3.4: Transcription and Translation
3.5.1: Compare the structure of RNA and DNA.
3.5.1: Compare the structure of RNA and DNA.
IB Question: Compare the structure and composition of DNA with RNA. [4]
both are polymers of nucleotides / both nucleic acids;
sugar is deoxyribose in DNA and ribose in RNA;
DNA is double stranded and RNA is single stranded;
DNA has a (double) helix;
DNA has thymine while RNA has uracil; (require full names written out)
both contain four nitrogenous bases / A, G, C, T for DNA and A, G, C, U for RNA; [4 max]
3.5.2: Outline DNA transcription in terms of the formation of an RNA strand
complementary to the DNA strand by RNA polymerase.
3.5.3: Describe the genetic code in terms of codons composed of triplets of bases.
Genetic code
3.5.4:Explain the process of translation,leading to polypeptide formation.
Translation
What will be the sequence of amino
acids from the following mRNA
transcript?
UAUGGAGCGCUAUCGAUCGUUAGA
IB Question: Explain the process of translation. [8]
messenger / mRNA attaches to ribosome (small unit);
many ribosome/polyribosomes bind to same mRNA;
carries codons / triplet of bases each coding for one amino acid;
transfer / tRNA each have specific anticodon;
triplet of bases for specific amino acid;
tRNA carries specific amino acid;
tRNA binds to ribosomes;
to corresponding triplet base / codon;
a second tRNA binds to next codon;
two amino acids bind together;
in a peptide linkage;
first tRNA detaches;
ribosome moves along mRNA;
another tRNA binds to next codon;
continues until polypeptide / protein formed to stop codon;
stop codon has no corresponding tRNA/amino acid / causes release of polypeptide; [8 max]
IB Question: Compare DNA transcription with translation. [4]
both require ATP;
DNA is transcribed and mRNA is translated;
transcription produces RNA and translation produces polypeptides/protein;
RNA polymerase for transcription and ribosomes for translation / ribosomes in translation
only;
transcription in the nucleus (of eukaryotes) and translation in the cytoplasm/at ER;
tRNA needed for translation but not transcription; [4 max]
3.5.5: Discuss the relationship between one gene and one polypeptide.
One gene may code for multiple polypeptides due to alternative splicing