SUPPLEMENTARY MATERIAL
Chitooligosaccharides prevent osteopenia by promoting bone
formation and suppressing bone resorptionin ovariectomized
rats: Possible involvement of COX-2
Bingshu Hea and Jun Wangb,*
a
Department of Orthopedic Surgery, Hubei Woman and Child Hospital, Wuhan
430070, China;
b
Department of Pharmacology, College of Medicine, Wuhan University of Science
and Technology,Wuhan 430065, China.
* Author to whom correspondence should be addressed; EMail:wangj79@hotmail.com; Tel.: +86-27-87661513; Fax: +86-27-68893590.
Abstract
Chitooligosaccharides(CHOS) added in diet have been foundas potent calcium
fortifiers in conditions of Ca2+ deficiency such as osteoporosis.In this study, we
found thatpharmaceutical intervention using CHOS prevented ovariectomyinducedbone
mineral
density
loss
and
the
deterioration
of
trabecularmicroarchitecture in a dose-dependent manner(p < 0.05 or
0.01).CHOS (125, 250 mg/kg)suppressed the serum levels of bone resorption
biomarkers CTx and TRACP5b induced by ovariectomy(p < 0.05),
butincreased the levels of osteogenic markers ALP and OC by 11.3-11.6% and
10.7-15.2%
of
OVX-group
(p
< 0.05), suggesting CHOS’s
exact
pharmacological action in the control of osteoporosis whichmay be the result
of both promoting bone formation and suppressingbone resorption. Bone
turnover-modulating effectsof CHOS appear related to their anti-inflammatory
capacity to down-regulatemRNA and protein expression of COX-2(17.2-32.2%
and 16.4-21.9% of OVX-group, p < 0.05 or 0.01),a key madiatorlinking
between inflammation and osteoporosis.
Keywords: chitooligosaccharides; osteoporosis; cyclooxygenase-2
1
Experimental
Chemical
CHOS(degree of deacetylation of 90% and average molecular weight of 1500 Da)
provided by the company of Qingdao BZ Oligo Biotech Co. Ltd (Qingdao, Shandong,
China) were prepared from chitosan isolated fromcrustaceansshell by enzymatic
hydrolysis. The purity of the CHOS is determined by HPLC and it has achieved 90%
at least.
Animal models and treatment protocols
Female Sprague-Dawley rats (3 months old, 230 ± 10 g) were obtained from the
Experimental Animal Center of the Hubei Province (Certificate No. SCXK-20080005, Hubei, China). Rats were housed at a constant room temperature of 22 °C and
maintained under controlled conditions of 12 h light/12 h dark photoperiod. All
animals received human care according to the criteria outlined in the Guide for the
Care and Use of Laboratory Animals published by the National Institutes of Health,
and the experiments were approved by the Animals Care and Use Committee of
Wuhan
University of
Science
and
Technology Medicine
College.
After
acclimatization for 1 week, surgery of animals was performed under pentobarbital
sodium (50 mg/kg body weight, i.p.) anesthesia. The rats underwent either bilateral
laparotomy (Sham group, n = 10) or bilateral oophorectomy (OVX group, n = 50).
Then the OVX rats were randomly divided into into 5 groups of 10 animals in each
group: OVX control, OVX with low dose CHOS -treated (62.5 mg/kg), medium dose
CHOS –treated (125 mg/kg) and high dose CHOS -treated (250 mg/kg), and positive
control group. All the samples were suspended in normal saline. Rats in the Sham and
OVX control groups were administered with the same volume of normal saline.
Vehicle and CHOS were all administered orally through an oral gavage once per day.
E2 was injected intraperitoneally in animals of positive control group at a dosage of
0.1 mg/kg body weight 3 times per week. The treatments started after 3 days of
recovery from surgery and lasted for 12 weeks. At the end of treatment, the mice were
sacrificed after the blood was collected by cardiac puncture.
Femur and tibia were isolated from adjacent tissues, wrapped in saline-soaked
gauze bandages to prevent dehydration, and stored at −20 ◦C until examination for
BMD and structural analysis. The lumbar L1-L3 were snap frozen in liquid nitrogen
for mRNA and protein preparations.
BMD analysis
2
BMD of the rightfemur and tibia were determined by a dual-energy X-ray
absorptiometer (DEXA; XR-36; Norland, Fort Atkinson, WI) using a mode for small
subjects as described previously (Li et al. 2012).
Bone structure analysis
The left proximal femurs were fixed in formaldehyde sodium phosphate (Na2HPO4)
for 24 to 48 h. Each bone sample was cut longitudinally into sections (6 µm thick)
using a microtome (Polycut E, Leica, Nussloch, Germany) and stained with H&E. For
analysis, well-established quantitative trabecular bone morphometric parameters,
includingBV/TV(%),Tb.Th(μm), Tb.N(1/mm) and Tb.Sp (mm),were calculated using
a light microscope equipped with a HMIAS-20 type high-resolution medical colorful
image analyzing system (Qianping Image Co., Wuhan). The selected regions were 1
mm below the growth plate and extended distally for 1.5 mm.
Detection of bone turnover markers in serum
Blood was allowed to clot for 30min.Serum was then separated via centrifugation at
1500g for 10min. ALP and OC levels, as the biomarkers of bone formation, were
estimated with ALP Activity Assay Kits (Nanjing Jiancheng Bioengineering
Institute, Nanjing, China ) and Rat Osteocalcin EIA Kit (Biomedical Technologies,
Stoughton, MA) according to the manufacturers' instructions, respectively. Serum
levels of bone resorption biomarkers CTx andTRACP5bwere evaluated using
commercial
ELISA
kits
(CTx
:Immunodiagnostic
Systems
Ltd.,
Boldon,
UK;TRACP5b: Westang, Shanghai, China).
Real-time PCR
To explore the mechanisms associated with CHOS on OVX-induced osteoporosis in
rats, total RNA isolated from frozen lumbar was extracted for analysis of real-time
PCR using the TRIzol reagent according to the manufacturer’s protocol (Invitrogen,
Carlsbad, CA, USA). After quantifying the isolated RNA using a spectrophotometer,
2-lg aliquots were reverse transcribed using a Transcriptor First Strand cDNA
Synthesis Kit (Genecopoiea, USA). The primer sequences used to amplify COX-2
and β-actin mRNA are 5’-ACCGTGGTGAATGTATGAGCATAGGA -3’ (forward)
and
5’-TCAGGTGTTGCACGTAGTCTTCGAT
TGTTTGAGACCTTCAACACCCC
-3’(reverse),
-3’(forward)
and
and
5’5’-
ACGTCACACTTCATGATGGAA -3’ (reverse), respectively. Real-time PCR was
carried out in a StepOnePlus™ Real-Time PCR System. Level of COX-2 mRNA
3
were normalized to those of β-actin.The mean ratio of each group was calculated as
the average for 10 animals.
Western blotting analysis
The lumbar tissues were homogenized with a homogenizer in ProteoJET™
Mammalian Cell Lysis Reagent (MBI fermentas) followed by centrifugating at 4 °C,
14,000 rpm for 20 min.The protein concentration in the lysate was measured by the
Lowry method. The supernatants (50 μg protein/lane) were separated by 10% SDSPAGE and then transferred to nitrocellulose membrane by electroblotting. The
membrane was then blocked overnight and then incubated for 2 h with a 1:1000
dilution of goat polyclonal COX-2 or β-actin antibody (Santa Cruz, CA, USA). After
incubation with the secondary antibody, proteins were detected with an ECL
chemiluminescence detection kit.The amount of protein expression was corrected by
the amount of β-actin in the same sample.
Statistical analysis
All the grouped data were statistically evaluated with SPSS11 software. Hypothesis
testing methods included one way analysis of variance (ANOVA) followed by least
significant difference (LSD) test; p value of less than 0.05 were considered to indicate
statistical significance. All the results were expressed as the mean ± SD for 10
animals in each group.
Figure S1. BMD of femur (a) and tibia (b). BMD of the right femur and tibia was
measured by dual-energy X-ray absorptiometry after 12 weeks treatment. Values are
the mean ± SD. ** p < 0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.
4
Figure S2. Histology and parameters of bone. (a)Bone architecture of the proximal
femurs after 12 weeks treatment (H&Estain).Osteocytes were visualised in inset.
Slides are representative of 10 animals per group; (b) Trabecular bone parameters
assessed: bone volume fraction (BV/TV), trabecular thickness(Tb.Th), trabecular
number(Tb.N) and trabecular separation(Tb.Sp). Values are the mean ± SD. ** p <
0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.
5
Figure S3. Serum levels of osteoporotic biochemical markers including alkaline
phosphatase (ALP), osteocalcin(OC), telopeptides of collagen type I (CTx) and
tartrate-resistant acid phosphatase 5b (TRACP5b) in OVX rats. Values are the mean
± SD. ** p < 0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.
Figure S4. Expression of COX-2 in lumbar. (a) Relative amount of COX-2 gene was
measured with quantitative real time polymerase chain reaction. Data were
normalized to the β-actin gene. (b) Relative amount of COX-2 protein was
measured withWestern blotting. β-actin was used as an internal control. Values are
the mean ± SD. ** p < 0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.
6
References
Li TM, Huang HC, Su CM, Ho TY, Wu CM, Chen WC, Fong YC, Tang CH.2012.
Cistanche deserticola extract increases bone formation in osteoblasts.J Pharm
Pharmacol. 64:897–907.
7