure the double helix (Wang, 2005). Homo Sapien XPC functions by recognizing and binding the irregularities in the double stranded DNA, rather than looking at the characteristics of the lesion itself (Wang, 2005). Following the removal of the irregularities, the gaps are filled by DNA synthesis and ligation, or binding (Wang, 2005). A binding protein, DDB, stimulates the recruitment of heterotrimeric XPC when bound to lesions (Bergink, 2007). Heterotrimeric means that the XPC complex contains three subunits in which at least one of the units differs from the other two. UV radiation causes a large increase in the amount of the Homo Sapien XPC gene expressed (Fitch, 2003). At the transcriptional level, XPC expression is controlled by an intricate set of different regulatory mechanisms (Bergink, 2007). After isolating XPC from Tetrahymena, we can place it into plasmid to preserve the gene for later use, or we can put it into bacteria, like E. coli, and see how much of the XPC gene we actually cloned. By isolating the gene and cloning it, not only can we purify the plasmid from bacteria, but we can also use it in other experiments and further study its uses in DNA repair. Methods and Procedure: Bioinformatics Lab: Our first step in the process of isolating Homo Sapien XPC from Tetrahymena was finding the amino acid sequence of XPC from the NCBI website, http://www.ncbi.nlm.nih.gov/. We then went to http://www.ciliate.org/ to find if the Homo Sapien XPC gene was found in the Tetrahymena homolog and subsequently obtained the protein sequence. We also found the nucleotide sequence of the gene and the start codon. Finally, we compared the original amino acid sequence to the protein sequence of the Tetrahymena homolog. (Complete procedure in BMS 110H: Lab 3: Bioinformatics, Fall 2008) Tetrahymena Genomic DNA Isolation Our next step was actually isolating the DNA. We began by pipeting Tetrahymena culture into a microcentrifuge tube. After placing it in the centrifuge for a short spin and pouring off supernatant and residue from the tube, we added Urea Lysis Buffer to the culture. Then, we phenol-extracted the lysate. We had to make sure to wear gloves during this step because phenol can cause severe burns. Next, we centrifuged the mixture and transferred the aqueous layer to another tube. We repeated the phenol-extract process again and then added NaCl to the lysate. Next, we precipitated the DNA by adding ethanol. After letting the pellet air dry, we added TE and RNase A and placed the mixture into an incubator at 37̊C for ten minutes. (Complete procedure in BMS 110H: Lab 4: Tetrahymena Genomic DNA Isolation, Fall 2008) Quantification of genomic DNA After isolating the DNA, my lab partner and I had to quantify the amount of DNA in our solution. First, we prepared dilutions of our DNA. We recorded the A260 and the A260:A280 for all of our samples. Using the A260 reading, we calculated the concentration of our original (stock) genomic DNA solution. (Complete procedure in BMS 110H: Lab 4: Tetrahymena Genomic DNA Isolation) Polymerase Chain Reaction (PCR) Polymerase chain reaction is the most widely used method in molecular biology. PCR is a quick way of copying a certain section of DNA to a large amount. To use this method, we needed thermostable DNA polymerase, oligonucleotides, deoxynucleoside triphoshates, divalent cations, buffer, monovalent cation, and template DNA. XPC-TF (34-MER; TM=55°C) 5’-CAC CCT CGA GGA TTC AAA TGA AGA TCT TGA TTT C-3’ and XPC-TR (33-MER; TM=59°C) 5’-CCT AGG TCA CAT ACT TAT TTT ATT TTA TCT ATC-3’ are the primers we used in order to perform the PCR reaction to isolate the Homo Sapien XPC sequence. To complete the PCR reaction, we denatured the template of DNA. The next step was the annealing of primer to the template of DNA, which was done at four temperatures, 56.3 ̊C, 50.2 ̊C, 52.4 ̊C, and 50.0 ̊C. Then was the extension of the primer, or DNA synthesis. The last step of PCR was the cycling of the reaction. (Complete procedure in BMS 110H: Lab 5: Polymerase Chain Reaction) Agarose Gel Electrophoresis Electrophoresis is the major process used in molecular biology to separate, identify, and purify DNA fragments. There are six factors that affect the migration of DNA through the agarose gel. Firstly, the larger the molecular size of the DNA, the greater the frictional force, and, therefore, the slower the DNA will travel down the gel. Also, the higher the percentage of the concentration of the agarose, the slower the DNA will go through the gel. A third factor is the state of the DNA; the DNA will migrate at different rates depending if it’s linear or circular. Another factor is the electrophoresis buffer; the migration of the DNA is dependent upon the ions in the buffer for conductivity of the electrical current. Also, the voltage applied has an effect on the speed of the migration; the lower the voltage, the slower the migration and the more separation there is. The last factor is the type of agarose used. At this stage in our attempt to isolate Homo Sapien XPC and create many copies, we had to first prepare our agarose gel to run. To do this, we filled the electrophoresis chamber with 1X TAE and removed the comb. We then loaded our mixture of dye and sample into the gel, along with a 1kb ladder. We hooked it up to the power supply, ran it at 900 Volts for 60 minutes, and let the dye run three-fourths of the way down the gel. We then took a picture of our gel in a UV light box to decide if we need to clean up our product, or if we can proceed straight to the cloning section. (Complete procedure in BMS 110H: Lab 6: Agarose Gel Electrophoresis) TOPO Cloning and E. coli Transformation Since our PCR product had no primer dimers, my lab partner and I could skip the cleaning process and go straight to TOPO cloning. TOPO cloning is when we clone our XPC gene sequence into the pENTR/D-TOPO vector. The first step in this process was to calculate the amount of the reaction components, including PCR product, salt solution, sterile water, and TOPO vector, we needed. The total volume of these components was six microliters. We then mixed the reaction by pipeting up and down. Next, we incubated the mixture at room temperature (22-23 ̊C) for ten minutes. The second part of the process was the actual transformation into E. coli. We added E. coli into our mixture and heat-shocked the cells. Throughout this process we made sure to keep the mixture on ice in order to prevent the E. coli from dying. After adding SOC Medium and placing in a shaking incubator for an hour, we spread the mixture onto a pre-warmed plate containing kanamycin. Finally, we placed the plate in an incubator set at 37 ̊C overnight. (Complete procedure in BMS 110H: Lab 7: TOPO Cloning and E. coli Transformation) Construction of Plasmid Map and Restriction Enzyme Digestion Design Scientists produce plasmid maps in order to catalog their many plasmids found in their lab and to tell what is in the constructs. We used Gene Construction Kit 3.0 to create our plasmid map. We opened our XPC gene sequence and colored the region where our gene will be inserted and the introns a different color so we could clearly see them when our plasmid map was created. We then prepared our restriction enzyme digest. The restriction enzyme digest we chose was BglII. After picking a digest, we pasted it into our restriction enzyme, and we could see where the bands from the digest would be present in the gel. (Complete procedure in BMS 110H: Lab 8: Construction of Plasmid Map and Restriction Enzyme Digestion Design) Plasmid Purification and Restriction Enzyme Digest At this stage in our work with Homo Sapien XPC, we grew bacteria from the colonies made during the E. coli Transformation lab. We then purified our plasmid in order to screen for our PCR product. Then, using the restriction enzyme digest BglII, we looked to see if the PCR product was inserted into the plasmid. We began this process by primarily making a cocktail for our digest. Our digest, which is the final concentration in the tube, included 1X Buffer 3, 1X BSA, BglII, and water. We incubated the reactions at 37 ̊C for an hour. We then used gel electrophoresis and let the dye run three-fourths of the way down the gel. Finally, we took a picture of our results to see if our product was successfully cloned. (Complete procedure in BMS 110H: Lab 9: Plasmid Purification and Restriction Enzyme Digest) Results: Gene name Homo Sapien XPC Protein size (amino acid) 940 Homolog 1 (e-value) TTHERM_00825460 6.9e-12 TtRAD4 Table 1: This information is the Tetrahymena homolog found for Homo Sapien XPC that we found in the bioinformatics lab. There was only one homolog found for Homo XPC. CACCCTCGAGGATTCAAATGAAGATCTTGATTTCAATGATGAATTTGAAGAAGTAGATGAAAA ATAAAATGAAGATAGGATAAGCTTTGGATCTGATGACGAAAATAATTAGTAGAAGTAATCAGATTCAG AAGATAATCTCTATTTTGATAATAAAATCAAAAATAATAAAAAATAAAAAAATAAATTGGAAGACAGCTA TGAAGATGATAGAATGATTAATGAAGATGAAAATTAAGATATCGATTTTTTAAATGCCATTTGTAATAA AGATGAAGAAGGTTAAAAAAACATGAGAGAAGACTTTTTAAGTTTGATTAAAACTGCAGGAGATGATG ATACAATTCAGAAATTAATGTAAGAAAGACAACAATTAGGTAGAACTGAAGGAGGGAGAGAGAATCCT CATATTATTAAAGAATAAATGATTCTTGAGAAAATGCTTGCAAAACAAAAAAGATATGATGAAATTATG TATGAAAAAGAAAAGCTTGAATTTCTAAAAAAAACTAGAAAGATTCGCTAAAATCCAGAAGAATACAG GAATTTTATTAAGTGTTTTGTATTATGCGAAATTTCTTCTACTTTCTACTTTCTATAGTCTCATTTGGAA GATGAGTATTTAAAAGCTAAGATAATATCTTAATTTTCTTTAAAAGATTTAAATTTTTTACTTTCCATGAA AAACTATCCTGAAAAATACTCAACTAGAAGTATTATAAAAACTGTTAATTATCACATATAGCAATACTTT ACTTATAAATGGAAGAAAGAATAAATTGAATTTCATAAAAATTTAGATGAAGGAATAGAGGTAGGCTAC TCTTAAATGACATTAATTGCCTTGATCTTATTTGAATTTATTGGTATGAAAGTTAGATTTTCCAAAATTG TAGACATGAGATACCTCAACCTTGACAAAAAACACAATTCAAGGATCAAAGAAAGTAAAAGAAGTTCA AATTAGTCTTAAGAATCCACACATAGCAATTAAAAGCGTACTAGAGAATCTATAGTAAGTAGTGTTGTT TAAAATAAGAGAGCTGCACGTTTTTCAGATATGGCTTCTAGAATTACTGCTAAAATAATGAATTAGGTA TAATAATTAGTTAAATATTAAAAAAAGGAATATTTATTTAATTTTTATAGACTTAAATGATAGAAGATTAA ATAGATAGTGATTAAAGTGACAGTGATGATGAAGATTATTAAACAAAAAAAAATGATAAAAAATAATAA TAAAAAGAAAGCAATGATTTATTTGACCAAATGCTGTCAAATTTTAAGTTTGATAAAAAAAGCACTAAC AATTCATCAATGATTAGTTTTAGTAATTAAAAAAAAAATTAACAAGAAGAAGATTCAATTGTTTCAACTG CCTCATCTACCTTTTAGACTGATCCTAAAAAATTTGATTTTAGAAAGTATTTAAATAAAGGAAAAAAGC AAGATGATGATAAAAGCTCCTTATTGAAAATAGATAACTAAACATAAAAATAAGAAGAAGAAGAAATTA AATTAGTTAATAAAAAATTAAGTAATTTGAAGAAGTTAGATAGTTTATCTGATGGTAAATTAAAATTAGA TAACATTAAATTTATTTTAATAATTAAATTTAATAGTAGAAAAATGCGAAAGCGAAGTTGAAAAAGAAGA GGAAACTTTAAATCCATTTAATTTTGCTTTTTCTAAAAAAAAATTTAAAAAGACTTAACAGGGTAGATTT TTAATTATTTTAATTTTAATTAATTATGTCATTTTTTTAAGACTTAATATAGACTTAGTAGACAAATTAAA CAGAATAGGATTCAAAGCTTTTGGAAAATGACTAAAATTAATAACAATAAAAGTTATTAAAAAGTGATT TCTATCAAAGTTCTGAAATAAAGTATTGGCTTGAAGTTTATGATGAAAAGAGTTAGCAATGGATTTGTT TTGATGCTGTTTAGAATGAAATTTTAGAAAGATTCTAAATTTTGTTAAAATAAAATAGTATACCTGTTTT ATTCATAGTTGGATATAATAAATTAGAATTTAAAAATGAAAAATTAAAAGAATATGTTCATAACAAAAGA TCTATGAAAAATTTGTTTTTATTTGATATTACTGATATACACTGTGATAGGTATCCGAAAATTTAGGTAA GTAGAAGAGAGTTGAATTTCGATTATTGGTGGAAAAATCTTCTTTAACATGTTTCATTTCTTGGAAATC CAGAATTACTATAAGACGAATATGTAAAATGTTATTTATAATAAATTATATTATTTATTATATAAAAAATA GAAACCCTAAGTAATTAGTGAAAGAGAAACAAAAATATAAATGTAAAAATCTTAAATCCCTTAATCATA TCCTGAGTTTAAAGCAAGTGAAATTTATATTACTAAGTCAATGCTTTAAAAGTATTAAGGTTTACATCC AAATGCATAAAAGACAAATCTTACATTTAAAGACGAAGACGTAAGCAACTATGCTATTAACATTTATTA TAATAAATTAATAAAAAAAAGGTATATTTTAAAGAATATGTCGTTGATTTGCATGCAAAAACTAGATGG AGATCCTACTAAAGATCAGTTAAGCCTGATGAGAAGCCTGTTAAATAGGTTCAATCGATTTTAGGTAA CAAAAAAATGGTAGATTTGTTTGGATTCTGGTAAACTGAAGAGTTAGTATACAAAATCAGAGATGATG GAACTCTCCCAAGAAATGAATATGGTAACTGGGAGGTAATTTTAATTAAAATTATTATAATTTGTTTGT TTGATTTAAATTAAATAAAAATAAAATTTAATTTAATTAAACTCTCTCTTTAAAATCAAATTCTTATTTAG ACGTTTGCTGGTGATCCACCTGAAGGAACAGTTTTGATTGAAATCTAAGGATTACCTAAGTTGCTAAA AAAACATAACATAGAGTATGTAGAAGCAGTTTGCGGATTTGAATCGACAGCATCTGGTAGATCTCATG TGGTTAAAAATGGTATACTAGCCCACAAGAAAGATGAAGAAAGAATAAGATAAATTTATTAAGATAACT ATGAAATTATGAAAGCTCAGTAAGCAGAAAATCTTAAAAAAGAGCTTATGGGATTTTGGAGAAAAATA TTTAAAGGAGTTTTACTGAAAAAGAGTATTTCAGATAGATAAAATAAAATAAGTATGTGACCTAGG Figure 1: Genomic sequence of Tetrahymena Homo Sapien XPC. The introns are colored black and the exons are colored red. The primers designed for PCR are highlighted in yellow. There are no ESTs found in our sequence. The original start codon location is colored green. The stop codon is colored blue. A260 0.576 A280 0.283 DNA Concentration 2.88 µg\µL DNA Purity 2.04 Table 2: Using our A260 and A280 values, we calculated our DNA’s concentration and its purity. To find the purity, we multiplied our A260 value by 50 and our dilution factor, which was 100. We then divided this value by 1000µL\µL. To find the purity, we took the A260 value and divided it by the A280 value. Ladder Lane 1 2 3 4 10,000kb 9,000kb 8,000kb 7,000kb 6,000kb 5,000kb 4,000kb 3,000kb 2,000kb 1,000kb Figure 2: This picture is the result of the agarose gel electrophoresis in the PCR of Tt XPC. The DNA in lane one had an annealing temperature of 52.4̊C. The DNA in lane 2 had an annealing temperature of 50.0̊C. The DNA in lane 3 had an annealing temperature of 56.3̊C. The DNA in lane four did not show up because it was improperly loaded into the gel. Our predicted band size for our PCR product was 3,176 kb. Our results show that our product is right around 3,000 kb. One can clearly see that the DNA in lane 1 had the best results. Figure 3: This figure represents the pENTR/TOPO-D plasmid vector that we used in Lab 7 in order to clone our PCR product. No DNA (Negative Control) 200µL plate Rest of mixture 16 colonies 2 colonies Results 200µL plate Rest of mixture 26 colonies 2 colonies Table 3: This table represents the negative control for the number of colonies that should appear on our plates. On our 200µL plate, we actually counted 26 colonies, which is more than the negative control. Figure 4: This figure represents our plasmid map with the restriction enzyme digests shown. Our gene sequence is colored green, and the introns are colored black. Our enzyme digest, BglII, is shown by an arrow. The restriction enzyme digest will help us to determine if the bacteria grown on our plates contains our PCR product. Digest #1, pENTR;;TtHOMOXPC1 (5752) : BglII size from to 2810 3649 (BglII) 706 (BglII) 2051 707 (BglII) 2757 (BglII) 891 2758 (BglII) 3648 (BglII) ================================================================== Digest #1, pENTR;;TtHOMOXPC1 (5752) : BglII position site 706 BglII 2757 BglII 3648 BglII Table 4: This table, created during our plasmid map construction lab, displays the band sizes of any clones we may produce. The band sizes are shown by the arrows. Our clones will be exhibited through gel electrophoresis in Lab 9. Figure 5: This image represents the actual kb ladder of our predicted band sizes. Our band sizes, shown from this figure, should be 2810 kb, 2051 kb, and 891 kb. Figure 6: This image represents the 1kb ladder we used for the gel electrophoresis part of the restriction enzyme digest process. M 1 2 3 4 5 6 M 10kb 8kb 6kb 5kb 4kb 3kb 2kb 1.5kb 1kb .5kb Figure 7: This picture represents the results from plasmid purification and restriction enzyme digest. My lab partner and I’s results are in the middle. You can clearly see that there is a clone in lane 3, but it’s not the correct band size that we predicted in previous labs. There were no clones in any of the other lanes. Once my lab partner and I found the size and homolog of our gene (displayed in Table 1), we were able to find the correct genomic DNA sequence of Tetrahymena Homo Sapien XPC, which is shown in Figure 1. After finding the sequence, we could isolate that certain part of DNA from Tetrahymena. Once we isolated the Genomic DNA, we prepared dilutions of the DNA and placed our samples in a spectrophotometer. We then recorded our A260 and A260:A280 values. We used these values to find the concentration and purity of our DNA, shown in Table 2. We used our concentration to create a master mix for PCR. We then used this mix to set up our PCR, splitting up our reaction into four PCR tubes; we placed the tubes into a thermocylcer. Each tube had a different primer annealing temperature. After this process, we put the mixtures through agarose gel electrophoresis to separate the DNA fragments. The predicted band size for the target PCR product was 3,176 kb. Our results of this process, displayed in Figure 2, show that our products were around 3,000 kb. From this figure, my lab partner and I can clearly see that our first PCR, ran at 52.4̊C, had the best results. After looking at our electrophoresis results, we can see that we have no primer dimers present. Because of this, my lab partner and I were able to skip the PCR product clean-up stage and proceed directly to the TOPO cloning and E. coli transformation stage. Figure 3 shows the pENTR/TOPO-D plasmid vector that we started with in Lab 7. We added this vector to a mixture of PCR product, water, and salt solution to aid in our transformation of E. coli. Table 3 shows the negative control for the number of colonies produced in the plates. We counted 26 colonies on our 200 µL plate, which is much larger than the negative control of 16 colonies. After counting our colonies, we had to construct a plasmid map and design our restriction enzyme digest. Our plasmid map, shown in Figure 4, has all of the restriction enzyme digests displayed. We chose BglII as our enzyme. We then found what size the bands would be when ran on a gel. Our sizes are shown in Table 4, while the actual kb ladder of the predicted sizes is displayed in Figure 5. After finding our band sizes, my lab partner and I and to purify our plasmid and perform restriction enzyme digest to find any clones. The kb ladder we used in gel electrophoresis part of our restriction enzyme digest is shown in Figure 6. Finally, our cloning results are found in Figure 7. One can clearly see that there is a clone shown on the gel (Lane 3, Figure 7), but it is not the correct band size for our restriction enzyme digest. Reasons for the incorrect clone could be contamination to any of our mixtures or incorrectly inserting our plasmid into the gel, among many other potential mistakes made along the way. Conclusion: Our next step in cloning DNA is to fix any mistakes made in this process in order to correctly make our clones. In our process of isolating Homo Sapien XPC from Tetrahymena, we ran into several problems. Our first was learning to use the pipets without getting air bubbles in the tubes. This problem was fixed by practice with the pipets and help from professors. A second problem that constantly arose was that our DNA or other components of mixtures would stick to the sides of the microcentrifuge tubes. This problem, we found, could be fixed by centrifuging the mixture or flicking the tube. Another problem was the loading of our samples into the gel. Getting all of the sample into the gel without letting it mix with the 1X TAE can be difficult. This technique gets better with lots of practice and experience. In the future, this process of isolating DNA and creating clones could be made easier by having more pipets (especially 2-20) available; we were constantly waiting on the smaller pipets. Another way to improve this process would be to prevent double dipping so that one group doesn’t ruin the results of other groups. One section that lowered the chance of error was the bioinformatics lab. By using the online databases, we could find the correct amino acid sequence of our proteins and easily see if there is a homolog of our protein, XPC, in Tetrahymena. In this lab, my partner and I have learned that you can isolate a certain 8section of a DNA sequence and use it in later experimentation. We have also learned, from our readings, that Homo Sapien XPC can repair damage in the DNA sequence. Finding XPC in Tetrahymena was very important because if the DNA is ever damaged, it can be repaired by this gene. XPC can prevent and fix any irregularities. Homo Sapien XPC is a very important gene in maintaining DNA’s regular shape. Without it, there could be many permanent, damaging effects for DNA. References: Bergink, S, Jaspers, N, & Vermeulen, W (2007). Regulation of UV induced DNA damage response by ubiquitylation. DNA Repair. 6, 1231-1242. Fitch, Maureen E., Nakajima, Satoshi, Yasui, Akira, Ford, James M. 2003. In Vivo Recruitment of XPC to UV-induced Cyclobutane Pyrimidine Dimers by the DDB2 Gene Product. The Journal of Biological Chemistry Vol. 278, No. 47: 4690646910. Wang, Qi-En, Zhu, Qianzheng, Wani, Gulzar, El-Mahdy, Mohamed A., Li, Jinyou, Wani, Altaf A. 2005. DNA repair factor XPC is modified by SUMO-1 and ubiquitin following UV irradiation. Nucleic Acids Research Vol. 33, No. 13: 4023-4034.
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )