1
Supplementary Methods
Saccharomyces cerevisiae strains. YEF473, a gift from Professor Mark Longtine
(Oklahoma State University), is the parent strain used in this paper. The result was
reproduced in two other backgrounds, Hansen BY4743 (Open Biosystems), and L5976
(1278b strain background, a gift from Professor Gerald Fink, Whitehead Institute).
L5976 (a/ ura3-52/ura3-52 trp1::hisG/trp1::hisG leu2::hisG/leu2::hisG); BY4743
(a/his3-1/his3-1 leu2-0/leu2-0 ura3-0/ura3-0 met15-0 lys2-0); YEF473
(a/ ura3-52/ura3-52 lys2-801/lys2-801 leu2-1/leu2-1 his3-200/his3-200 trp163/trp1-63).
Molecular biology techniques and reagents. Diploid yeast expressing one Cterminally Gfp-tagged septin allele were created via the one step PCR tagging
technique31, 32. The plasmid used for PCR amplification was pLP27, a pRS304
derivative containing the Gfp coding sequence (S65T, V163A; GenBank accession
number AJ002683) between the XbaI and BamHI sites (a gift from Professor Rong Li
laboratory, Harvard Medical School). Yeast transformations were performed as
previously described33. The identity of the transformants was confirmed by sequencing
(Harvard Biopolymers Facility; GfpR primer) the PCR amplified Gfp-tagged genomic
septin allele. The Cdc3F (or Cdc12F) and GfpR primers were used for amplification.
The primers’ sequences (5’ to 3’) are given in Supplementary Table 1.
For the in vitro analysis, the Gfp DNA was sub-cloned into a pET-28 vector
(Novagen) between the BamHI and XhoI sites. The resulting vector was transformed
into BL21 (DE3) bacteria. Gfp was isolated using standard procedures34 and further
purified from large aggregates on a Superdex 200 gel filtration column (Amersham
Biosciences). The monomeric species were used for anisotropy measurements.
2
Microscope considerations and calibration. The filter cube used for
excitation/emission was the Endow GFP Bandpass (Chroma Technology Corp). During
the image acquisition, the epifluorescence field diaphragm was minimized (diameter of
approximately 25-30 m), such as to reduce the amount of scattered light and improve
the signal to background ratio. To correct for differences in transmission of the
horizontally and vertically polarized light through the microscope optics the setup was
calibrated using a fluorescein solution. Since fluorescein fluorescence lifetime is much
longer than its rotational correlation constant, differences in IXX, IYYi are mainly due to
differences in transmission. A correction factor of 0.9 was applicable for IYY. This
transmission bias was a constant for our setup and was checked frequently during the
course of the experiments. Differences in the light path resulting in misalignment were
also accounted for. We used sub-resolution fluorescent beads (~170 nm, Component B
of the PS-Speck Microscope Point Source Kit, Molecular Probes) and determined that
the misalignment of the YY acquired image relative to the XX one was approximately
one pixel in the X direction, and two pixels in the Y direction.
In vivo analysis considerations. The nocodazole arrested or partially arrested yeast are
easier to image, quantify and interpret than the asynchronous population. Because the
mother and daughter of the arrested yeast have similar sizes, the yeast population is
packed uniformly with the mother-daughter axis in the stage plane. For the
asynchronous culture, the packing can be non-uniform, many cells having the motherdaughter axis at some unknown angle to the microscope stage. The hourglass septin
structures of middle to large budded yeast are quantitatively and qualitatively the same
for an asynchronous and a nocodazole arrested population. The particular sets of data
presented in this paper are from nocodazole arrested yeast, unless otherwise noted.
i
IXX and IYY are the measured intensities using the XX and YY polarizer configurations, respectively.
3
In vitro analysis. Yeast extract were prepared35 from the engineered strains and septin
complexes were purified as previously described36. The purifed complexes were spun at
20,800 g for 5 minutes and diluted in 20 mM Tris pH 8, 1 M KCl. The Gfp anisotropy
I
 G  I VH 37
r= VV
was determined using the Cary Eclipse fluorescence
I VV  2  G  I VH
spectrophotometer (Varian). The correction factor G for our measurements (ex= 490
nm, 10 nm slit; em= 510 nm, 10 nm slit) is 1.70. The final solute concentration was 20
mM Tris pH 8, 1 M KCl, 1% sucrose. The measured anisotropies are shown in
Supplementary Table 2.
To form filaments and bundles, freshly eluted septin complexes were dialyzed
against low salt buffer38. The bundles were tighter and more anisotropic when incubated
with 2 mM MnCl2 for 30 minutes at 30o C or overnight at 4o C. Those bundles were
used for the analysis presented in Fig. 3a and Supplementary Fig. 1c.
4
Supplementary Discussion
The mathematical model. A collection of Gfp dipoles attached to the septin scaffold
describes a surface similar to an hourglass. We approximate the hourglass surface for
the large budded cells to a hyperboloid of one sheet39. Parametric equations describing
the average structure in large budded cells can be derived, given the following
measurements. The average height of the structure (measured along mother-daughter
axis) is 0.6 m (standard deviation (SD)= 0.06 m), while the average bud-neck
diameter is 1.3 m (SD= 0.1 m). The slopes of the asymptotes to the surface
generating hyperbola39 are ~/ 0.77. Such, the following parametric equation describes
the surface:
Hyperboloid(u,v)=(0.65 cosh(v)cos(u), 0.65 cosh(v)sin(u), 0.5 sinh(v)), 0u2Pi and 0.56<v <0.56. The plot of this surface is shown bellow, as generated in Mathematica 5.2
(Wolfram Research, Inc.).
m
m
m
We engineered yeast strains to express fusion proteins between septins and Gfp
such that the fluorophore is orientationally restricted relative to the septin protein. The
resulted Gfp dipole ensembles displayed strongly polarized fluorescence. We developed
5
a mathematical model to analyze the data based on the following observations and
conclusions:

The order present at the Gfp dipole level suggests that the underlying septin
structure is made of ordered septin subunits;

The little noise present in the population data (Fig. 2b, empty black squares)
shows that the property we measure and probably the septin organization is the same
from one yeast to another. We assume that each yeast lands on the gelatin pad
randomly, since the yeast morphology presents no indication of potential bias. Thus the
same result (Fig. 2b, empty black squares) suggests that the septin organization is
invariant upon rotation around the mother-daughter axis (C symmetry axis). The
uniform organization is also supported by the anisotropic pattern present in individual
yeast imaged with the mother-daughter axis perpendicular to the microscope stage (Fig.
2a).
We define a right handed coordinate system, xyz, centered at each point on the
hyperboloid surface ; x= dHyperboloid /du, y= dHyperboloid /dv, z= x  yii, evaluated
at the particular (u, v) corresponding to each point, and normalized (Fig 1a). We
consider a sub-resolution area around each point that is approximately flat and define
f(, ) as its static dipole distribution. The distribution function is normalized and
described using the spherical coordinates  and , as shown in the figure below.
ii
=cross product, . =dot product
6
y


x
z 
The conformational motion of Gfp is slow relative to its fluorescence lifetime40
and in the designed septin-Gfp fusions its steady state anisotropy approaches 0.4
(Supplementary Table 2). Since the excitation and emission transition dipoles are
approximately along the same direction within the Gfp coordinate frame40, we assume
that the two dipoles are collinear during the Gfp fluorescence lifetime for our analysis.
The intensity of a particular area for the light path going through the excitation
polarizer Ex (X or Y), and the emission polarizer Em (X or Y) is:
π 2π
IExEm= K    f (θ, )  D 2Ex  D 2Em  sin( θ)ddθ ; DEx is the dipole projection on the Ex
00
direction and DEm is the projection on the Em direction. K is a correction factor that
incorporates lamp intensity, polarizers, microscope, and sample concentration
differences. Since we are concerned with ratios () of the same sample field, we ignore
K for the theoretical treatment.
There are a few considerations in quantifying and interpreting the data:

The dipole orientational distribution around the average;

The particular curved geometry of the structure as described above along with its
size, close enough to the resolution limit of the microscope (~0.26 m). Thus for any
measurement, more than one unit area is averaged over a curved surface;
7

The excitation and emission depolarization caused by high numerical aperture
objectives41. However, corrections for the emission depolarization can easily be
incorporated into the model equations, while the excitation depolarization is negligible
for our system;

Depolarization due to light scattering (more significant for the in vitro
experiments).
The above mentioned reasons contribute to the observed depolarization (absolute
value of  different from 1). The dipole distribution can be attributed to not perfect
restriction of the Gfp fluorophore relative to the Cdc3 -helix, to some flexibility of the
-helix relative to the septin complex, to imperfect alignment of the septin complexes,
or to all of the above. Further consideration to this issue is given in the ‘Septin filament
orientation within the hourglass’ section below.
Septin filament orientation within the hourglass. The in vitro-assembled septin
bundles are three-dimensional arrangements of longitudinal filaments38. For the Cdc3
and Cdc12 strains described in the main text, the average dipole direction is at 90degrees to the bundles (Fig. 3a, Supplementary Fig. 1c). However, since the filament
assemblies (the bundles) probably have cylindrical symmetric, the average dipole
direction relative to an individual septin filament may not be precisely at 90-degrees.
For the analysis that follows we use the Cdc12 strain since it is the most
anisotropic and thus most useful in restricting the bud-neck filament orientation.
Depending on the Gfp linkage flexibility, the average dipole orientation relative to an
individual Cdc12 tagged filament (Supplementary Fig. 1c) could be between 63 to 117
degrees (the limits are reached for a rigid linkage). However, this interval is based on
the maximum  measured in vitro and is likely much more narrow, since light
scattering depolarization is significant for the in vitro experiments (data not shown). For
the in vivo measurements, the hourglass structure  approaches unity (Supplementary
8
Fig. 1a). This suggests that the Gfp dipoles have a tight distribution around their
average, the x-axis. Thus the septin filaments should be oriented at 63 to 117 degrees to
the x-axis in the xy plane, which is along the y-axis +/- 27 degrees (the maximum
deviation from the y-axis is probably largely overestimated, as explained above).
The measurement. Due to the sub-resolution curvature of the septin scaffold, IXX and
IYY reflect not only the dipole projections in the polarizers’ plane, but also the projection
on the perpendicular axis. The most affected measurements are the ones in areas B and
C. Since the axial (along the light path) resolution of the microscope is worse than the
lateral one, areas B and C measurements average over a larger portion of the septin
surface. Qualitatively, the (IXX- IYY) maximum is still reached when the yeast is oriented
such that the average dipole projection is along the X-axis (calculation not shown). This
justifies ignoring the quantitative aspect in the main text, which is concerned with
finding the average dipole direction.
9
Supplementary Notes
31.
Schneider, B. L., Seufert, W., Steiner, B., Yang, Q. H. & Futcher, A. B. Use of
polymerase chain reaction epitope tagging for protein tagging in Saccharomyces
cerevisiae. Yeast 11, 1265-74 (1995).
32.
Tatchell, K. & Robinson, L. C. Use of green fluorescent protein in living yeast
cells. Methods Enzymol 351, 661-83 (2002).
33.
Gietz, R. D. & Woods, R. A. Transformation of yeast by lithium acetate/single-
stranded carrier DNA/polyethylene glycol method. Methods Enzymol 350, 87-96
(2002).
34.
Patterson, G. H., Knobel, S. M., Sharif, W. D., Kain, S. R. & Piston, D. W. Use
of the green fluorescent protein and its mutants in quantitative fluorescence microscopy.
Biophys J 73, 2782-90 (1997).
35.
Cheng, S. C., Newman, A. N., Lin, R. J., McFarland, G. D. & Abelson, J. N.
Preparation and fractionation of yeast splicing extract. Methods Enzymol 181, 89-96
(1990).
36.
Vrabioiu, A. M., Gerber, S. A., Gygi, S. P., Field, C. M. & Mitchison, T. J. The
majority of the Saccharomyces cerevisiae septin complexes do not exchange guanine
nucleotides. J Biol Chem 279, 3111-8 (2004).
37.
Lakowicz, J. R. Principles of Fluorescence Spectroscopy (Kluwer Academic/
Plenum Publishers, 1999).
38.
Frazier, J. A. et al. Polymerization of purified yeast septins: evidence that
organized filament arrays may not be required for septin function. J Cell Biol 143, 73749 (1998).
39.
1999).
Weisstein, E. W. CRC Concise Encyclopedia of Mathematics. (CRC Press,
10
40.
Volkmer, A., Subramaniam, V., Birch, D. J. & Jovin, T. M. One- and two-
photon excited fluorescence lifetimes and anisotropy decays of green fluorescent
proteins. Biophys J 78, 1589-98 (2000).
41.
Axelrod, D. Carbocyanine dye orientation in red cell membrane studied by
microscopic fluorescence polarization. Biophys J 26, 557-73 (1979).
11
Supplementary Table 1
Primer sequences
The 5’ to 3’ primers’ sequences are shown. The primers ending in F are the forward primers,
while those ending in R are the reverse primers. The names of the forward primers reflect the
fusion proteins they generate. The notation Septin_ab_Gfp is used to indicate that a aminoacids have been deleted from the septin C-terminus, and b amino-acids from Gfp N-terminus.
The strain presented in the main text was obtained using the Cdc3_204_GfpF primer, while
the strain presented in Supplementary Fig. 1 was obtained using the Cdc12_34_GfpF primer.
Cdc3-GfpF and Cdc12-GfpF are the primers used for creating the respective full-length septin to
full-length Gfp fusions, Cdc3-GlySer-GfpF and Cdc12-GlySer-GfpF are used for making the
fusions with a two amino-acids linker between the full-length proteins.
Cdc3-GfpF
GTTAACCACTCCCCCGTCCCTACAAAGAAGAAGGGATTTTTACGTATGA
GTAAAGGAGAAGAACT
Cdc12-GfpF
CTAGAAGAGCAGGTCAAAAGCTTGCAAGTAAAAAAATCCCATTTAAAAAT
GAGTAAAGGAGAAGAACT
Cdc3-GlySerGfpF
GTTAACCACTCCCCCGTCCCTACAAAGAAGAAGGGATTTTTACGTGGAT
CCATGAGTAAAGGAGAAGAAC
Cdc12-GlySerGfpF
CTAGAAGAGCAGGTCAAAAGCTTGCAAGTAAAAAAATCCCATTTAAAAGG
ATCCATGAGTAAAGGAGAAGAAC
Cdc12_34_GfpF
GTAAAAAAACTAGAAGAGCAGGTCAAAAGCTTGCAAGTAAAAAAATCCGA
AGAACTTTTCACTGGAGTTG
Cdc3_204_GfpF
AATTAAAAGCTTTGGAGGACAAGAAAAAACAGCTAGAACTTTCAATAAAT
GAAGAACTTTTCACTGGAGTTG
Cdc3taggingR
ATAATATTTAATAGTGTATGTTTGAAATTTTTATATGTCTTTATTTCGCGTA
CAATCTTGATCCGGAGC
Cdc12taggingR
GATAGGCGTTGAAATTGACGAGACAAAGAGGAAGACATTAATTAATCAC
GTACAATCTTGATCCGGAGC
Cdc3F
TGAGGCAAAACTAGCCAAACTAGAAATTG
Cdc12F
GATTTCACTCTTCCAGCAATTGCACCA
12
GfpR
GATAATGGTCTGCTAGTTGAACGCTTC
Supplementary Table 2
The anisotropy (r) of septin-attached Gfp
The anisotropy of the septin-attached Gfp was determined for the indicated septin complexes
using the Cary Eclipse fluorescence spectrophotometer as detailed in Supplementary Methods
(‘In vitro analysis’ section).
Gfp
Free Gfp
Cdc3-GlySer-Gfp
Cdc3_204_Gfp
Cdc12_34_Gfp
Anisotropy
0.3387+/-
0.3448+/-
0.3577+/-
0.3636+/-
(r)
0.0026
0.0078
0.00145
0.002
species
13
Characterization of the Cdc12 strain
The yeast strain expressing an engineered Cdc12 to Gfp fusion (3 Cdc12
amino-acids, and 4 Gfp amino-acids were deleted) is analyzed. The hourglass
structure (a), the rings (b), and the in vitro bundles (c) imaged with the polarizer
setup are shown. Quantitations of  versus  are shown for the hourglass and
ring structures, correspondingly. Black empty squares= population data, red
filled squares= individual rotations data, blue filled circles= population data for
yeast expressing full-length Cdc12 fused to full-length Gfp, showing isotropic
fluorescence. For the in vitro bundles, a table with the maximum  values for a
given orientation () is shown.
14
Hourglass area C quantitations
Quantitations () for yeast oriented with the mother-daughter axis perpendicular
to the stage plane are shown as color-coded surfaces for the Cdc3 and Cdc12
strains, as indicated.
15
Cdc3 strain rearrangement time lapse
Identically scaled subtractive images (XX-YY) acquired during the diagrammed
hourglass to rings transition with elapsed time (minutes) printed on images.
Graph: quantitation () of this transition for three different cells ( measured in
the red boxed area).
16
Supplementary Movie Legend
The engineered Cdc3 strain hourglass to rings transition
XX and YY images of the same sample field were acquired every 15 seconds
for approximately 11 minutes, at 20oC. The difference images (XX-YY) were
assembled into a movie. Note that there are two imaged yeast both positioned
with the mother-daughter axis parallel to the X-axis (horizontal). The top cell
undergoes the hourglass to rings transition during the imaged interval, while the
bottom cell displays a stable hourglass structure.