LS1A: Carbon-containing compounds are the building blocks of life.
Photosynthesis is the process that plant cells use to combine the energy of
sunlight with molecules of carbon dioxide and water to produce energy-rich
compounds that contain carbon (food) and release oxygen.
1. The formula for photosynthesis is:
2. In words, photosynthesis is:
3. Draw a picture of a plant cell. Use arrows to show the inputs and the outputs for
photosynthesis.
4. Plants do photosynthesis so they can make:
5. What do plants do with the glucose they make?
a.
b.
c.
d.
6. Why do animals need the glucose plants make?
7. Why do animals need the oxygen plants make?
Resource: http://www.pbs.org/wgbh/nova/nature/photosynthesis.html An interactive
simulation about photosynthesis.
LS1B:The gradual combustion of carbon-containing compounds within
cells, called cellular respiration, provides the primary energy source of
living organisms; the combustion of carbon by burning fossil fuels
provides the primary energy source for most of modern society.
1. The formula for cellular respiration is:
2. In words, cellular respiration is:
3. The inputs for cellular respiration are:
4. The outputs for cellular respiration are:
5. How does glucose have energy?
6. The energy in glucose gets turned into a form of energy that cells can
use:
7. Why do cells need this energy?
8. Animals do cellular respiration because
9. Plants do cellular respiration because
10. When you a fossil fuel (like gas in your car) you do the following
reaction: C3H8 + O2 makes CO2 + H2O + energy. How is this similar to
cellular respiration?
Resource:
http://www.sumanasinc.com/webcontent/animations/content/cellularrespiration.
html click on “big picture”
LS1C: Cells contain specialized parts for determining essential
functions such as regulation of cellular activities, energy capture
and release, information proteins, waste disposal, the transfer of
information, and movement.
For each part of the cell listed in the table, label it on the pictures above
and describe its function on the table below.
Part of the cell Function
Cell membrane
Cell wall
Nucleus
Chromosome
Chloroplast
Mitochondrion
Ribosome
Cytoplasm
Vacuole
Resource: http://www.cellsalive.com/cells/cell_model.htm
LS1D: The cell is surrounded by a membrane that separates the interior of
the cell from the outside world and determines which substances may
enter and which may leave the cell.
Diffusion
1. Diffusion always causes particles to move from a region of _______________
concentration to region of ______________ concentration.
2. Does diffusion require energy?______________ Does it require a membrane?
_______
Osmosis
3. Osmosis is the ________________ of _______________ across a ____________.
4. In which direction does water move across membranes? It moves ____________ the
concentration gradient from a ____________ concentration to a ____________
concentration.
5. Each red blood cell bellow is surrounded by a solution. Below each picture, label
where the concentration of solute is the highest (inside, outside, same).
_____________
_____________
______________
6. Use arrows to show the movement of WATER in each of the cells
LS1D: continued.
7. Label the picture of the cell membrane: Include protein,
hydrophobic, hydrophilic, and lipid bilayer
Facilitated Diffusion
8. In facilitated diffusion, which direction do molecules move across
membranes? They move from a __________ concentration to a
_________ concentration.
9. Does facilitated diffusion require energy?____________ Does it
require a membrane ? __________
10. During facilitated diffusion, what do the molecules travel through
in the membrane? _______________
Active Transport
11. In active transport, which direction do molecules move across
membranes? They move from a _______ concentration to a _________
concentration.
12. What is required for active transport to work?
____________________
13. Draw active transport occurring on the diagram below. Include
protein, high concentration, low concentration, and ATP.
Resource:
http://programs.northlandcollege.edu/biology/biology1111/animations
/passive1.swf
LS1E: The genetic information responsible for inherited characteristics
is encoded in the DNA molecules in chromosomes. DNA is composed of
four subunits (A,T,C,G). The sequence of a subunit in a gene specifies
the amino acid needed to make a protein. Proteins express inherited
traits (ex. eye color, hair texture) and carry out most cell function.
1. DNA is made up of four different nucleotides/bases: _____, ______,
_____, and _____.
2. Label the bases on the DNA molecule below.
3. For the strand below, complementary DNA bases below each one
TACTGTAAAGGCTATATGCCGAAT
4. When we talk about “genetic information”, what part of the DNA are we
talking about?
What do we mean when we talk about
“genetic information”?
5. How does the genetic information coded in the DNA of a muscle cell in
your arm compare to the genetic information in the DNA of a cell in
your brain?
6. What happens to allow your brain cells to take a different shape and
function compared to your arm cells?
7. What is the relationship between DNA, genes and proteins?
Resource: http://learn.genetics.utah.edu/content/begin/tour/
LS1E continued
8. How do your genes determine your characteristics?
9. In what part of the cell does DNA get turned into mRNA?
10. What determines the sequence of nucleotides in a mRNA?
11. Turn the DNA sequence of bases below in to an mRNA
sequence of bases.
TACTGTAAAGGCTATATGCCGAAT
12. Where does an mRNA go after it has been made?
13. At the ribosome, mRNA gets translated into
14. A string of amino acids with a certain shape is called a
.
15. What molecule brings amino acids to the ribosome?
16. Translate the following mRNA into amino acids
.
AUGCACCCCGAGAAU
Resource:
http://www.biotechnologyonline.gov.au/popups/int_translation.html,
http://www.biotechnologyonline.gov.au/popups/int_transcription.html
LS1F All the functions of the cell are based on chemical reactions. Food
molecules are broken down to provide energy and the chemical
constituents needed to synthesize other molecules. Breakdown and
synthesis are made possible by enzymes.
Some of these enzymes enable the cell to store energy in special
chemicals, such as ATP, that are needed to drive the many other
chemical reactions in a cell.
1. Proteins are broken down into
2. Carbohydrates are broken down into
3. Lipids/fats are broken down into
4. DNA/RNA are broken down into
5. Amino acids are put together to make
6. Simple sugars are put together to make
7. Fatty acids are put together to make
8. Nucleotides are put together to make
9. The types of molecules that break down and put together the molecules
in questions 1-8 are called
10. Enzymes are a type of
11. What are some examples of molecules in the body that can store
energy?
12. What type of molecules help transfer energy from food into energy for
cells?
13. Why do cells need energy?
LS1G: Cells use the DNA that forms their genes to encode enzymes and other
proteins that allow a cell to grow and divide to produce more cells, and to
respond to the environment
1. Describe how cells use DNA to make enzymes and other proteins.
2. If a cell’s environment changes, what can the cell do to respond to that
change?
3. What are some things that a cell can change about the proteins and enzymes
that it makes?
LS1H: Genes are carried on chromosomes. Animal cells contain two
copies of each chromosome with genetic information that regulate body
structure and functions. Most cells divide by a process called mitosis, in
which the genetic information is copied so that each new cell contains
exact copies of the original chromosomes.
1. Describe the relationship between DNA, genes, and chromosomes using
this figure
2. How many copies of each chromosome do you have?
3. Where did each of your copies of your chromosome come from?
4. What information is contained in chromosomes?
5. What is the process by which new cells are made called?
6. Briefly describe how new cells are made.
7. How many cells result in mitosis?
8. What is true about the number of chromosomes in these cells?
9. What is true about the genetic info in these cells?
LS1I: Egg and sperm cells are formed by a process called meiosis in which
each resulting cell contains only one representative chromosome from
each pair found in the original cell. Recombination of genetic information
during meiosis scrambles the genetic information, allowing for new genetic
combinations and characteristics in the offspring. Fertilization restores
the original number of chromosome pairs and reshuffles the genetic
information, allowing for variation among offspring.
1. What is the point of meiosis?
2. What types of cells are made in meiosis?
3. How many cells are made in meiosis?
4. What is true about the number of chromosomes in these cells, compared
to the original cell?
5. What is true about the genetic information in each of these cells?
6. Name and describe two ways in which meiosis makes every single egg or
sperm cell unique.
a.
b.
7. Why are siblings, people with the same parents, not identical to one
another?
8. If meiosis makes cells with half the number of chromosomes, how do
offspring end up with the full number of chromosomes?
9. How does fertilization allow siblings to be different from one another?