Kristen Marten
BMS 110, 2008
October 6, 2008
The Isolation of Homo Sapiens XPC Homolog from Tetrahymena DNA
Kristen Marten
Megan Boxx
Fall 2008
Abstract:
Homo Sapien XPC is an important gene used to repair damages in DNA
sequences. An XPC homolog has been found in the organism Tetrahymena.
Tetrahymena is a model organism used in biomedical research. Studies of XPC show it
is important in recognizing lesions on DNA. In this lab, my lab partner and I are
attempting to isolate XPC from Tetrahymena. We will do this process by finding the
amino acid sequence and then actually isolating the DNA. Then, we will perform a
polymerase chain reaction, or PCR, to amplify the coding sequence of T.t. XPC and
make many copies of it. After the PCR, we will separate and purify the DNA through gel
electrophoresis. Following the electrophoresis step, my lab partner and I will clean and
quantify the product and then TOPO clone the product to transform it into E. coli. Our
next step is to construct a plasmid map and design a restriction enzyme digestion.
Finally, my lab partner and I will purify the plasmid and complete the restriction enzyme
digest. Through this we will help find out what Homo Sapien XPC does in Tetrahymena
and how important it is to the organism.
.
Introduction:
There are many different types of genes found in DNA that all have different uses
and levels of importance. In our study of Tetrahymena, we attempted to isolate the
homolog gene for Homo Sapien XPC from the DNA. After we isolated the DNA, we
produced many copies of the gene. Homo Sapien XPC is a gene that is thought to be
among one of the many proteins to recognize DNA damage during genomic repair
(Wang, 2005). It helps to eliminate lesions that disfigure the double helix (Wang, 2005).
Homo Sapien XPC functions by recognizing and binding the irregularities in the double
stranded DNA, rather than looking at the characteristics of the lesion itself (Wang,
2005). Following the removal of the irregularities, the gaps are filled by DNA synthesis
and ligation, or binding (Wang, 2005). A binding protein, DDB, stimulates the
recruitment of heterotrimeric XPC when bound to lesions (Bergink, 2007).
Heterotrimeric means that the XPC complex contains three subunits in which at least
one of the units differs from the other two. UV radiation causes a large increase in the
amount of the Homo Sapien XPC gene expressed (Fitch, 2003). At the transcriptional
level, XPC expression is controlled by an intricate set of different regulatory
mechanisms (Bergink, 2007). After isolating XPC from Tetrahymena, we can place it
into plasmid to preserve the gene for later use, or we can put it into bacteria, like E. coli,
and see how much of the XPC gene we actually cloned. By isolating the gene and
cloning it, not only can we purify the plasmid from bacteria, but we can also use it in
other experiments and further study its uses in DNA repair.
Methods and Procedure:
Bioinformatics Lab:
Our first step in the process of isolating Homo Sapien XPC from Tetrahymena
was finding the amino acid sequence of XPC from the NCBI website,
http://www.ncbi.nlm.nih.gov/. We then went to http://www.ciliate.org/ to find if the Homo
Sapien XPC gene was found in the Tetrahymena homolog and subsequently obtained
the protein sequence. We also found the nucleotide sequence of the gene and the start
codon. Finally, we compared the original amino acid sequence to the protein sequence
of the Tetrahymena homolog. (Complete procedure in BMS 110H: Lab 3:
Bioinformatics, Fall 2008)
Tetrahymena Genomic DNA Isolation
Our next step was actually isolating the DNA. We began by pipeting
Tetrahymena culture into a microcentrifuge tube. After placing it in the centrifuge for a
short spin and pouring off supernatant and residue from the tube, we added Urea Lysis
Buffer to the culture. Then, we phenol-extracted the lysate. We had to make sure to
wear gloves during this step because phenol can cause severe burns. Next, we
centrifuged the mixture and transferred the aqueous layer to another tube. We
repeated the phenol-extract process again and then added NaCl to the lysate. Next, we
precipitated the DNA by adding ethanol. After letting the pellet air dry, we added TE
and RNase A and placed the mixture into an incubator at 37̊C for ten minutes.
(Complete procedure in BMS 110H: Lab 4: Tetrahymena Genomic DNA Isolation, Fall
2008)
Quantification of genomic DNA
After isolating the DNA, my lab partner and I had to quantify the amount of DNA
in our solution. First, we prepared dilutions of our DNA. We recorded the A260 and the
A260:A280 for all of our samples. Using the A260 reading, we calculated the
concentration of our original (stock) genomic DNA solution. (Complete procedure in
BMS 110H: Lab 4: Tetrahymena Genomic DNA Isolation)
Polymerase Chain Reaction (PCR)
Polymerase chain reaction is the most widely used method in molecular biology.
PCR is a quick way of copying a certain section of DNA to a large amount. To use this
method, we needed thermostable DNA polymerase, oligonucleotides, deoxynucleoside
triphoshates, divalent cations, buffer, monovalent cation, and template DNA. XPC-TF
(34-MER; TM=55°C) 5’-CAC CCT CGA GGA TTC AAA TGA AGA TCT TGA TTT C-3’
and XPC-TR (33-MER; TM=59°C) 5’-CCT AGG TCA CAT ACT TAT TTT ATT TTA TCT
ATC-3’ are the primers we used in order to perform the PCR reaction to isolate the
Homo Sapien XPC sequence. To complete the PCR reaction, we denatured the
template of DNA. The next step was the annealing of primer to the template of DNA,
which was done at four temperatures, 56.3 ̊C, 50.2 ̊C, 52.4 ̊C, and 50.0 ̊C. Then was
the extension of the primer, or DNA synthesis. The last step of PCR was the cycling of
the reaction. (Complete procedure in BMS 110H: Lab 5: Polymerase Chain Reaction)
Agarose Gel Electrophoresis
Electrophoresis is the major process used in molecular biology to separate,
identify, and purify DNA fragments. There are six factors that affect the migration of
DNA through the agarose gel. Firstly, the larger the molecular size of the DNA, the
greater the frictional force, and, therefore, the slower the DNA will travel down the gel.
Also, the higher the percentage of the concentration of the agarose, the slower the DNA
will go through the gel. A third factor is the state of the DNA; the DNA will migrate at
different rates depending if it’s linear or circular. Another factor is the electrophoresis
buffer; the migration of the DNA is dependent upon the ions in the buffer for conductivity
of the electrical current. Also, the voltage applied has an effect on the speed of the
migration; the lower the voltage, the slower the migration and the more separation there
is. The last factor is the type of agarose used. At this stage in our attempt to isolate
Homo Sapien XPC and create many copies, we had to first prepare our agarose gel to
run. To do this, we filled the electrophoresis chamber with 1X TAE and removed the
comb. We then loaded our mixture of dye and sample into the gel, along with a 1kb
ladder. We hooked it up to the power supply, ran it at 900 Volts for 60 minutes, and let
the dye run three-fourths of the way down the gel. We then took a picture of our gel in a
UV light box to decide if we need to clean up our product, or if we can proceed straight
to the cloning section. (Complete procedure in BMS 110H: Lab 6: Agarose Gel
Electrophoresis)
TOPO Cloning and E. coli Transformation
Since our PCR product had no primer dimers, my lab partner and I could skip the
cleaning process and go straight to TOPO cloning. TOPO cloning is when we clone our
XPC gene sequence into the pENTR/D-TOPO vector. The first step in this process was
to calculate the amount of the reaction components, including PCR product, salt
solution, sterile water, and TOPO vector, we needed. The total volume of these
components was six microliters. We then mixed the reaction by pipeting up and down.
Next, we incubated the mixture at room temperature (22-23 ̊C) for ten minutes. The
second part of the process was the actual transformation into E. coli. We added E. coli
into our mixture and heat-shocked the cells. Throughout this process we made sure to
keep the mixture on ice in order to prevent the E. coli from dying. After adding SOC
Medium and placing in a shaking incubator for an hour, we spread the mixture onto a
pre-warmed plate containing kanamycin. Finally, we placed the plate in an incubator set
at 37 ̊C overnight. (Complete procedure in BMS 110H: Lab 7: TOPO Cloning and E. coli
Transformation)
Construction of Plasmid Map and Restriction Enzyme Digestion Design
Scientists produce plasmid maps in order to catalog their many plasmids found in
their lab and to tell what is in the constructs. We used Gene Construction Kit 3.0 to
create our plasmid map. We opened our XPC gene sequence and colored the region
where our gene will be inserted and the introns a different color so we could clearly see
them when our plasmid map was created. We then prepared our restriction enzyme
digest. The restriction enzyme digest we chose was BglII. After picking a digest, we
pasted it into our restriction enzyme, and we could see where the bands from the digest
would be present in the gel. (Complete procedure in BMS 110H: Lab 8: Construction of
Plasmid Map and Restriction Enzyme Digestion Design)
Plasmid Purification and Restriction Enzyme Digest
At this stage in our work with Homo Sapien XPC, we grew bacteria from the
colonies made during the E. coli Transformation lab. We then purified our plasmid in
order to screen for our PCR product. Then, using the restriction enzyme digest BglII, we
looked to see if the PCR product was inserted into the plasmid. We began this process
by primarily making a cocktail for our digest. Our digest, which is the final concentration
in the tube, included 1X Buffer 3, 1X BSA, BglII, and water. We incubated the reactions
at 37 ̊C for an hour. We then used gel electrophoresis and let the dye run three-fourths
of the way down the gel. Finally, we took a picture of our results to see if our product
was successfully cloned. (Complete procedure in BMS 110H: Lab 9: Plasmid
Purification and Restriction Enzyme Digest)
Results:
Gene name
Homo Sapien XPC
Protein size (amino acid)
940
Homolog 1 (e-value)
TTHERM_00825460
6.9e-12
TtRAD4
Table 1: This information is the Tetrahymena homolog found for Homo Sapien XPC that
we found in the bioinformatics lab. There was only one homolog found for Homo XPC.
CACCCTCGAGGATTCAAATGAAGATCTTGATTTCAATGATGAATTTGAAGAAGTAGATGAAAA
ATAAAATGAAGATAGGATAAGCTTTGGATCTGATGACGAAAATAATTAGTAGAAGTAATCAGATTCAG
AAGATAATCTCTATTTTGATAATAAAATCAAAAATAATAAAAAATAAAAAAATAAATTGGAAGACAGCTA
TGAAGATGATAGAATGATTAATGAAGATGAAAATTAAGATATCGATTTTTTAAATGCCATTTGTAATAA
AGATGAAGAAGGTTAAAAAAACATGAGAGAAGACTTTTTAAGTTTGATTAAAACTGCAGGAGATGATG
ATACAATTCAGAAATTAATGTAAGAAAGACAACAATTAGGTAGAACTGAAGGAGGGAGAGAGAATCCT
CATATTATTAAAGAATAAATGATTCTTGAGAAAATGCTTGCAAAACAAAAAAGATATGATGAAATTATG
TATGAAAAAGAAAAGCTTGAATTTCTAAAAAAAACTAGAAAGATTCGCTAAAATCCAGAAGAATACAG
GAATTTTATTAAGTGTTTTGTATTATGCGAAATTTCTTCTACTTTCTACTTTCTATAGTCTCATTTGGAA
GATGAGTATTTAAAAGCTAAGATAATATCTTAATTTTCTTTAAAAGATTTAAATTTTTTACTTTCCATGAA
AAACTATCCTGAAAAATACTCAACTAGAAGTATTATAAAAACTGTTAATTATCACATATAGCAATACTTT
ACTTATAAATGGAAGAAAGAATAAATTGAATTTCATAAAAATTTAGATGAAGGAATAGAGGTAGGCTAC
TCTTAAATGACATTAATTGCCTTGATCTTATTTGAATTTATTGGTATGAAAGTTAGATTTTCCAAAATTG
TAGACATGAGATACCTCAACCTTGACAAAAAACACAATTCAAGGATCAAAGAAAGTAAAAGAAGTTCA
AATTAGTCTTAAGAATCCACACATAGCAATTAAAAGCGTACTAGAGAATCTATAGTAAGTAGTGTTGTT
TAAAATAAGAGAGCTGCACGTTTTTCAGATATGGCTTCTAGAATTACTGCTAAAATAATGAATTAGGTA
TAATAATTAGTTAAATATTAAAAAAAGGAATATTTATTTAATTTTTATAGACTTAAATGATAGAAGATTAA
ATAGATAGTGATTAAAGTGACAGTGATGATGAAGATTATTAAACAAAAAAAAATGATAAAAAATAATAA
TAAAAAGAAAGCAATGATTTATTTGACCAAATGCTGTCAAATTTTAAGTTTGATAAAAAAAGCACTAAC
AATTCATCAATGATTAGTTTTAGTAATTAAAAAAAAAATTAACAAGAAGAAGATTCAATTGTTTCAACTG
CCTCATCTACCTTTTAGACTGATCCTAAAAAATTTGATTTTAGAAAGTATTTAAATAAAGGAAAAAAGC
AAGATGATGATAAAAGCTCCTTATTGAAAATAGATAACTAAACATAAAAATAAGAAGAAGAAGAAATTA
AATTAGTTAATAAAAAATTAAGTAATTTGAAGAAGTTAGATAGTTTATCTGATGGTAAATTAAAATTAGA
TAACATTAAATTTATTTTAATAATTAAATTTAATAGTAGAAAAATGCGAAAGCGAAGTTGAAAAAGAAGA
GGAAACTTTAAATCCATTTAATTTTGCTTTTTCTAAAAAAAAATTTAAAAAGACTTAACAGGGTAGATTT
TTAATTATTTTAATTTTAATTAATTATGTCATTTTTTTAAGACTTAATATAGACTTAGTAGACAAATTAAA
CAGAATAGGATTCAAAGCTTTTGGAAAATGACTAAAATTAATAACAATAAAAGTTATTAAAAAGTGATT
TCTATCAAAGTTCTGAAATAAAGTATTGGCTTGAAGTTTATGATGAAAAGAGTTAGCAATGGATTTGTT
TTGATGCTGTTTAGAATGAAATTTTAGAAAGATTCTAAATTTTGTTAAAATAAAATAGTATACCTGTTTT
ATTCATAGTTGGATATAATAAATTAGAATTTAAAAATGAAAAATTAAAAGAATATGTTCATAACAAAAGA
TCTATGAAAAATTTGTTTTTATTTGATATTACTGATATACACTGTGATAGGTATCCGAAAATTTAGGTAA
GTAGAAGAGAGTTGAATTTCGATTATTGGTGGAAAAATCTTCTTTAACATGTTTCATTTCTTGGAAATC
CAGAATTACTATAAGACGAATATGTAAAATGTTATTTATAATAAATTATATTATTTATTATATAAAAAATA
GAAACCCTAAGTAATTAGTGAAAGAGAAACAAAAATATAAATGTAAAAATCTTAAATCCCTTAATCATA
TCCTGAGTTTAAAGCAAGTGAAATTTATATTACTAAGTCAATGCTTTAAAAGTATTAAGGTTTACATCC
AAATGCATAAAAGACAAATCTTACATTTAAAGACGAAGACGTAAGCAACTATGCTATTAACATTTATTA
TAATAAATTAATAAAAAAAAGGTATATTTTAAAGAATATGTCGTTGATTTGCATGCAAAAACTAGATGG
AGATCCTACTAAAGATCAGTTAAGCCTGATGAGAAGCCTGTTAAATAGGTTCAATCGATTTTAGGTAA
CAAAAAAATGGTAGATTTGTTTGGATTCTGGTAAACTGAAGAGTTAGTATACAAAATCAGAGATGATG
GAACTCTCCCAAGAAATGAATATGGTAACTGGGAGGTAATTTTAATTAAAATTATTATAATTTGTTTGT
TTGATTTAAATTAAATAAAAATAAAATTTAATTTAATTAAACTCTCTCTTTAAAATCAAATTCTTATTTAG
ACGTTTGCTGGTGATCCACCTGAAGGAACAGTTTTGATTGAAATCTAAGGATTACCTAAGTTGCTAAA
AAAACATAACATAGAGTATGTAGAAGCAGTTTGCGGATTTGAATCGACAGCATCTGGTAGATCTCATG
TGGTTAAAAATGGTATACTAGCCCACAAGAAAGATGAAGAAAGAATAAGATAAATTTATTAAGATAACT
ATGAAATTATGAAAGCTCAGTAAGCAGAAAATCTTAAAAAAGAGCTTATGGGATTTTGGAGAAAAATA
TTTAAAGGAGTTTTACTGAAAAAGAGTATTTCAGATAGATAAAATAAAATAAGTATGTGACCTAGG
Figure 1: Genomic sequence of Tetrahymena Homo Sapien XPC. The introns are
colored black and the exons are colored red. The primers designed for PCR are
highlighted in yellow. There are no ESTs found in our sequence. The original start
codon location is colored green. The stop codon is colored blue.
A260
0.576
A280
0.283
DNA Concentration
2.88 µg\µL
DNA Purity
2.04
Table 2: Using our A260 and A280 values, we calculated our DNA’s concentration and
its purity. To find the purity, we multiplied our A260 value by 50 and our dilution factor,
which was 100. We then divided this value by 1000µL\µL. To find the purity, we took
the A260 value and divided it by the A280 value.
Ladder
Lane
1
2
3
4
10,000kb
9,000kb
8,000kb
7,000kb
6,000kb
5,000kb
4,000kb
3,000kb
2,000kb
1,000kb
Figure 2: This picture is the result of the agarose gel electrophoresis in the PCR of Tt
XPC. The DNA in lane one had an annealing temperature of 52.4̊C. The DNA in lane 2
had an annealing temperature of 50.0̊C. The DNA in lane 3 had an annealing
temperature of 56.3̊C. The DNA in lane four did not show up because it was improperly
loaded into the gel. Our predicted band size for our PCR product was 3,176 kb. Our
results show that our product is right around 3,000 kb. One can clearly see that the DNA
in lane 1 had the best results.
Figure 3: This figure represents the pENTR/TOPO-D plasmid vector that we used in
Lab 7 in order to clone our PCR product.
No DNA (Negative Control)
200µL plate
Rest of mixture
16 colonies
2 colonies
Results
200µL plate
Rest of mixture
26 colonies
2 colonies
Table 3: This table represents the negative control for the number of colonies that
should appear on our plates. On our 200µL plate, we actually counted 26 colonies,
which is more than the negative control.
Figure 4: This figure represents our plasmid map with the restriction enzyme digests
shown. Our gene sequence is colored green, and the introns are colored black. Our
enzyme digest, BglII, is shown by an arrow. The restriction enzyme digest will help us to
determine if the bacteria grown on our plates contains our PCR product.
Digest #1, pENTR;;TtHOMOXPC1 (5752) : BglII
size
from
to
2810
3649
(BglII) 706
(BglII)
2051
707
(BglII) 2757
(BglII)
891
2758
(BglII) 3648
(BglII)
==================================================================
Digest #1, pENTR;;TtHOMOXPC1 (5752) : BglII
position site
706
BglII
2757
BglII
3648
BglII
Table 4: This table, created during our plasmid map construction lab, displays the band
sizes of any clones we may produce. The band sizes are shown by the arrows. Our
clones will be exhibited through gel electrophoresis in Lab 9.
Figure 5: This image represents the actual kb ladder of our predicted band sizes. Our
band sizes, shown from this figure, should be 2810 kb, 2051 kb, and 891 kb.
Figure 6: This image represents the 1kb ladder we used for the gel electrophoresis part
of the restriction enzyme digest process.
M
1
2
3
4
5
6
M
10kb
8kb
6kb
5kb
4kb
3kb
2kb
1.5kb
1kb
.5kb
Figure 7: This picture represents the results from plasmid purification and restriction
enzyme digest. My lab partner and I’s results are in the middle. You can clearly see that
there is a clone in lane 3, but it’s not the correct band size that we predicted in previous
labs. There were no clones in any of the other lanes.
Once my lab partner and I found the size and homolog of our gene (displayed in
Table 1), we were able to find the correct genomic DNA sequence of Tetrahymena
Homo Sapien XPC, which is shown in Figure 1. After finding the sequence, we could
isolate that certain part of DNA from Tetrahymena. Once we isolated the Genomic
DNA, we prepared dilutions of the DNA and placed our samples in a
spectrophotometer. We then recorded our A260 and A260:A280 values. We used
these values to find the concentration and purity of our DNA, shown in Table 2. We
used our concentration to create a master mix for PCR. We then used this mix to set up
our PCR, splitting up our reaction into four PCR tubes; we placed the tubes into a
thermocylcer. Each tube had a different primer annealing temperature. After this
process, we put the mixtures through agarose gel electrophoresis to separate the DNA
fragments. The predicted band size for the target PCR product was 3,176 kb. Our
results of this process, displayed in Figure 2, show that our products were around 3,000
kb. From this figure, my lab partner and I can clearly see that our first PCR, ran at
52.4̊C, had the best results. After looking at our electrophoresis results, we can see that
we have no primer dimers present. Because of this, my lab partner and I were able to
skip the PCR product clean-up stage and proceed directly to the TOPO cloning and E.
coli transformation stage. Figure 3 shows the pENTR/TOPO-D plasmid vector that we
started with in Lab 7. We added this vector to a mixture of PCR product, water, and salt
solution to aid in our transformation of E. coli. Table 3 shows the negative control for
the number of colonies produced in the plates. We counted 26 colonies on our 200 µL
plate, which is much larger than the negative control of 16 colonies. After counting our
colonies, we had to construct a plasmid map and design our restriction enzyme digest.
Our plasmid map, shown in Figure 4, has all of the restriction enzyme digests displayed.
We chose BglII as our enzyme. We then found what size the bands would be when ran
on a gel. Our sizes are shown in Table 4, while the actual kb ladder of the predicted
sizes is displayed in Figure 5. After finding our band sizes, my lab partner and I and to
purify our plasmid and perform restriction enzyme digest to find any clones. The kb
ladder we used in gel electrophoresis part of our restriction enzyme digest is shown in
Figure 6. Finally, our cloning results are found in Figure 7. One can clearly see that
there is a clone shown on the gel (Lane 3, Figure 7), but it is not the correct band size
for our restriction enzyme digest. Reasons for the incorrect clone could be
contamination to any of our mixtures or incorrectly inserting our plasmid into the gel,
among many other potential mistakes made along the way.
Conclusion:
Our next step in cloning DNA is to fix any mistakes made in this process in order
to correctly make our clones. In our process of isolating Homo Sapien XPC from
Tetrahymena, we ran into several problems. Our first was learning to use the pipets
without getting air bubbles in the tubes. This problem was fixed by practice with the
pipets and help from professors. A second problem that constantly arose was that our
DNA or other components of mixtures would stick to the sides of the microcentrifuge
tubes. This problem, we found, could be fixed by centrifuging the mixture or flicking the
tube. Another problem was the loading of our samples into the gel. Getting all of the
sample into the gel without letting it mix with the 1X TAE can be difficult. This technique
gets better with lots of practice and experience. In the future, this process of isolating
DNA and creating clones could be made easier by having more pipets (especially 2-20)
available; we were constantly waiting on the smaller pipets. Another way to improve
this process would be to prevent double dipping so that one group doesn’t ruin the
results of other groups. One section that lowered the chance of error was the
bioinformatics lab. By using the online databases, we could find the correct amino acid
sequence of our proteins and easily see if there is a homolog of our protein, XPC, in
Tetrahymena. In this lab, my partner and I have learned that you can isolate a certain
8section of a DNA sequence and use it in later experimentation. We have also learned,
from our readings, that Homo Sapien XPC can repair damage in the DNA sequence.
Finding XPC in Tetrahymena was very important because if the DNA is ever damaged,
it can be repaired by this gene. XPC can prevent and fix any irregularities. Homo
Sapien XPC is a very important gene in maintaining DNA’s regular shape. Without it,
there could be many permanent, damaging effects for DNA.
References:
Bergink, S, Jaspers, N, & Vermeulen, W (2007). Regulation of UV induced DNA
damage response by ubiquitylation. DNA Repair. 6, 1231-1242.
Fitch, Maureen E., Nakajima, Satoshi, Yasui, Akira, Ford, James M. 2003. In Vivo
Recruitment of XPC to UV-induced Cyclobutane Pyrimidine Dimers by the DDB2
Gene Product. The Journal of Biological Chemistry Vol. 278, No. 47: 4690646910.
Wang, Qi-En, Zhu, Qianzheng, Wani, Gulzar, El-Mahdy, Mohamed A., Li, Jinyou, Wani,
Altaf A. 2005. DNA repair factor XPC is modified by SUMO-1 and ubiquitin
following UV irradiation. Nucleic Acids Research Vol. 33, No. 13: 4023-4034.