SUPPORTING INFORMATION
Hi-Fi SELEX: A high-fidelity digital-PCR based
therapeutic aptamer discovery platform
Eric Ouellet,1,2,3 Jonathan H. Foley,4,5 Edward M. Conway,4,5 Charles Haynes1,2,3*
1
Michael Smith Laboratories, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada
2
Department of Chemical and Biological Engineering, University of British Columbia,
Vancouver, BC, V6T 1Z3, Canada
3
Biomedical Engineering Program, University of British Columbia, Vancouver, BC, V6T 1Z4,
Canada
4
Centre for Blood Research, University of British Columbia, Vancouver, BC, V6T 1Z3, Canada
5
Department of Medicine, Faculty of Medicine, University of British Columbia, Vancouver, BC,
V6T 2B5, Canada
Table S-I. ssDNA SELEX library, primers and blocker sequences used in this study
Name
Sequence (5’ – 3’)
Comment
Library
TCGCACATTCCGCTTCTACC – N40 –
CGTAAGTCCGTGTGTGCGAA
N40 = random nucleotide region of
library
FOR
TCGCACATTCCGCTTCTACC
5’ amplification primer
REV or
3’-Comp
p- TTCGCACACACGGACTTACG
3’ phosphorylated amplification
primer /
complementary blocker
5’-Comp
GGTAGAAGCGGAATGTGCGA
5’ complementary blocker
Table S-II. Core (random region) sequences of the top factor D-mediated inhibitors of
complement activation (alternative pathway) recovered from the demonstration aliquot
containing 40 – 60 of the unique aptamer sequences within the final retention pool after
3 rounds of Hi-Fi SELEX. Each isolated sequence (clone) reported in the Table are
listed in order of % inhibition observed.
Clone
Factor D
Core region sequence (5’ – 3’)
Number
Inhibition
28
ACGGAGAAAGAGAGAGTGTAATTGCTAGCATAACCGCTGC
56 %
29
GTAACCACGTTGCCAGACCGAGTCTACCAGCGATCCTCAG
51 %
19
TATGCCCAAATCCCTCAAGTCGGCCAGGATACACCACCGT
44%
21
AATCAAAAGGCTCACGCGCGGATTGGTCAACCTTACAACC
39%
35
TCGGCCTTCCCAGACCACCGCAATCCCCAGGGAACAGGCA
36%
13
CATCACACTGTCAACATACCCAGCCTGGGGAAAGACGAAC
35%
36
AACCCGCATGCCGATCGATGTCGTGCCTCGCTCCACGCTC
33%
12
ACCAGGCACCCGACGGACTAACTCATCACTCAGGCGAGGG
33%
aInactivation
assay was performed using full-length (library) sequences
Table S-III. Isothermal titration calorimetry (ITC) data for binding of human factor D to
either the full-length (full length) library sequence or the random-region (truncated)
sequence of clones 19 and 29. Standard deviations for fitting both the equilibrium
binding affinity and enthalpy are reported.
Aptamer
Clone 19
Clone 29
n
Kd
∆H
T∆S
∆G
(nM)
(kcal mol-1)
(kcal mol-1)
(kcal mol-1)
Full Length
0.95
0.714 ± 0.247
-8.25 ± 0.06
4.29
-12.54
Truncated
0.90
0.627 ± 0.157
-6.26 ± 0.04
6.32
-12.58
Full Length
0.93
4.55 ± 0.46
-5.87 ± 0.03
-5.52
-11.39
Truncated
0.95
5.44 ± 0.42
-7.47 ± 0.07
-3.82
-11.29
Figure S1. Relative amounts of SELEX library members that were irreversibly retained
on Nunc Immobilizer™ plates which had undergone various surface treatments to block
reactive sites and eliminate non-specific adsorption. No target was immobilized on the
plates. (A) Comparison of amounts of library members that were non-specifically and
irreversibly retained on the standard (commercial) Nunc Immobilizer™ plate surface
(control), and after that surface has been pre-treated with 1 M ethanolamine, 1% Ficoll
(w/v), 1% Ficoll and 1% polyvinyl alcohol (w/v), or tris-containing aptamer folding (AF)
buffer supplemented with 0.005 % Tween 20. (B) Comparison of levels of non-specific
adsorption observed after blocking the Nunc Immobilizer™ plate surface with 1X AF
buffer supplemented with 0.005 % Tween 20 for either 1 hr or 16 hrs. Standard
deviations are reported for quadruplicate absorbance readings from duplicate
experiments. For all ELONA-assay values reported, the background colorimetric signal
when no SELEX library was incubated with the passivated surface was first subtracted.
Figure S2. Identification of reaction conditions for immobilizing a target protein on the
modified display surface at densities most suitable for Hi-Fi SELEX. (A) Relative
amounts of human α-thrombin immobilized on the display surface at different reaction
pH. (B) Change in the surface density of immobilized human α-thrombin as a function
of the concentration of thrombin in the reacting solution. (C) Computed mean center-ofmass distance of separation of immobilized thrombin as a function of the concentration
of the immobilization solution. The dashed line indicates the separation distance below
which aptamer bridging effects could theoretically be observed. Standard deviations are
reported for quadruplicate absorbance readings from duplicate experiments.
Figure S3. Effect of surface passivation chemistry (A) and immobilization conditions (B)
on the functional (serine protease) activity of immobilized target (human α-thrombin).
Activities were determined by monitoring (Ex=370 nm, Em= 450 nm) the cleaving rate of
a fluorogenic substrate. In both data sets, negative controls indicate the spontaneous
cleavage rate measured for each passivated surface containing no immobilized αthrombin. Standard deviations are reported from quadruplicate fluorescence readings
from triplicate experiments.
Figure S4. Effect of incubation time during a selection round on (A) competent library
partitioning to the immobilized target (α-thrombin) phase, and (B) non-specific
partitioning of the competent library to the same surface, but without immobilized target.
Absorbance values reported reflect the quantity of aptamer recovered from the surface
following selection and washing. Statistically significant differences in adsorbed
amounts are reflected in the p-values reported, where a p-value > 0.1 is reported as not
significant (n.s.), calculated from the standard
Figure S5. Dependence of ddPCR performance in amplifying 108 unique library
members on the mean copies-per-droplet (CPD) value used. Gel documentation and
associated band-intensity analyses show that significant by-products formation occurs
at CPD values above 50.
Figure S6. Schema depicting the principal duplex structure of amplicons, and the
resulting action of λ-exonuclease on the 5’-phosphoylated reverse strand following PCR
amplification of ssDNA SELEX libraries of low (Left column) and high (Right column)
sequence diversity.
Figure S7. Normalized melting curve data for amplicon pools (1014 total amplicons)
generated from ssDNA SELEX libraries of different sequence diversity. The sequence
diversity of the library is reported for each melting curve reported. Transitions (peaks)
centered at a Tm of ~ 81 °C and ~ 67 °C correspond to melting of fully complemented
homo-duplexes and partially complemented hetero-duplexes, respectively.
Figure S8. Real-time λ-exonuclease-mediated hydrolysis of 5’phosphorylated antisense strands as a function of the sequence diversity of the initial amplification pool.
Data for sequence diversities ranging from a single amplicon sequence to 10 9 unique
sequences are reported along with that for a negative control (Negative) in which no λexonuclease was added. The data show that both the initial hydrolysis rate and the
total extent of hydrolysis decrease with increasing sequence diversity.
Figure S9. Relationship between the sequence diversity of the ssDNA SELEX library
and the fraction fhetDNA of those sequences participating in a hetero-duplex structure
following amplification. (A) Normalized areas of the melting transitions (Figure S7) for
the hetero-duplexes and homo-duplexes within the pool within the 1014 amplicons. (B)
Fraction of all amplicons that are in a hetero-duplex structure, computed from the data
in (A). Standard deviations are reported from quadruplicate experiments.
Figure S10. Schema and results for the alternative PCR/PicoGreen™ method for
quantifying the sequence diversity of a retained aptamer pool. (A) Eluted library
members are PCR amplified. (B) Calibration standards (108 to 100 individual members)
generated by PCR amplification are then used to define the slope of fluorescently
quantified double-stranded regions (generated by PicoGreen™ staining) of serially
diluted amplicons. (C) The sequence diversity of an eluted pool can be quantified using
this information. The data show that for library diversities spanning 6 orders of
magnitude, the slope is inversely proportional to the sequence diversity due to the
increased proportion of hetero-duplexes formed at higher diversities. Standard
deviations are reported for slopes quantified by quadruplicate fluorescence readings
from duplicate experiments.
Figure S11. Comparison of diversities from eluted aptamer pools selected using
competent (blocked) or standard (unblocked) libraries after the third round of Hi-Fi
SELEX. (A) Raw data used to estimate pool diversity by the melting curve method
defined in Figures S7 and S9. (B) Quantification of pool diversities by the
PCR/PicoGreen™ fluorometric assay described in Figure S10. Standard deviations are
reported for quadruplicate fluorescence readings from duplicate experiments.
Figure S12. SPR sensorgrams for binding of human factor D to immobilized biotinylated
aptamers from (A) the entire round 3 pool (Kd = 1.17 ± 0.63 nM) or (B) the
representative factor D inhibiting aliquot generated from that pool and containing 40 –
60 unique aptamer sequences (Kd = 0.97 ± 0.43 nM). Experiments were performed on
a Biacore 3000 using an SA chip. Several concentrations of Factor D were injected, and
the results fitted to a 1:1 Langmuir isotherm.
Figure S13. M-fold predicted secondary structures for the full-length blocked aptamers
sequences in Table S-II. Several of the clones exhibit a common bulge-loop motif.