Confirmation that Xq27 and Xq28 are susceptibility loci for migraine in independent pedigrees and a case-control cohort Maher B.H.1, Kerr M.1, Cox, H.C.1, MacMillan J.C.2, Brimage P.J.3, Esposito T.4, Gianfrancesco F.4, Haupt L.M.1, Nyholt D.5, Lea, R.A.1, Griffiths L.R.1 1 Genomics Research Centre, School of Medical Science, Griffith Health Institute, Griffith University, Gold Coast, Queensland, Australia, 2 Queensland Clinical Genetics Service, Royal Children's Hospital, Herston, Brisbane, Australia, 3 Institute of Neurological Sciences, Prince of Wales Hospital, New South Wales, Australia 4 Institute of Genetics and Biophysics, Italian National Research Council, Naples, Italy 5 Neurogenetics Laboratory, Queensland Institute of Medical Research, Brisbane, Queensland, Australia, Corresponding author: Professor Lyn Griffiths e-mail: l.griffths@griffth.edu.au Genomics Research Centre, Griffith Health Institute, Griffith University, Queensland 4222, Australia. t: +61 7 5552 8664 f: +61 7 5552 9081 Marker Primers Amplicon DXS8064 F: FAM - AGAATCGCTTGACCCTTG 3’ R:CTGATGGCTGCCAACTC 3’ 208-214bp DXS1001 F: FAM - TGTACAAGTAACCCTCGTGACACG 3’ R: TAGTGGCTGGCAGAGAGATTCC 3’ 376-386bp DXS1206 F: FAM - TGCCATAGGTAGTCATAGCATAGCC 3’ R: CAGAGCATGGGACTTCTCAACC 3’ 277-291bp DXS984 F: NED - TGGAGGTCTGATTTAATGGCAGC 3’ R: GCCCTACTCCATTCCACACTGG 3’ 127-141bp DXS8106 F: FAM - CTCCTTGCACTTGCTGTGG 3’ R: TGCTTGCACCCTGTGAAGTC 3’ 387-405bp DXS8043 F: FAM - AGTTCTCAGAAACATTTGGTTAGGC 3’ R: AATTATTGGCAAAGAGTACAGGCAG 3’ 166-184bp DXS297 F: NED - TTGGACTTCCCAAGCCTCCACAA 3' R: TTCTGAGTCTGTGCAGTGTATTTGTCAG 3' 191-197bp DXS8091 F: FAM - CCACATTCAGGTTCCACAGGTACC 3’ R: TGCAAGATCCAGGCAAAAGTCTC 3’ 90-108bp DXS1123 F: FAM - TGCCTAAATGTTCGCAAGCCCATTC 3’ R: ACAAACAGCTGCCTCCTAGAAACCC 3’ 168-176bp DXS8061 F: VIC - GCAAGCTTGAAGTGTCCATGAGG 3’ R: AGAAGCTGATGTGCTCCCTGC 3’ 141-155bp DXS15 F: PET - AGCACATGGTATAATGAACCTCCACG 3' R: CAGTGTGAGTAGCATGCTAGCATTTG 3' 154-166bp DXS1073 F: VIC - TTGGGTGGAATTCCGTGACC 3’ R: CCAAAGAATGCCCTCTCCGA 3’ 197-211pb DXS1108 F: PET - GGAGTGAATTCATCATATGTGATTTCC 3’ R: ACTAGGCGACTAATACAGTGGTGCTC 3’ 168-184bp GPR50 F: VIC - GCCTGACTCTGTTCATTTCAAGCCT R: CTTAGGGTGGCTGGTAGTGGCA 196-208bp Online Resource 1: Primer Sequences and Labels Xq27 Candidate Genes SLITRK2 CXorf1 Gene Product SLIT and NTRK-like family, member 2 chromosome X open reading frame 1 Gene GRP50 Product Orphan G-protein coupled receptor 50 CNGA2 Cyclic nucleotide gated ion channel GABRA3 NSDHL ATP2B3 ABCD1 Gamma-aminobutyric acid (GABA) A receptor, alpha 3 NAD(P) Dependant Steroid Dehydrogenase-like ATPase Ca2+ transporting plasma membrane 3 (PMCA3) ATP-binding cassette, sub-family D (ALD), member 1 FLNA filamin A, alpha (actin binding protein 280) GDI1 GDP dissociation inhibitor 1 CLIC2 Chloride Intracellular Channel 2 Function May play a role in modulating nuerite activity Exact function is unknown however is expressed in the hippocampus # SNPs analysed 2 2 Xq28 Candidate Genes Online Resource 2: Xq27 and Xq28 Candidate Genes Function Expressed in the hypothalamus and the pituitary and has shown positive association between bipolar affective disorder and major depressive disorder in women. Expressed in the middle cerebral and basilar arteries and the trigeminal ganglion. Rat studies have shown that cyclic nucleotide gated channels affect membrane potential suggesting that they may have a role in regulating excitability in the CNS. GABA, the major inhibitory neurotransmitter in the vertebrate brain Involved in cholesterol biosynthesis Brain specific receptor that potentially has a role in calcium homeostasis and signalling. Involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle This actin-binding protein interacts with integrins, transmembrane receptor complexes, and second messengers Primarily expressed in neural and sensory tissues, GDI1 Regulates the GDP/GTP exchange reaction of most Rab proteins Voltage-gated chloride channel activity, that may modulate Ryanodine Receptor (RyR) calcium release channels # SNPs analysed 1 3 10 6 5 1 1 1 2