“Forget Antibodies. Use Aptamers!” Presentation Contents: 1. Introduction and Background 2. Aptamer Introduction 3. Diagnostic Applications 4. Drug Discovery Applications 5. Delivery Applications Founder Highlights: B.S. in Biochemistry, minor in Mathematics Philadelphia College of Pharmacy and Science Ph.D. in Neuroscience Hahnemann University (Drexel University College of Medicine) Gaetano Tom Caltagirone, Ph.D. Dissertation Thesis work Yale University Aptagen, a biotechnology company based in central Pennsylvania, offers aptamer custom-based services to replace antibodies in research, diagnostic platforms, drug discovery and therapeutics. The company was founded in 2004 by Dr. G. Thomas Caltagirone, and operations began at the current facility located in Jacobus, PA in 2006. Dr. Caltagirone has over 20 years of research and business experience in start-ups. A native of York, PA, he began his studies at The University of the Sciences in Philadelphia followed by Drexel University in Philadelphia and completed his thesis on “Proton-Sensitive Ribozyme Switches with Molecular Memory” at Yale University with a Ph.D. in Neuroscience. Aptagen has grown from a one-man operation with the help of local interns to a tight-knit developing business with clients ranging globally from research academics at top-tier institutions to BigPharma companies. Aptagen has been named as a finalist for the “Top Emerging Business of the Year” by Central Penn Business Journal. Aptamers are an emerging technology that is poised to become the next evolution in diagnostics and drug discovery. Aptagen continues to play a leading role in developing aptamer technology that will assist in the treatment and diagnosis of various diseases. © 2007 Serving over 50 Companies, Organizations, and Universities globally. Examples of Aptamer Shapes A. B. C. D. A. B. C. D. Pseudoknot (ligand for HIV-1 reverse transcriptase) G-quartet (ligand for thrombin) Hairpin (ligand for bacteriophage for T4 polymerase) Stem loop/bulge (ligand for ATP) taken from McGown, et.al. (1995) - pM to nM affinity - Engineer out cross-reactivity…eliminate false positives (10,000 fold specificity, e.g. Theophylline/Caffeine) - Ligand binding against unknown and undiscovered biomarkers - Manufacturing (pennies on the dollar) - Stability (long shelf-life; heat denature/refold) Apta-index™ (database of aptamers) Basic Concept of ‘Directed Molecular Evolution’ Heterogeneous Population of Molecules ’sloppy’ copy to explore mutations collect Target immobilized on column surface ‘Fittest’ molecules Molecules that Bind to Target discard Molecules that do not Bind to Target General Aptamer Selection Scheme determine oligo sequence(s) of aptamer(s) random oligonucleotide pool 1014 single-stranded molecules Oligo synthesizer (7 to 15 rounds) target Propagate (i.e. amplify by PCR) Capture ligand-target complexes discard unbound collect bound oligo ligands Diagnostic Applications Conventional Antibody-based Diagnostics (ELISA) Method Plate coated with capture antibody Add samples Add detection antibody Add substrate Incubation steps and wash steps before detection = total time >>2 hours Apta-beacon™ Diagnostic Assay (simple 1-step reaction, free in-solution) Negative Sample Positive Sample No Incubation or wash steps = total time << 1 minute Analyte Quantitate based on a titration of controls Biosensor and Biochip Platforms Point mutation to inactivate switch function Aptamers easily tethered to solid interface through a wide variety of conjugation chemistries. Detection of binding event intact Apta-sensors Aptamers that produce an immediate output signal for detection of target analyte. apta-beacons™ Q F apta-switches™ F/Q removed FlashGel™ analysis (5 minute run) Apta-switch™ (aptamer that produces a self-cleavage output signal) Target Metal Ions Small Organics Example Co2+, Ni2+, Cd2+ Zn2+, Mn2+ Caffeine Peptides Rev Peptide Proteins Phosphorylated ERK2, Unphosphorylted ERK2 100 90 80 70 500-fold sensitivity range 60 1 minute reaction at 23oC, then stopped with stop buffer containing excess EDTA. Specificity Against Theophylline vs. Caffeine T7 Synthesized N55 random oligo library N55 Random Region Promoter Primer Extension RT-PCR N55 5’ Transcription Aptamer RNA library Mg++ dependent Cleavage site N55 pre 5’ clv Fluorophore Hammerhead ribozyme motif Refolding Negative/Counter Selection PAGE Partitioning Selection (-) Target Library (Buffer alone or Counter-target) clv Positive Selection Library (+) Target Optional: 1. RT-PCR 2. Transcription 3. Refolding PAGE Partitioning pre Purify Cleaved Purify Pre-cleaved Apta-switch Selection Strategy 5’ Apta-beacons™ vs. Competition Chemistry antibodies aptamers apta-beacons™ protein DNA/RNA RNA ++++ Stable / Refolding ++++ (with RNAse inhibitor) HIGH affinity ++++ ++++ ++++ HIGH selectivity + ++ ++++ ++++ ++++ ++ ++++ Unknown or undiscovered biomarkers Small targets + Targets which are difficult to immobilize ++++ One-step detection: direct output signal from target binding ++++ In-solution based detection ++++ ++++ ++++ Lower Cost to manufacture ++++ ++++ Sequences provided + ++++ Client retains IP + ++++ Biosensor implementation ++ Apta-switch™ Demonstration Kit (Theophylline/Caffeine) Drug Discovery Applications Pharmaceutical Drug Development Process Success Rate 5 Enter human clinical trials > 8 years >$1B Animal Testing of Drug candidates 5000 In vitro or in vivo assays on drug candidates Knowledge of Target / Mechanism Pharmaceutical Drug Development (combinatorial, natural product screening, etc.) MASS SCREENING Drug Discovery Process (time consuming and labor intensive) Random High Volume Screening In Vitro Studies In Vivo Studies Clinical Studies Humans Combinatorial Chemistry A positive hit in a “test” tube environment does not necessarily translate into a success in an in vivo environment. Compound has to be re-engineered and tested again in test tube, then back to animal. Back and forward through this iterative process costs time and money. http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8 Aptagen’s Drug Discovery in Whole-Animal Models (Saving Time and Money) X X Random High Volume Screening In Vitro Studies In Vivo Studies Clinical Studies Humans Combinatorial Chemistry By eliminating the “test” tube step, and performing drug discovery ‘directly’ in an animal model, we are one step closer to human clinical trials, thereby saving time and money. http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8 Reasons for Failures of Aptamer Drug Candidates Typical Aptamer Strategy: Develop aptamers in vitro against a known protein target of interest to block disease pathway. however… In vitro selected aptamers do not necessarily operate/function in vivo as therapeutic candidates. Aptamers are sensitive to the environmental conditions in which they are selected. In Vitro Studies In Vivo Studies Clinical Studies Humans The Conventional Paradigm in preclinical development is deficient. DELIVERY is always an issue! http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8 WHOLE-ANIMAL SELECTION Animal Model of disease or condition Molecular Library (bolus injection, nasal, or oral administration) Isolate and process tissue or organ of pathological interest Replicate (Amplify), enrich, and reselect MOLECULES associated with pathological marker Pathological Marker Normal Tissue Area http://images.google.com/images?q=drug+discovery&btnG=Search&hl=en&lr=&ie=UTF-8 In drug development, DELIVERY is always an issue! Selection in Whole-Animals solves DELIVERY issues. (Use molecular bullet to attach known drug to increase specificity) Chemical Diversity solves drug-like effects. Potential for ‘smart’ molecular bullets with Drug-like properties Initial round Progression of Selection with gradual disappearance of pathological marker… Normal tissue no sign of pathology Nth round of ‘natural’ selection… Key Requirements for Successful Selection: 1) Self-replicating molecules 2) Animal Model 3) Characteristic Phenotype for Visualization (of Target or Biomarker) Disease, Infection (bacterial or viral), etc... Could possibly Influence behavior? Enhanced cognitive abilities? etc… Delivery Applications Preliminary Experiment: Targeting Major Organs & In Vivo Stability Tail vein injection 2’-F-RNA library (-) Library nanomolar amounts 40 minutes post-IV Isolate various organs/tissue Tissue Harvesting Purification of Rare 2’-F-RNA species RT-PCR Lane: 1 DNA Ladder 2 3 no band gel 2’-F-RNA Targeting to Major Organs of the Mammalian Anatomy 2’-F-RNA LUNG Targeting focused on LUNG enrichment... Enrichment Ratio = qPCR of ‘extracted’ library relative to ‘input’ library Enrichment RATIO 6.00E-02 5.00E-02 4.00E-02 3.00E-02 * * 2.00E-02 * 1.00E-02 0.00E+00 G9 G9A2 LIBRARY G9B1 G9C4 CLONES Secondary Structures (MFOLD) ΔG -43.49 kcal.mole-1 Tm 73.6oC Family # of Clones Group A 12 Group B Group C ΔG -36.17 kcal.mole-1 Tm 75.6oC ΔG -37.45 kcal.mole-1 Tm 65.9oC 5’- gggcgacccugaugag [Consensus Sequence] cgaaacggugaaagccguagguugccc -3’ [UGACUGCUCCGUUCCGUUAUGACAGCUGCACCCAGUUAAAGC:GGUUCUGGGUCCGGA] G9A2 7 [CCUUUUUGAACAACUGUGCGAUUUGAUUG:AAAAUUCUCUCUGAUCCCACCGUGACG] 2 [UCUAGAGCGCAGAAACUUCUCUCAACGAUUCCCCACGUCCUCGCCCCGCCCGGU] G9B1 G9C4 Fluorescence Microscopy 1) 5’-end labeled G9C4 RNA aptamer with ADO™550/570 2) Washed with PBS & Fixed tissues with acetone 3) In situ bound (~4 mg) aptamer for 40 minutes at room temperature, and wash 1/6 sec exposure Lung 1/3 sec exposure Note: brain, spleen, heart, kidney were NEGATIVE Liver Aptamer Selection for Surface Binders Template LCR Negative Selection G6-Gx Circular DNA PCR Amplification of bound aptamers PC3 Positive Selection (G0-G5) (Optional) PCR Amplification of unbound aptamers PC3-PSMA Unbound aptamers Bound aptamers WASTE Figure 1. Schematic of Strategy. Linear template will undergo circularization via LCR (Ligation Chain Reaction). The circularized aptamers will be incubated with PC3-PSMA cells for positive selection. Aptamers specific for PSMA will be amplified; the selection process will be repeated for approximately five generations, before beginning a negative selection process with parental PC3 cells. Flow Cytometry of Enriched Aptamer Library on (-) Parental Cells A. B. PC3 Cells G0 G19 unlabeled Figure 7. Enrichment of the circular ssDNA library specific for PC3 monitored by flow cytometry. 5 x 105 PC3 cells were incubated with G0 (scrambled), G19 (enriched), or unlabeled (binding buffer only) Figure 7. Enrichment of the circular ssDNA library specific for PC3 monitored by flow cytometry. 5 x 105 PC3 cells were library for 30 min at 4°C. incubated with G0 (scrambled), G19 (enriched), or unlabeled (binding buffer only) library for 30 min at 4°C. a. Flow cytometry dotplot results of unlabeled (left), G0 (center), and G19 (right) labeled PC3 cells. a. dotplot results of (y-axis) unlabeled (left), G0 (center), G19 cell (right) labeled PC3 The top row TheFlow top cytometry row represents side scatter and forward scatterand (x-axis) morphology bycells. identification represents side scatter (y-axis) and forward scatter (x-axis) cell morphology by identification of the cells, and of the cells, and excluding any debris and dead cells from the PC3 cells. The bottom row shows excluding any debris and dead cells from the PC3 cells. The bottom row shows fluorescence (x-axis) and side scatter fluorescence (x-axis) and side scatter (y-axis) the FITC fluorescently-library that has bound to the PC3 (y-axis) of the FITC fluorescently-library that hasofbound to the PC3 cells. cells. Ref:[Notebook, AN Priya Book 3, 124-127] Ref:[Notebook, AN Priya Book 3, 124-127] b. Histogram of flow cytometry Fluorescence intensity (x-axis) as a function of the number of viable cells (y-axis) b. Histogram of flow cytometry Fluorescence intensity (x-axis) as a function of the number of viable analyzed with Flowing Software v1.6.0. The G19 library (blue) is shifted to the right of the G0 (red) and unlabeled library cells (y-axis) analyzedwith withPC3 Flowing (black) after incubation cells. Software v1.6.0. The G19 library (blue) is shifted to the right of the G0 (red) and unlabeled library after incubation with PC3 cells. Ref:{Notebook, AN Priya Book 3, (black) 124-127] Ref:{Notebook, AN Priya Book 3, 124-127] Flow Cytometry of Enriched Aptamer Library on (+) Cells A. B. PSMA-PC3 Cells unlabeled G0 G19 Figure 6. Enrichment of the circular ssDNA library specific for PSMA-PC3 monitored by flow cytometry. 2.5 x 105 PSMA-PC3 cells were incubated with G0 (scrambled), G19 (enriched), or unlabeled Figure 6. buffer Enrichment of the circular ssDNA library specific for PSMA-PC3 monitored by flow cytometry. 2.5 x 105 PSMA-PC3 (binding only) library for 30 min at 4°C. cells were incubated with G0 (scrambled), G19 (enriched), or unlabeled (binding buffer only) library for 30 min at 4°C. a. Flow cytometry dotplot results of unlabeled (left), G0 (center), and G19 (right) labeled PSMA-PC3 cells. The cytometry top row represents side scatter (y-axis)(left), and G0 forward scatter celllabeled morphology by cells. The top row a. Flow dotplot results of unlabeled (center), and (x-axis) G19 (right) PSMA-PC3 represents side (y-axis) and forward cell morphology by identification thebottom cells, and excluding any identification of scatter the cells, and excluding anyscatter debris (x-axis) and dead cells from the PSMA-PC3 cells.ofThe debris and fluorescence dead cells from the PSMA-PC3 cells. The bottom rowFITC-labeled shows fluorescence (x-axis) and side (y-axis) of the row shows (x-axis) and side scatter (y-axis) of the library that has bound toscatter the FITC-labeled library that has bound to the PSMA-PC3 cells. PSMA-PC3 cells. Ref:{Notebook, AN Priya Book 3, 124-127] Ref:{Notebook, AN Priya Book 3, 124-127] b. offlow flowcytometry cytometryFluorescence Fluorescenceintensity intensity(x-axis) (x-axis)asasa afunction functionofofthe thenumber number viable b. Histogram Histogram of ofof viable cells (y-axis) analyzed with Flowing Software v1.6.0. The G19 library (blue) is shifted to the right of the G0 (red) and unlabeled cells (y-axis) analyzed with Flowing Software v1.6.0. The G19 library (blue) is shifted to the right of thelibrary (black) after incubation with PSMA-PC3 cells. G0 (red) and unlabeled library (black) after incubation with PSMA-PC3 cells. Ref:{Notebook, AN Priya Book 3, 124-127] Ref:{Notebook, AN Priya Book 3, 124-127] Cell-based Selection for Intracellular-targeting Aptamers intracellular target Capture ligand-target complexes Circular-ssDNA library discard unbound isolate intracellular bound oligo ligands >100-fold preference for cells expressing intracellular target versus control cells Microscopy of Internalized Polyclonal Aptamer Library (-) counter cells expressing mutant receptor Figure 2B. Phase contrast and fluorescent images of (-) Mutant receptor cell line following exposure to the TAMRA labeled G12 library. Mutant receptor cells, grown to 100% confluency in a 100 mm TPP tissue culture dish, were exposed to 0.06 µM TAMRA labeled G12 library in 3ml of binding buffer (0.1mg/ml yeast tRNA, 1mg/ml BSA in wash buffer) for 30 minutes at 370C. The unbound library was aspirated from the dish (transferred to Positive target cells); cells were washed twice with 5 mL wash buffer, scraped from their plate into 1 mL of wash buffer. A 20 ul aliquot was placed on a glass slide for microscopy. Both the phase contrast (left image) and fluorescent (right image) images were taken at 40X magnification of the same field using a Tsview 1.4 MP CCD COOLED camera. These images suggest the library does not bind to the (-) Mutant receptor cell line. [Ref: Notebook, NSR 3 – 43] Microscopy of Internalized Polyclonal Aptamer Library (+) target receptor expressing cells Figure 2A. Phase contrast and fluorescent images of Target receptor cell line following exposure to TAMRA labeled G12 library. Target cells, grown to 100% confluency in a 60mm TPP tissue culture dish, were exposed to TAMRA labeled G12 library (3 ml of the unbound fraction after (-) Mutant selection), for 30 minutes at 370C. The excess library was aspirated from the dish; cells were washed twice with 5 mL wash buffer (1X PBS supplemented with 4.5 mg/mL glucose and 5mM MgCl2); scraped from their plate into 1 mL of wash buffer. A 20 ul aliquot was placed on a glass slide for microscopy. Both the phase contrast (left image) and fluorescent (right image) images were taken at 40X magnification of the same field using a Tsview 1.4 MP CCD COOLED camera. The images suggest that the G12 library was internalized. [Ref: Notebook, NSR 3 – 43] Aptagen’s Capability Against a Wide Range of Targets The AptabodyTM Technology Conceptual Relationships aptabodyTM aptamer Naked nucleic acid Conjugated nucleic acid Functionalized nucleic acid Effective Drug Delivery Improve PK/PD AptabodyTM Library (>1014 molecules) unique SupraMolecular structures (activity arises from the precise positioning of functional groups within scaffold) Diversity of Functional Groups • organics • metals * fatty acids * amino acids * sugars * small molecule drugs *molecular sizes are not relatively proportional Comparison of Pharmaceutical Drug Formats organics & natural products Biologics Peptides & Proteins Aptabody™ (postulated) Nucleic Acid Aptamer Chemical Diversity Large Moderate Small Largest Serum stability Yes Yes Yes Yes DELIVERY Moderate Moderate n/a Yes Drugs on the Market Largest Small One None No Yes Yes Yes Moderate Largest Large (<30 KD) Large (<60 KD) ‘In Vivo Selection’ Capability Flexibility to Improve PK/PD properties Small (300-500D) Moderate Moderate to Largest (up to 180 KD for Antibody) 3’ Molecular Size Smallest C pro tyr Most favorable condition C A ser leu T Small molecule drugs N val 5’ G 1-717- Aptagen