Molecular Microbiology (2011) 80(5), 1169–1185 䊏
doi:10.1111/j.1365-2958.2011.07636.x
First published online 4 April 2011
Mutations in b⬘ subunit of Escherichia coli RNA polymerase
perturb the activator polymerase functional interaction
required for promoter clearance
mmi_7636 1169..1185
Ganduri Swapna,1‡ Atanu Chakraborty,1†‡
Vandana Kumari,1 Ranjan Sen2 and
Valakunja Nagaraja1,3*
1
Department of Microbiology and Cell Biology, Indian
Institute of Science, Bangalore 560012, India.
2
Laboratory of Transcription Biology, Centre for DNA
Fingerprinting and Diagnostics, Hyderabad 500001,
India.
3
Jawaharlal Nehru Centre for Advanced Scientific
Research, Bangalore 560064, India.
Summary
Transcription activator C employs a unique mechanism to activate mom gene of bacteriophage Mu. The
activation process involves, facilitating the recruitment of RNA polymerase (RNAP) by altering the
topology of the promoter and enhancing the promoter
clearance by reducing the abortive transcription. To
understand the basis of this multi-step activation
mechanism, we investigated the nature of the physical interaction between C and RNAP during the
process. A variety of assays revealed that only DNAbound C contacts the b⬘ subunit of RNAP. Consistent
to these results, we have also isolated RNAP mutants
having mutations in the b⬘ subunit which were compromised in C-mediated activation. Mutant RNAPs
show reduced productive transcription and increased
abortive initiation specifically at the C-dependent
mom promoter. Positive control (pc) mutants of C,
defective in interaction with RNAP, retained the property of recruiting RNAP to the promoter but were
unable to enhance promoter clearance. These results
strongly suggest that the recruitment of RNAP to the
mom promoter does not require physical interaction
with C, whereas a contact between the b⬘ subunit and
the activator, and the subsequent allosteric changes
Accepted 11 March, 2011. *For correspondence. E-mail vraj@mcbl.
iisc.ernet.in; Tel. (+91) 80 2360 0668; Fax (+91) 80 2360 2697.
†
Present address: Mammalian Genetics Laboratory, London
Research Institute, Cancer Research UK, London WC2A 3PX, UK.
‡
G.S. and A.C. contributed equally to this work.
© 2011 Blackwell Publishing Ltd
in the active site of the enzyme are essential for the
enhancement of promoter clearance.
Introduction
Transcription initiation is one of the most important regulatory steps in gene expression. In bacteria the process
is comprised of sequential steps of RNA polymerase
(RNAP) binding at the promoter (closed complex formation, RPc), isomerization through kinetic intermediates
leading to promoter melting (open promoter complex,
RPo) and the start of RNA synthesis (RPI), before it enters
a productive elongation state (RPE) (Roe et al., 1984;
Saecker et al., 2002) (Fig. 1A). Transcription activators
interact with RNAP subunits to positively influence the
rate-limiting step(s) described above (Rhodius and Busby,
1998; Roy et al., 1998). A vast majority of the activators
bind to s or a subunit of RNAP to activate transcription
(Rhodius and Busby, 1998). In addition, the major subunits of RNAP (b and b′) which constitute the catalytic
centre of the enzyme also provide the interaction surface
for the activators. While a number of activators that
contact the b subunit have been discovered (Lee and
Hoover, 1995; Szalewska-Palasz et al., 1998; Kulkarni
and Summers, 1999; Deighan et al., 2008; Rao et al.,
2009; Yuan et al., 2009), interaction with the b′ subunit of
RNAP appears to be rare (Miller et al., 1997).
Transcription activator protein C is a middle gene
product of the phage Mu. Activity of C is required for the
expression of phage late gene mom, which encodes a
unique DNA modification function. Pmom, the promoter for
the gene, has typical characteristics of a weak promoter,
having suboptimal -10 and -35 elements and a 19 bp
spacer (Fig. 1B). In addition, an intrinsic distortion is conferred by a stretch of ‘T’ residues (Fig. 1B) in the spacer
region. These diverse negative regulatory features render
the Pmom inaccessible for Escherichia coli RNAP in the
absence of the activator (Balke et al., 1992; Sun and
Hattman, 1998). Upon binding at its site adjacent to -35
element, the phage late gene activator C unwinds the
promoter resulting in the alteration of the DNA topology,
thus realigning the promoter elements to facilitate RNAP
binding at Pmom (Ramesh and Nagaraja, 1996; Basak and
1170 G. Swapna et al. 䊏
Fig. 1. Multi-step activation by C protein at Pmom.
A. Transcription initiation pathway. RNAP holoenzyme (R) binds to the promoter (P) through base-specific contacts to form a closed complex
(RPC). Subsequently, RPC undergoes conformational changes through its kinetic intermediates (RPint) to form a heparin-resistant open complex
(RPO) associated with melting 12–14 bp duplex DNA around the +1 site. Addition of initiating nucleotides results in the formation of initiation
complex (RPI) ready for elongation. RNAP at this stage synthesizes short 2–14 nt abortive transcripts before proceeding into the productive
elongation mode. Promoter clearance involves RNAP switching from abortive synthesis to productive elongation complex (RPE). C protein
mediates RNAP recruitment at the promoter and enhances promoter clearance.
B. Promoter architecture of Pmom. The C binding site (CBS) is indicated by horizontal bar. T-stretch, neighbouring Pmom -10 element; -35 and
-10 elements; and transcription start sites are indicated. The -10 region and transcription start sites of divergent promoter element P2 are
also indicated in the figure.
Nagaraja, 1998). Subsequently, C reduces abortive transcription and enhances promoter clearance (Chakraborty
and Nagaraja, 2006). The steps of transcription initiation
influenced by multi-step activation process of C are
depicted in Fig. 1A.
Earlier studies on C–RNAP interaction indicated that C
contacted neither s70 nor a subunit C-terminal domain
(a-CTD) (Sun et al., 1998). In this study, we investigated
the requirements and the nature of the interaction
between C and RNAP (if any), in order to understand
further the molecular basis of the two-step transactivation
at mom promoter. Here, we demonstrate that C contacts
the b′ subunit of RNAP leading to allosteric changes at the
active centre. This in turn appears to facilitate the
enhancement of the promoter clearance by reducing the
synthesis of abortive products. Our results also reveal that
the activator–polymerase interactions occur only after the
recruitment of RNAP to the promoter.
Results
Physical interactions between C and RNAP
According to the ‘pre-recruitment’ model, transcription activators can interact with RNAP prior to binding to the
promoters (Griffith et al., 2002; Griffith and Wolf, 2004). A
number of transactivators, viz. SoxS, MarA, Rob, MotA,
etc., contact RNAP subunits in the absence of the promoter
DNA (Martin et al., 2002; Pande et al., 2002; Shah and
Wolf, 2004). Hence, we first analysed the interaction
between C and RNAP by carrying out surface plasmon
resonance refractometry (SPR) and the ability of C to
interact with isolated subunits of the enzyme by yeast
two-hybrid assays (described in Experimental procedures). Both these assays revealed that C does not interact
with RNAP in the absence of the promoter DNA (Fig. S1A
and B). Likewise, gel filtration and cross-linking studies
also did not indicate any interaction between the activator
and intact RNAP or the individual subunits of the enzyme
(data not shown).
Since the transactivation of mom gene is initiated by
sequence-specific binding and DNA untwisting by C
leading to RNAP recruitment (Ramesh and Nagaraja,
1996; Basak and Nagaraja, 1998), it is likely that DNA
binding is a prerequisite for the interaction between the
transactivator and the RNAP. We used SPR, gel filtration
and cross-linking assays again to monitor the C–RNAP
interactions on the DNA. A 24 bp biotinylated DNA fragment containing the C binding site (CBS) was at first
immobilized on a streptavidin (SA) chip, which was subsequently saturated by injecting C protein. Injection of
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1171
RNAP onto this DNA-bound C showed a relative increase
of 140 RU over the non-specific control indicating that C
binds RNAP in its DNA-bound conformation (Fig. 2A). The
increment in RU upon addition of RNAP occurred only
from its interaction with DNA-bound C and not due to
RNAP binding to the DNA because the fragment was
saturated with C protein. Similar SPR measurements
were carried out with core RNAP to evaluate further the
nature of interaction. Core polymerase showed similar
binding with DNA-bound C (Fig. 2B). The comparable
ability of core RNAP to interact with DNA-bound C indicates three important points: (i) Interaction is independent
of core or holoenzyme conformation, (ii) s subunit of
RNAP is unlikely to be the interaction partner for activator
binding, and (iii) activator–RNAP interaction occurs at a
post-recruitment step.
Interaction between C and RNAP was further analysed
by analytical gel filtration chromatography. In a superdex
75 gel filtration column, individually RNAP, DNA-bound C
and C alone eluted in 33rd (8.25 ml), 38th (9.5 ml) and
47th (11.25 ml) fractions respectively (Fig. 2C, i, iii and ii).
To analyse interaction between the two proteins, C and
RNAP were mixed together and applied to the column,
with or without 25 bp DNA-containing CBS (Table S1)
(Fig. 2C, iv and v). RNAP eluted in the 33rd fraction in
both the runs (Fig. 2D, i, lanes 1, 2). Immunoblotting with
anti-C antibody of the 33rd fraction confirmed that C did
not co-elute with RNAP in the absence of DNA (Fig. 2D, ii,
lane 1), while DNA-bound C protein co-eluted with RNAP
(Fig. 2D, ii, lane 2). Glutaraldehyde mediated crosslinking was carried out to verify further the interactions
between DNA-bound C and RNAP. C and RNAP were
incubated with or without DNA, the resulting complexes
were treated with glutaraldehyde and the reactions
were immunoblotted using anti-C antibody. Cross-linked
product of RNAP and C was observed when the reactions
were carried out in presence of DNA (Fig. 2E, lane 2). No
such cross-linked species was seen in the absence of
DNA (Fig. 2E, lane 3). From all these experiments, viz.
SPR, gel filtration and cross-linking, it is evident that
RNAP interacts with C only when the latter is bound to
DNA.
C protein binds to b⬘ subunit of RNAP
Next, we examined the nature of the interaction of C with
RNAP on DNA. A number of activators contact a-CTD and
the region 4 of s70 during their activation process (Igarashi
and Ishihama, 1991; Kuldell and Hochschild, 1994;
Ebright and Busby, 1995; Kim et al., 1995). As both holoand core-enzymes can bind to C protein (Fig. 2A and B),
it can be concluded that the s70 is not the target for C,
which confirmed the earlier observations (Sun et al.,
1998). Cross-linking experiments with the reconstituted
core RNAP-containing CTD deleted a (DCTDa2bb′) or
full-length a subunit (a2bb′) revealed that the activator
cross-linked with both the species (Fig. S2), and thereby
also ruling out a-CTD as the target for C interaction. The
interaction with a-NTD seems to be unlikely based on the
similar mobility of the C–RNAP and C-DCTD a RNAP
cross-linked products (Fig. S2). These experiments thus
narrowed down the C interacting surface to b or b′ subunits of RNAP.
Protease protection assays were carried out to investigate the protection of the b or b′ subunits by C protein.
RNAP was incubated with C protein in the presence of
mom promoter DNA, followed by the addition of trypsin
and the cleavage pattern of b or b′ subunits were detected
by probing with respective antibodies. C protein conferred
protection on b′ subunit of RNAP (Fig. 3A, ii, lane 4), while
the b subunit appeared to be unprotected (Fig. 3A, i, lane
4). The positive control (pc) mutants of C (F95A and
R105D, see later section), which bind DNA but show
compromised transactivation (Paul et al., 2003), failed to
render protection to either b or b′ subunits of RNAP
(Fig. 3A, i, ii, lanes 2, 3). These results indicated that the
interaction surface for C resides on the b′ subunit of the
RNAP.
In order to further map the interaction surface, we
repeated the trypsin cleavage assays using a holo RNAP
comprising a [P32] label at the C-terminal of b′ subunit (see
Experimental procedures). C protein conferred protection
on b′ subunit from trypsin cleavage, while no such protection was observed with the pc mutant R105D (Fig. 3B),
essentially confirming our findings described above.
However, it should be noted that the reduction in the
intensity of the trypsin cleavage products could arise
either from the direct protection of the surface or due to
C-induced conformational changes in the b′subunit (see
later section and Discussion).
Mutations in b⬘ subunit defective for C-mediated
transactivation
To further functionally validate the importance of C–b′
subunit interplay during transactivation, we developed a
genetic screen to identify mutations in the rpoC gene
defective for C-mediated activation. The strategy is
described in Experimental procedures and in Fig. S3. We
isolated 12 mutants which showed 15- to 20-fold reduced
b-galactosidase activity from the Pmom–lacZ reporter in the
strain comprising C-encoding plasmid (Fig. 4A). Upon
sequencing, mutations were identified as G524D, P243S–
S503F and T1050I. These RNAP mutants could be defective in general transcription from E. coli s70 promoters or
specifically compromised at C-dependent Pmom promoter.
The rpoC mutants, when tested showed comparable
activity to WT enzyme from Plac promoter-based reporter
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
1172 G. Swapna et al. 䊏
assays (Fig. 4B), indicating that general transcription is
not affected and the mutations could be indeed specific to
mom promoter. In vivo transactivation assays were also
carried out with a variant mom promoter known as Ptin7
(Balke et al., 1992). In this mutant mom promoter, substitution of T→G at -14 position converts it into an extended
-10 promoter, which is competent in transcription in the
absence of C. However, the transactivation levels from
this promoter are further enhanced in the presence of C
(Balke et al., 1992; Chakraborty and Nagaraja, 2006). We
observed that the transactivation levels of the rpoC
mutants were comparable to that of WT on Ptin7 promoter
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1173
Fig. 2. Interaction between C and RNAP.
A. SPR with DNA-bound C and holo RNAP. Biotinylated ds 24 bp DNA-containing C binding sequence (CBS) was immobilized on SA sensor
chip. C protein was injected at a concentration of 3 mM to arrive at the saturation of the DNA (1), following which during the dissociation phase
stable binding of C is achieved. In the actual experiment (i.e. the next injection) 3 mM C was passed to saturate unoccupied DNA (2) and
without time-lapse a co-injection was given where 100 nM holo RNAP was passed along with 3 mM C (3). Passing a high concentration of C
protein during co-injection ensures that the oligonucleotides harbouring the C binding site are saturated with C protein and no free DNA is
available for non-specific binding of RNAP. The resultant RU increase observed upon RNAP injection is due to RNAP binding to DNA-bound C
(protein–protein interaction) and not to the free DNA (protein–DNA interaction).
B. SPR with DNA-bound C and core RNAP. These experiments were carried out as described above with 100 nM core RNAP instead of holo
enzyme.
C. Gel filtration analysis. (i) Elution profile of RNAP in superdex 75 column. The RNAP elutes at 33rd fraction (8.25 ml). (ii) Elution profile of C
alone, which elutes at 47th fraction (11.75 ml). (iii) Elution profile of DNA-bound C protein, which elutes at 38th fraction (9.5 ml). (iv) Elution
profile of C+RNAP. (v) Elution profile of C+DNA+RNAP.
D. (i) Western blotting, with anti-b antibody, of (1) 33rd fraction of the run containing C+RNAP and (2) 33rd fraction of the run containing
C+DNA+RNAP. (ii) Western blotting, with anti-C antibody, of (1) 33rd fraction of the run containing C+RNAP and (2) 33rd fraction of run
containing C+DNA+RNAP.
E. Glutaraldehyde cross-linking with C and RNAP in the absence and presence of DNA was carried out as described in Experimental
procedures. After cross-linking, the samples were immunoblotted with anti-C antibody. C monomer, dimer and C–RNAP cross-linked bands are
indicated.
in the absence of C (Fig. 4C). When b-galactosidase
assays were carried out from Ptin7–lacZ reporter construct
in the presence of activator C, as expected, the levels of
lacZ expression increased with WT RNAP. On the contrary, the mutant RNAPs failed to respond to the presence
of activator C and hence exhibited lower levels of transactivation as compared with WT enzyme from this promoter (Fig. 4D). Together, these results signify that the
defective phenotype of the rpoC mutants is C-specific.
G524DrpoC mutant was isolated multiple times in several
Fig. 3. C induced protection of b′ subunit of
RNAP.
A. Trypsin cleavage protection assay of RNAP
in the presence of C or pc mutants. RNAP
was incubated with Pmom in presence of F95A,
R105D or C at 37 °C for 10 min. Trypsin was
added to the reactions and further incubated
for 5 min. Reactions were immunoblotted with
(i) anti-b or (ii) anti-b′ antibodies. The
protected bands are indicated by arrows.
B. RNAP with C-terminal P32-labelled b′
subunit was incubated with either C protein or
its pc mutant R105D in presence of DNA and
subjected to trypsin digestion. The b′ subunit
shows a protection in the cleavage pattern in
presence of C (indicated by asterisk),
whereas the pc mutant or the absence of C
protein in the reaction does not confer
protection.
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
1174 G. Swapna et al. 䊏
Fig. 4. In vivo transactivation of RNAP rpoC mutants. (A) mom promoter. RpoC mutants isolated in the genetic screen were assessed for
their transactivation ability by carrying out b-galactosidase assays on mom–lacZ fusion construct. The putative mutants are labelled M1–M12.
The mutants exhibit 15- to 20-fold reduced transactivation levels as compared with the WT RNAP from Pmom promoter in presence of C. The
rpoC mutants were sequenced and identified to be G524D, T1050I and P243S–S503F. These mutants were assessed for their general
transcription efficiency by carrying out b-galactosidase assays on (B) lac promoter, (C) tin7 promoter, (D) tin7 promoter in the presence of
transactivator C.
independent screens and hence chosen for further
studies.
G524D mutation is defective in C-mediated promoter
clearance
To further understand the mom promoter-specific defect
in rpoC mutant, in vitro transcription assays were carried
out on E. coli promoters Ptrc, PT7A1, C-dependent Pmom and
transactivator-independent mutant mom promoter Ptin7.
Transcription from E. coli Ptrc and PT7A1 promoters were
unaffected by G524DrpoC RNAP (Fig. 5A, i, ii), corroborating the in vivo results. Mutant RNAP exhibited reduced
productive transcription compared with WT RNAP on Pmom
and Ptin7 promoters when transactivator C is present in the
reaction (Fig. 5B, lanes 1, 2, 3, 4). In contrast, transcription from Ptin7 was again comparable between WT and
mutant RNAP, in the absence of transactivator C (Fig. 5B,
lanes 5, 6). These results substantiate the C-specific phenotype of G524DrpoC. The mutant RNAP is competent in
transcription from typical E. coli promoters but compromised in transcription from Pmom which is C-dependent.
Abortive initiation profiles of both the enzymes on Pmom
indicated that the mutant RNAP showed an enhanced
abortive RNA synthesis as compared with WT enzyme
(Fig. 5C). In contrast, as expected, abortive initiation
pattern was unchanged with PT7A1 (Fig. 5A, ii). The
increased abortive initiation could account for the
decreased productive transcription by G524DrpoC RNAP
on C-dependent promoters, i.e. decreased ability of the
mutant enzyme for promoter clearance.
In addition, promoter binding (closed complex) and promoter melting (open complex formation) assays were
carried out as described in Supporting information. The KB
values indicate that the RNAP recruitment of both the
species was comparable (109 M-1) on the Pmom and Ptin7
promoters (Fig. S4A–D). The open complex formation
assays also showed that the isomerization step per se was
not compromised in the mutant enzyme (Fig. S5). From
these results, it appears that the decreased transcription at
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1175
Fig. 5. Effect of G524DrpoC mutation on promoter clearance.
A. In vitro transcription from E. coli s70 promoter (i) Ptrc and (ii) PT7A1. WT and G524D RNAP transcribe with equal efficiency. G524D RNAP
exhibits comparable abortive profile from PT7A1. The graphs show quantitative representation.
B. In vitro transcription assays to assess the productive transcription profile of WT and G524D RNAP on Pmom and Ptin7 promoter constructs.
RNAP–promoter open complexes were allowed to form either in the presence or in the absence of C. Open complexes were challenged with
heparin and transcription was initiated by addition of NTPs. The transcripts were analysed on 8% denaturing PAGE, quantified using Multi
gauge software. Transcription from Pmom with WT RNAP was taken as 100%. The graphs show quantitative representation.
C. Abortive initiation profile of the WT and G524D RNAP on Pmom promoter in presence of activator C, as analysed on 25% denaturing PAGE.
The results are an average of three independent experiments.
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
1176 G. Swapna et al. 䊏
Pmom by mutant RNAP is due to the increased abortive
transcription and the G524D mutation in rpoC confers
specific defect only in the C-mediated transactivation.
RpoC mutation is located away from the DNA
binding surface
The effect of G524DrpoC RNAP seen above on mom
transcription essentially mirrors the compromised transactivation observed with pc mutants (Paul et al., 2003).
Because the pc mutants of C showed decreased protection
of b′ subunit (Fig. 3A, ii and B), we probed the mutant
RNAP–C interaction with two different proteases. Upon
immunoblotting, C-induced protection from V8-protease
treatment was detected only in the b′ subunit of WT RNAP
and not with the G524D mutant (Fig. S6). Next, WT and
mutant enzymes labelled at C-terminus of b′ subunit (see
Experimental procedures) were subjected to partial trypsin
digestion in the presence of C. The b′ subunit of
G524DrpoC RNAP did not exhibit any difference in the
trypsin cleavage pattern either in the presence or in the
absence of C protein, in contrast to the protection seen in
the WT enzyme (Fig. 6A). The trypsin cleavage sites were
identified as described in Experimental procedures. The
cleavage products obtained in the absence of C and with
G524D RNAP coincide to ~115 kDa, 72 kDa, 50 kDa
(Fig. 6A). The corresponding residues were mapped on
the RNAP structure (Fig. 6B). Parallelly, CLUSTALW alignment was carried out between rpoC amino acid sequences
from E. coli, Thermus aquaticus and Thermus thermophilus, to map the C-specific transactivation deficient rpoC
mutant G524D on the T. thermophilus elongation complex
(EC) structure (PDB ID: 2O5I) (Vassylyev et al., 2007a)
using PyMol software. Notably, G524 residue falls at the
farther end of the b′ subunit in RNAP–DNA complex, away
from the DNA binding surface of RNAP (Fig. 6B). The
distance between the G524DrpoC mutation on RNAP
structure and the trypsin cleavage sites varies between
35 Å and 60 Å and the cleavage sites are away from the
DNA binding site (data not shown).
Positive control mutants do not affect RNAP recruitment
but show compromised promoter clearance
Typically, both the pc mutants (F95A and R105D) showed
reduced level of transactivation at Pmom in reporter assays
(Fig. S7). Ability of the pc mutants to unwind promoter
DNA required for RNAP recruitment (first-step transactivation) was assessed by coupled topoisomerase assays,
as described before (Ansari et al., 1992; Basak and Nagaraja, 1998). Prior addition of C protein to the plasmid
resulted in unwinding of the DNA, reducing the extent of
relaxation by topoisomerase I. The analysis indicated
that both the pc mutants were able to unwind the DNA
to the same extent as that of C (Fig. 7A). Analysis of
Fig. 6. Limited trypsin digestion of WT and G524D RNAP.
A. WT and G524D RNAP were incubated in presence of mom
promoter fragment either in the absence or in the presence of C
protein. The b′ subunit of WT RNAP shows a protection in the
cleavage pattern in presence of C (indicated by asterisk), whereas
the b′ subunit of G524D RNAP does not show any C induced
protection.
B. Localization of the G524 residue and trypsin cleavage sites on
T. thermophilus elongation complex (EC). Shown in this figure (T.
thermophilus RNAP EC- 205I) are DNA (brown), RNA (blue), b′
subunit is represented in green helices (cartoon); a, b and w
subunits are represented as space filled model in light blue.
CLUSTALW alignment was carried between rpoC amino acid
sequences of E. coli and T. thermophilus and the corresponding E.
coli residues were mapped on T. thermophilus EC structure. G524
residue is shown as an orange sphere at the farther end of the b′
subunit, away from the DNA binding site. P243 and S503 residues
are also indicated on the structure as orange spheres. P243
localizes close to the lid region of b′ subunit and S503 to the
secondary channel. Nearest residues of trypsin cleavage are
represented as spheres: Magenta: R362/K370/K371/K378- 115 kDa
fragment; red: R744/K749/R764- 72 kDa fragment. Nearest
residues for 50 kDa cleavage product cannot be mapped as these
residues are not conserved between E. coli and T. thermophilus
rpoC genes. (The numbering of residues followed here corresponds
to the E. coli b′ subunit).
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1177
Fig. 7. Comparison of RNAP recruitment and promoter clearance activity of C protein and transactivator mutants.
A. Coupled topoisomerase assay with C and its pc mutants. Supercoiled (SC) pSB13 was partially relaxed (R) with E. coli topoisomerase I
(lane 2), in the presence of C protein (lane 3), R105D (lane 4) and F95A (lane 5) at 37°C. The reactions were analysed on an agarose gel
and subsequently visualized by ethidium bromide staining.
B. RNAP recruitment by C, F95A and R105D at mom promoter. 5′g-32P-labelled promoter DNA (5 nM) was incubated with RNAP (40 nM) in
presence of C, F95A or R105D (50 nM), to form open complexes and then challenged with heparin. Heparin-resistant complexes were
subjected to EMSA. RNAP alone does not bind to Pmom (lane 1); while a competent open complex is formed only in presence of C (lane 2),
F95A (lane 3) and R105D (lane 4).
C. Promoter clearance by C protein. RNAP–promoter open complexes were challenged with heparin and then transcriptions were initiated by
addition of NTPs and [a-32P]-ATP, with or without 300 nM C. The transcripts at different time points were analysed on denaturing PAGE. The
graph (right panel) shows quantitative representation of promoter clearance. Transcription in absence of C at 30 min was taken as 100%.
D. Promoter clearance in absence and presence of F95A. Experiments carried out as above using 300 nM F95A. The graph shows
quantitative representation.
E. Promoter clearance in the absence and presence of R105D. Experiments carried out as above using 300 nM R105D. The graph shows
quantitative representation.
F. Abortive initiation profiles seen in presence of C, F95A and R105D. pc mutants exhibit increased abortive transcription compared with that
seen with C protein. The graph shows quantitative representation. Transcript intensity of 7 mer abortive product obtained in presence of C
protein is taken as 100%.
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
1178 G. Swapna et al. 䊏
Fig. 8. Interaction between pc mutants –
F95A, R105D and RNAP.
A. Gel filtrations containing F95A in
combination with RNAP and DNA are shown
as a representative profile. The elution
patterns (i) and (ii) of the proteins are similar
as described in Fig. 2D (iv) and (v)
respectively.
B. (i) Immunoblotting, with anti-b antibody, of
(1) 33rd fraction of the run containing
F95A+RNAP and (2) 33rd fraction of the run
containing F95A+DNA+RNAP. (ii)
Immunoblotting, with anti-C antibody, of (1)
33rd fraction of the run containing
F95A+RNAP and (2) 33rd fraction of run
containing F95A+DNA+RNAP. (iii)
Immunoblotting, with anti-C antibody, of (1)
33rd fraction of the run containing
R105D+RNAP and (2) 33rd fraction of run
containing R105D+DNA+RNAP. Purified C
protein was used as marker (M).
heparin-resistant RNAP–promoter complexes at Pmom in
presence of pc mutants indicated that both F95A and
R105D facilitated formation of open complexes comparable with C (Fig. 7B), indicating that the pc mutants
retained their ability to unwind DNA and recruit RNAP to
the mom promoter. The difference, if any, in the amount of
the complex formed in presence of pc mutants or C
protein is marginal compared with the differences in their
transactivation potential (Fig. S7). Next, the ability of the
transactivation mutants to enhance the promoter clearance from Pmom was analysed (see Experimental procedures; Chakraborty and Nagaraja, 2006). While the
addition of C protein stimulated transcription by enhancing promoter escape (Fig. 7C), the assays with the mutant
proteins (F95A, R105D) showed no significant change in
transcription profile (Fig. 7D and E). Abortive initiation profiles in presence C, F95A and R105D proteins presented
in Fig. 7F reveal that mutants are defective in second step
activation. Increased abortive transcription seen with the
pc mutants (Fig. 7F) and data presented in Fig. 7C–E
indicates that the pc mutants are compromised in promoter clearance. From these results, it is apparent that
the transactivation mutants were able to unwind DNA and
recruit RNAP to the promoter but were compromised in
enhancing promoter escape by RNAP.
G524D RNAP and pc mutants exhibit contrasting
interaction properties
The results presented thus far demonstrate that both the
pc mutants of C and G524DRNAP affect Pmom transcription at promoter clearance step, with a concomitant loss of
protease protection pattern (Figs 3 and 6A). Hence, one
would expect a loss of interaction between C and RNAP in
these mutant proteins. However, SPR and gel filtration
experiments with G524D RNAP and C protein in presence
of DNA indicated that the interaction per se was not compromised between the two proteins (Fig. S8). In contrast,
the pc mutants when subjected to gel filtration together
with RNAP and DNA did not co-elute with RNAP (Fig. 8A
and B). Thus, although they exhibit similarity in their action
at promoter clearance step, the difference in the interaction properties of mutant RNAP and pc mutants warrant
an explanation other than the physical interaction to
account for the transactivation. Mapping of the mutation in
RNAP away from the DNA binding surface would imply
conformational changes in the enzyme upon C contact.
Protease cleavage sites located away from the DNA also
suggest a role for conformational transitions.
Discussion
Transcriptional regulation requires an intimate interplay of
activators or repressors and the basal transcription
machinery. Diversity in activators and the transactivation
processes would warrant varied modes of the protein–
protein interactions during the process. Although all the
subunits of RNAP are potential targets for binding with
activators (Hochschild and Dove, 1998), in nature,
however, activators seem to prefer binding with CTD of a
or s subunits (Busby and Ebright, 1994; Hochschild and
Dove, 1998), and some bind to NTD of a subunit (Niu
et al., 1996). Among the two subunits which form the
catalytic core, b appears to be a preferred target for activator binding (Lee and Hoover, 1995; Szalewska-Palasz
et al., 1998; Kulkarni and Summers, 1999). N4SSB (Miller
et al., 1997), BglG (Nussbaum-Shochat and AmsterChoder, 1999), RfaH (Belogurov et al., 2007; Sevosty-
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1179
anova et al., 2008) and GreB (Vassylyeva et al., 2007) are
a few of the regulatory proteins shown to interact with b′
subunit. Our study reveals that C protein of bacteriophage
Mu belongs to this latter group.
Some transactivators interact with RNAP subunits and
do not necessarily require intact core/holo enzyme conformation or the presence of DNA. For example, SoxS,
MarA and Rob from E. coli and TraR from Agrobacterium
tumefaciens bind RNAP a subunit in the absence of DNA
(Martin et al., 2002; Qin et al., 2004; Shah and Wolf,
2004). MotA and bacteriophage T4 late gene co-activator,
gp33 bind to the isolated s70 and b subunits respectively
(Pande et al., 2002; Nechaev et al., 2004). N4SSB also
does not seem to require DNA binding while contacting
C-terminus of b′ subunit for activation of phage late genes
(Miller et al., 1997). More recent studies with replication
initiator protein O of phage l indicated that the protein can
contact b subunit of RNAP in the absence of DNA (Szambowska et al., 2011). In contrast, C interacts with core or
holo RNAP only in the presence of DNA-harbouring CBS.
Depending on the contact surface, activator–
polymerase communications during promoter binding or
open complex formation lead to different effects (Busby
and Ebright, 1994; Ptashne and Gann, 1997). For
example, the binding of RNAP to the promoter is stabilized by the activator interacting with a-CTD of RNAP
(Gourse et al., 2000). On the other hand, activators contacting a-NTD or s-CTD mainly increase the rate of
isomerization (Ishihama, 1993; 1997; Niu et al., 1996;
Yamamoto et al., 2001). Interaction of CAP with a subunit
facilitates recruitment of RNAP to lac promoter (Malan
et al., 1984; Ren et al., 1988; Heyduk et al., 1993; Kolb
et al., 1993), while at galP1 promoter, CAP targets a-NTD
to increase the rate of open complex formation (Niu et al.,
1996). Bacteriophage l cI contacts s70 in order to stimulate isomerization of RNAP–promoter closed to open
complex at lPRM (Hawley and McClure, 1982; Kuldell and
Hochschild, 1994). In contrast to these examples, the
importance of activator–polymerase contact leading to
transactivation at post-recruitment steps of initiation is not
well understood. DnaA, which is primarily an initiator of
DNA replication at OriC, acts as a transcription activator at
lPR promoter, influencing both the closed complex formation and promoter clearance (Glinkowska et al., 2003).
Suppression mutagenesis analysis revealed the likely
interaction between b subunit and DnaA during transactivation from lPR (Szalewska-Palasz et al., 1998). Late
gene activation by phage N4 SSB-b′ subunit interaction in
the absence of DNA also does not appear to stimulate
closed or open complex formation, suggesting a role at a
subsequent step of initiation (Miller et al., 1997). The
transactivator C interaction with b′ subunit only after
RNAP recruitment to DNA to enhance promoter clearance
is a mechanism different from the other modes discussed
above. Such a mechanism occurring at later stages of
transcription initiation, involving the interaction with catalytic subunits, is indeed distinct from the classical ‘Busby–
Ebright model’ of transcription activation (Busby and
Ebright, 1994; 1999).
The high-resolution crystal structures of bacterial RNAP
(Vassylyev et al., 2007a,b) largely facilitated the current
understanding of the mechanism of transcription.
G524DrpoC mutation described in this article is located
towards the farther end of the b′ subunit (with respect to
DNA binding surface of RNAP), near the tip of secondary
channel on T. thermophilus EC structure (Fig. 6B). The
localization of G524D argues against the mutation lying in
the actual interaction surface between the two proteins.
Based on the observation that the G524D mutation is
located at a site away from the probable C interacting
surface on the RNAP structure, its mode of action appears
to be analogous to RNAP mutants resistant to RfaH
(Svetlov et al., 2007). Bacterial anti-terminator RfaH,
binds to the b′-clamp helices (CH) at a site that is 50 Å
away from the closest substitution in the RNAP that
makes the enzyme resistant to RfaH. The authors suggest
that the distance between the binding site and the mutation support allosteric mechanism of control (Svetlov
et al., 2007). The other mutants isolated in our study were
P243S–S503F and T1050I. P243 residue falls near the
lid region, while S503 falls in the secondary channel
(Fig. 6B). Previously, other variants of S503 substitutions
have been isolated (S503Y, S503P) which conferred
microcin J25 resistance (Mukhopadhyay et al., 2004).
T1050I rpoC mutant does not fall in the homology region
with T. aquaticus or T. thermophilus rpoC gene and hence
could not be mapped on the structure.
Although isolation of allele-specific suppressors is
a successful strategy in identifying the direct contact
between the interacting partners, we were unsuccessful in
obtaining any such suppressors (gain of function mutants)
in rpoC gene for pc mutants of C. Similarly, we could not
isolate a suppressor in C for G524DrpoC mutant. This
could be attributed to the spatial differences in localization
of C interacting surface on RNAP and transactivation
deficient mutation (G524D) on the structure of RNAP
(Fig. 6B). The pc mutants of C and RNAP mutant demonstrate the importance of not only the physical interaction
between the two proteins but also the significance of the
corresponding allosteric transition in the enzyme. The
mutant RNAP, although retaining the interaction with C,
could be restrictive to its associated allosteric changes,
essential to overcome abortive initiation on mom
promoter. Thus, it is unlikely that conventional genetic
suppressors can be isolated for such interactions.
An intriguing observation is the ability of G524D RNAP
to carry out uncompromised transcription with typical
E. coli promoters (Figs 4B and 5A). Although glycine is a
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
1180 G. Swapna et al. 䊏
Fig. 9. Schematic representation of
C-mediated transcription activation at Pmom. In
absence of transactivator, RNAP cannot bind
to the mom promoter. C protein, upon binding
to the promoter, unwinds the DNA and
recruits RNAP (right panel). The interaction
between C and RNAP reduces abortive
transcription and enhances promoter
clearance leading to Pmom activation. The
transactivation mutants, R105D and F95A,
are able to unwind the DNA and recruit RNAP
(left panel). The inability of the mutants to
interact with RNAP results in a significant
reduction in promoter clearance enhanced
abortive transcription and subsequent reduced
activation of Pmom. G524DrpoC RNAP retains
the interaction with C, however fails to
achieve the requisite activator-induced
conformational changes resulting in reduced
productive and enhanced abortive
transcription at Pmom.
highly conserved residue in that position, G→D variants
are found in RNAP b′ subunits of other members of bacteria (ex: Candidatus pelagibacter, Pedobacter sp., etc.,
not shown). Thus, it appears that such mutations would
not affect normal housekeeping function but seem to have
a context-dependent specific effect on ternary complexes
of promoter–RNAP–activator accounting for hitherto
unexplained mechanism of transcription activation.
To conclude, while activator–polymerase interactions
engaging a or s subunits result in the increase in promoter binding or rate of isomerization, the communication with catalytic subunits seems to be necessary for
stimulation of later steps of transcription initiation, viz.
promoter clearance, as described here. The two-step
activation of the promoter, first interaction-independent
recruitment of RNAP and then activator–RNAP contactdependent promoter escape (Fig. 9), appears to be necessary for ensuring the expression of mom gene only
during the late lytic cycle. Protein–protein contact triggered allosteric transition during C-mediated transcrip-
tion activation, adds another layer of complexity in mom
regulation.
Experimental procedures
Chemicals and reagents
NTPs and dNTPs were purchased from Promega. [g-32P]-ATP
and [a-32P]-UTP were purchased from PerkinElmer life
sciences. All the column materials used for protein purifications and gel filtration chromatography were from GE
Healthcare. Restriction enzymes were from New England
Biolabs. The oligonucleotides and other chemicals were from
Sigma-Aldrich. Supporting information (Table S1) summarizes the sequence of oligonucleotides used in the study.
Strains and plasmids
Bacterial strains and plasmids used in the study are listed in
Table 1. The background strains used for screening Cspecific transactivation-deficient mutants in the b′ subunit
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1181
Table 1. Plasmids, bacterial strains used in the study.
Plasmids/strains
Characteristicsa
References
r
pVR7
pVR7R105D
pVR7F95A
pVN184
pVNR105D
Ap , C under T7 promoter in pET11d
Apr, C containing R105D substitution under T7 promoter in pET11d
Apr, C containing F95A substitution under T7 promoter in pET11d
Cmr, C under tet promoter in pACYC184
Cmr, C containing R105D substitution under tet promoter in pACYC184
pVNF95A
pRS40
pM40
pUW4
Cmr, C containing F95A substitution under tet promoter in pACYC184
Apr, rpoC gene cloned at HindIII–SacI site of pBAD18M
Apr, G524D mutant in rpoC gene cloned at HindIII–SacI site of pBAD18M
Apr, 220 bp mom promoter construct cloned between EcoRI–BamHI sites of
pUC19
Apr, 220 bp tin7 promoter (mutant Pmom) construct cloned between EcoRI–BamHI
sites of pUC19
Apr, mom–lacZ fusion in pNM480
Apr, recA gene cloned in pBR322
Apr, 13 C binding sites in pUC19
Apr, rpoC gene with C-terminal HMK and His tag, cloned in pBAD18M
Apr, G524DrpoC gene with C-terminal HMK and His tag, cloned in pBAD18M
Kmr, b under T7 promoter in pET11DKM (Apr is replaced by Kmr in pET11d)
Kmr, b′ under T7 promoter in pET11DKM (Apr is replaced by Kmr in pET11d)
Apr, TRP1, GAL4 (1–147) BD (NcoI site inserted in MCS of pGBT9)
Apr, LEU2, GAL4 (768–887) AD (NcoI site inserted in MCS of pGBT9)
Apr, aWT gene under T7 promoter in pGEMDXba
Apr, a-235 gene under T7 promoter in pGEMDXba
F- l- ilvG- rfb-50 rph-1
Kmr, E. coli LL306, lRS45 lysogen carrying mom–lacZ fusion cassette,
chromosomal ts for RpoC
Kmr, E. coli LL306, lRS45 lysogen carrying tin7–lacZ fusion cassette,
chromosomal ts for RpoC
MG1655, rpoC120 btuB::Tn10 (tetr, ts)
Plac-Dnut-DT–lacZ monolysogen in E. coli
K3093MATa, ura3-52, his3-200, ade2-101, lys 2-801, trp1-901, leu2-3, 112, Canr,
gal4-542, gal 80-538, URA3::Gal1–lacZ
pUT7
pLW4
pRecA
pSB13
pRS513
pRS513-G524DrpoC
pARC8241
pARC8242
pARC8256
pARC8257
pGEMAX185
pGEMAD235
E. coli MG1655
RSW rpoCts
RSTrpoCts
DJ354
RS445
Saccharomyces
cerevisiae SFY526
Ramesh et al. (1994)
Paul et al. (2003)
Paul et al. (2003)
Balke et al. (1992)
Chakraborty and Nagaraja
(2006)
This work
Sen et al. (2002)
This work
Ramesh et al. (1994)
Balke et al. (1992)
Balke et al. (1992)
Laboratory stock
Basak and Nagaraja (1998)
Cheeran et al. (2007)
This work
Astra Zeneca, India
Astra Zeneca, India
Astra Zeneca, India
Astra Zeneca, India
Igarashi and Ishihama (1991)
Igarashi and Ishihama (1991)
Laboratory stock
This work
This work
Laboratory stock
Laboratory stock
CLONTECH
a. Antibiotic resistance to ampicillin, chloramphenicol and kanamycin is indicated by Apr, Cmr and Kmr respectively.
of RNAP were generated as follows. RSW and RST (Balke
et al., 1992) were l lysogens comprising a single copy of
Pmom–lacZ and Ptin7–lacZ chromosomal fusion respectively.
Transduction in these strains was facilitated by transforming
with a plasmid encoding recA gene. RSW recA and RST recA
were then made temperature-sensitive (ts) for chromosomal
rpoC gene by infecting with a P1 lysate raised on DJ354
[rpoCR120(ts)]. The resultant temperature-sensitive strains
were transformed with pVN184 (Balke et al., 1992).
184RSWrpoCts and 184RSTrpoCts were used for screening
the mutants and measuring the in vivo transactivation levels.
These strains with ts alleles of rpoC showed WT phenotype at
permissive temperatures (30°C) with no apparent defects in
transcription and growth rates. They failed to grow at nonpermissive temperature (42°C) unless the rpoC gene is supplied in trans.
MNNG mutagenesis and screening for mutants
Mutant plasmid libraries of rpoC used for screening
C-specific RNAP mutants were generated by random
mutagenesis of pRS40 (pBAD18M- rpoC gene) (Sen et al.,
2002) using a chemical mutagen – MNNG (N-methyl-N⬘nitro-N-nitrosoguanidine) following Miller’s protocol (Miller,
1992). The mutagenized plasmid libraries were electroporated into the background strain 184RSWrpoCts and the
transformants were plated on LB agar supplemented with
ampicillin, kanamycin, tetracycline, X-Gal (5-bromo-4-chloro3-indolyl-beta-D-galactopyranoside) and incubated at 42°C.
Stable C-specific rpoC down mutants identified as white colonies in 184RSWrpoCts background were reconfirmed for the
phenotype by repeated streaking and the putative mutant
rpoC plasmid was isolated by alkaline lysis method. These
plasmids were then retransformed into their respective background strain and checked for the consistency of the mutant
phenotype.
In vivo transactivation assays
b-Galactosidase assays were carried out following Millers
protocol (Miller, 1992). For Pmom transcription activity assay,
plasmid pLW4 containing mom–lacZ fusion was used
(Table 1) as the reporter construct in E. coli DH10B strain. To
assess the effect of C, R105D or F95A, protein expressing
plasmids pVN184, pVNR105D or pVNF95A (Table 1) were
used along with the reporter plasmid pLW4. Similarly, the
strains harbouring the mutant and WT rpoC genes were
subjected to in vivo transactivation assays in the background
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
1182 G. Swapna et al. 䊏
strains 184RSWrpoCts and 184RSTrpoCts. The cultures
were grown at 42°C until the OD600 reaches around 0.8 and
used for measuring b-galactosidase activity. The data presented is an average of three independent measurements of
activity.
Protein purification
C protein and its mutants were purified by following the procedure described earlier (Ramesh et al., 1994). RNAP was
purified from the background strain (184RSWrpoCts) harbouring either pRS40 (Sen et al., 2002) or pM40 (Table 1)
grown at 42°C, essentially following the method of Kashlev
(Kashlev et al., 1996), with minor modifications, using Ni-NTA
sepharose and heparin sepharose affinity columns. RNAP a
and DCTD a subunits were purified as described (Igarashi
and Ishihama, 1991). The overexpressed RNAP b and b′
subunits were insoluble. The inclusion bodies were loaded on
a 7% SDS-PAGE and subjected to negative staining using
CuCl2. The protein bands were excised and eluted from the
gel using Bio-Rad electro-elution system. Eluted proteins
were denatured using 8 M Urea in refolding buffer (20 mM
Tris HCl pH 8, 5 mM MgCl2, 1 mM EDTA, 10 mM ZnCl2,
50 mM NaCl, 5 mM 2-ME, 5% glycerol) and renatured in vitro
by step dialysis to remove urea. Core RNAP was reconstituted and purified as described earlier (Igarashi and Ishihama, 1991).
Coupled topoisomerase assay
For coupled topoisomerase assay (Ansari et al., 1992), a
supercoiled plasmid pSB13 (with 13 CBS) was used (Basak
and Nagaraja, 1998). Protein–DNA complexes were formed
by incubating 15 pmol of C protein or its mutants with
0.6 pmol of supercoiled pSB13 plasmid in buffer containing
20 mM Tris HCl (pH 7.2), 1 mM EDTA, 5 mM MgCl2 and
50 mM NaCl, on ice, for 10 min. These complexes were incubated with E. coli topoisomerase I at 37°C for 15 min. The
reactions were stopped by the addition of SDS to a final
concentration of 1.5% (w/v) and heat-inactivated at 65°C for
20 min. The reaction mixes were electrophoresed on 1.2%
(w/v) agarose slab gel at 25°C in 1¥ TAE buffer at 3V/cm for
16 h. Gels were stained with ethidium bromide and
documented.
Surface plasmon resonance spectroscopy (SPR)
The biotinylated double-stranded (ds) DNA-containing CBS
(5′ GATCGATTATGCCCCAATAACCAC 3′) was immobilized
on streptavidin (SA) sensor chip and anti-C antibody was
immobilized on carboxy methyl cellulose (CM5) sensor chip,
following the manufacturer’s protocol. Assays were carried
out in the SPR buffer (20 mM Tris HCl pH 8.0, 5 mM MgCl2,
1 mM EDTA, 10 mM ZnCl2, 50 mM NaCl). To analyse the
interaction in solution, 500 nM C protein was passed over the
immobilized antibody. After allowing dissociation for 10 min,
RNAP holoenzyme (100 nM) was injected on C bound chip.
To analyse the interaction in the presence of DNA, C protein
(3 mM) was injected to the DNA immobilized SA chip to arrive
at the saturation of CBS. In the actual assay, again 3 mM C
was injected to saturate the unoccupied DNA, following which
without time-lapse 3 mM C with 100 nM RNAP or its subunits
were co-injected. For both the experiments, response units
(RU) from the empty channel in the chip were taken as
control. The difference between the RU in the experiment and
the control (relative difference) was measured to identify
interaction between the proteins.
Analytical gel filtration chromatography
Superdex 75 (bed volume 24 ml, fractionation range
3–70 kDa) was used for the gel filtration chromatography.
Experiments were carried out in gel filtration buffer (20 mM
Tris HCl pH 8.0, 5 mM MgCl2, 1 mM EDTA, 50 mM NaCl,
5 mM 2-ME and 5% glycerol). C protein (30 mg) and RNAP
(50 mg) were incubated for 15 min at 4°C before applying to
the column. Three nmoles of DNA [25 bp CBS with divergent
promoter P2 disrupted (CBSD-10 P2): Supporting information, Table S1] was incubated with the proteins wherever
indicated. The protein mixture was applied onto the column
and 250 ml fractions were collected. The peak fractions from
each of the chromatographic runs were immune-blotted using
anti-C or anti-b/b′ antibodies to detect the presence of C or
RNAP respectively.
Chemical cross-linking
C protein (2 mg) was incubated with 2 mg of RNAP holoenzyme, core RNAP reconstituted with DCTD a subunit or individual subunits of RNAP in the presence and absence of DNA
in cross-linking buffer (20 mM HEPES pH 7.4, 5 mM MgCl2,
1 mM EDTA, 10 mM ZnCl2, 50 mM NaCl, 5 mM 2-ME and 5%
glycerol). Glutaraldehyde was added to a final concentration
of 0.05%. Reactions were incubated at 37° C for 30 min and
stopped by the addition of stop buffer (62.5 mM Tris HCl
pH 6.8, 2% SDS, 5% glycerol, 1% 2-ME, 0.6% bromophenol
blue). The products were analysed on 7% SDS-PAGE and
immune-blotted with anti-C antibody. Proteins were visualized with ECL Plus Western blot detection kit.
In vitro transcription
The promoter templates for transcription were generated as
described in Supporting information. The reactions were
carried out on linear DNA templates comprising Pmom, Ptin7,
PT7A1 or Ptrc in transcription buffer [40 mM Tris HCl pH 8.0,
5 mM (CH3COO)2 Mg, 0.1 mM EDTA, 0.1 mM DTT, 100 mM
KCl, 100 mg ml-1 BSA]. Reactions were initiated by incubating
40 nM DNA, 80 nM RNAP (WT or G524DrpoC RNAP) in
transcription buffer, on ice for 10 min to allow the formation of
closed complex. C protein (300 nM) was used wherever
required. The reactions were shifted to 37°C for 10 min to
allow the open complex formation. For single round transcriptions, 50 mg ml-1 heparin was added after open complex formation and incubated at 37°C for 1 min. Transcription was
initiated by the addition of 0.3 mM NTP mix and 3 mCi
[a-32P]-UTP (6000 Ci mMol-1). Reactions were carried out for
30 min at 37°C and terminated by addition of urea loading
dye (8 M Urea, 0.05% bromophenol blue and 0.05% xylene
cyanol), heat-inactivated at 65°C for 3 min and quenched on
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1183
ice. Wherever required, one half of the sample (equal cpm)
from the reaction was electrophoresed on 8% denaturing
PAGE to analyse ~120 nt run-off transcript and the remaining
half was electrophoresed on 25% denaturing PAGE to
analyse abortive transcripts. The transcripts were quantified
by using Multi Gauge software. The intensity of the band was
normalized with band area to get intensity/area value. The gel
background value was subtracted from quantified values of
each band and normalized values were plotted.
Promoter clearance assay
Experiments were carried out as described before
(Chakraborty and Nagaraja, 2006). Briefly, RNAP–Ptin7 open
complexes were formed and incubated with heparin
(100 mg ml-1) for 1 min. To one set of reactions, 300 nM C
protein was added. Transcriptions were initiated by the addition of 0.1 mM NTP and [a-32P]-ATP (300 counts min-1 pmol-1
of ATP). Aliquots were taken out at different time intervals and
the reactions were terminated with formamide loading dye
(95% formamide, 20 mM EDTA, 0.05% bromophenol blue,
0.05% xylene cyanol). Transcripts were analysed on 8%
denaturing PAGE and visualized by phosphorimager and
quantified as described (Chakraborty and Nagaraja, 2006).
Transcription reactions carried out for 30 min were resolved
on 25% denaturing PAGE to analyse the abortive transcripts.
Identification and localization of mutants on TEC
(transcription elongation complex)
The rpoC mutants isolated in the screen were sequenced
with a series of gene-specific internal primers. The point
mutations were identified by carrying out pairwise BLAST
(BLAST2SEQ, NCBI) against WT rpoC sequence. The localization of the rpoC mutants on T. thermophilus EC (PDB ID:
2O5I) (Vassylyev et al., 2007a) was carried out by aligning
the corresponding E. coli rpoC residues with the T. thermophilus rpoC residues using CLUSTALW program followed by
mapping the substitutions on the structure using PyMol
software.
C-terminal heart muscle kinase (HMK)-tagged RNAPs
pRS513 is a pBAD18M cloned with heart muscle kinase
(HMK)-tagged rpoC gene (Cheeran et al., 2007). G524DrpoC
mutant with HMK-tag was generated by subcloning 997 bp
SnaBI–BsrGI fragment from pM40 (pBAD18M-G524DrpoC)
comprising G to A mutation at 1570 nucleotide, into SnaBI–
BsrGI-digested pRS513 backbone (~7.9 kb). The point mutation was confirmed by sequencing using internal rpoC
primers spanning the cloned region. The tag did not affect the
cell viability or the phenotype. C-terminal His, HMK-tagged
RNAP (WT and G524DrpoC RNAP mutant) were purified
from background strain 184RSWrpoCts (Kashlev et al.,
1996). Purified RNAP with HMK tagged b′ subunits were
radiolabelled with [g-32P]-ATP (6000 Ci mMol-1) using the
protein kinase A in labelling buffer (20 mM Tris HCl pH 8.0,
150 mM NaCl, 10 mM MgCl2, 10 mM ATP). Labelling reactions were carried out by incubating the reaction mixture at
21°C for 60 min. Labelled RNAP was purified through sephadex G-25 spin columns and used for further analysis.
Trypsin cleavage assays using labelled RNAP
Pmom DNA template (3 mM) was incubated with 10 mM C
protein and 5 mM b′-labelled RNAP (~40 000 cpm) in the
reaction buffer [20 mM Tris HCl (pH 8.0), 5 mM MgCl2, 5 mM
2-ME, 0.5 mM EDTA, 100 mM NaCl, 10% glycerol] for 5 min
on ice followed by incubation at 37°C for 10 min. Two nanograms of trypsin was added to the reaction mix and incubated
at room temperature for 2 min. Reactions were terminated by
the addition of SDS loading dye and heat-inactivated at 75°C
for 10 min. Samples were electrophoresed on 10% SDSPAGE and the gels were exposed to phosphorimager screen
to detect the cleavage pattern. Calibration curves were generated from migration of the cleaved products with respect to
the labelled molecular weight marker. The molecular weights
of the cleaved bands were identified by measuring their distance of migration and interpolating the values with the standards using Graphpad prism software.
Acknowledgements
We thank D. Chatterji for the w protein, A. Ishihama for
antibodies against E. coli RNAP subunits, B.D. Paul for C
mutants, Astra Zeneca, Bangalore for b, b′ overexpression
and yeast two-hybrid assay constructs. G.S. and A.C. were
recipients of senior research fellowship from Council of Scientific and Industrial Research, India. V.N. is a recipient of
J.C. Bose fellowship and a grant from the Department of
Science and Technology, Government of India.
References
Ansari, A.Z., Chael, M.L., and O’Halloran, T.V. (1992) Allosteric underwinding of DNA is a critical step in positive
control of transcription by Hg-MerR. Nature 355: 87–89.
Balke, V., Nagaraja, V., Gindlesperger, T., and Hattman, S.
(1992) Functionally distinct RNA polymerase binding sites
in the phage Mu mom promoter region. Nucleic Acids Res
20: 2777–2784.
Basak, S., and Nagaraja, V. (1998) Transcriptional activator C
protein-mediated unwinding of DNA as a possible mechanism for mom gene activation. J Mol Biol 284: 893–902.
Belogurov, G.A., Vassylyeva, M.N., Svetlov, V., Klyuyev, S.,
Grishin, N.V., Vassylyev, D.G., and Artsimovitch, I. (2007)
Structural basis for converting a general transcription factor
into an operon-specific virulence regulator. Mol Cell 26:
117–129.
Busby, S., and Ebright, R.H. (1994) Promoter structure,
promoter recognition, and transcription activation in
prokaryotes. Cell 79: 743–746.
Busby, S., and Ebright, R.H. (1999) Transcription activation
by catabolite activator protein (CAP). J Mol Biol 293: 199–
213.
Chakraborty, A., and Nagaraja, V. (2006) Dual role for transactivator protein C in activation of mom promoter of bacteriophage Mu. J Biol Chem 281: 8511–8517.
Cheeran, A., Kolli, N.R., and Sen, R. (2007) The site of action
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
1184 G. Swapna et al. 䊏
of the antiterminator protein N from the lambdoid phage
H-19B. J Biol Chem 282: 30997–31007.
Deighan, P., Diez, C.M., Leibman, M., Hochschild, A., and
Nickels, B.E. (2008) The bacteriophage lQ antiterminator
protein contacts the b-flap domain of RNA polymerase.
Proc Natl Acad Sci USA 105: 15305–15310.
Ebright, R.H., and Busby, S. (1995) The Escherichia coli RNA
polymerase a subunit: structure and function. Curr Opin
Genet Dev 5: 197–203.
Glinkowska, M., Majka, J., Messer, W., and Wegrzyn, G.
(2003) The mechanism of regulation of bacteriophage lPR
promoter activity by Escherichia coli DnaA protein. J Biol
Chem 278: 22250–22256.
Gourse, R.L., Ross, W., and Gaal, T. (2000) UPs and downs
in bacterial transcription initiation: the role of the alpha
subunit of RNA polymerase in promoter recognition. Mol
Microbiol 37: 687–695.
Griffith, K.L., and Wolf, R.E., Jr (2004) Genetic evidence for
pre-recruitment as the mechanism of transcription activation by SoxS of Escherichia coli: the dominance of DNA
binding mutations of SoxS. J Mol Biol 344: 1–10.
Griffith, K.L., Shah, I.M., Myers, T.E., O’Neill, M.C., and Wolf,
R.E., Jr (2002) Evidence for ‘pre-recruitment’ as a new
mechanism of transcription activation in Escherichia coli:
the large excess of SoxS binding sites per cell relative to
the number of SoxS molecules per cell. Biochem Biophys
Res Commun 291: 979–986.
Hawley, D.K., and McClure, W.R. (1982) Mechanism of activation of transcription initiation from the l PRM promoter.
J Mol Biol 157: 493–525.
Heyduk, T., Lee, J.C., Ebright, Y.W., Blatter, E.E., Zhou, Y.,
and Ebright, R.H. (1993) CAP interacts with RNA polymerase in solution in the absence of promoter DNA. Nature
364: 548–549.
Hochschild, A., and Dove, S.L. (1998) Protein–protein contacts that activate and repress prokaryotic transcription.
Cell 92: 597–600.
Igarashi, K., and Ishihama, A. (1991) Bipartite functional map
of the E. coli RNA polymerase a subunit: involvement of the
C-terminal region in transcription activation by cAMP-CRP.
Cell 65: 1015–1022.
Ishihama, A. (1993) Protein–protein communication within
the transcription apparatus. J Bacteriol 175: 2483–2489.
Ishihama, A. (1997) Promoter selectivity control of Escherichia
coli RNA polymerase. In Nucleic Acids and Molecular
Biology, Vol. 11: Mechanism of Transcription. Eckstein, F.,
and Lilley, D. (eds). Heidelberg: Springer-Verlag, pp. 53–70.
Kashlev, M., Nudler, E., Severinov, K., Borukhov, S., Komissarova, N., and Goldfarb, A. (1996) Histidine-tagged RNA
polymerase of Escherichia coli and transcription in solid
phase. Methods Enzymol 274: 326–334.
Kim, S.K., Makino, K., Amemura, M., Nakata, A., and Shinagawa, H. (1995) Mutational analysis of the role of the first
helix of region 4.2 of the s70 subunit of Escherichia coli RNA
polymerase in transcriptional activation by activator protein
PhoB. Mol Gen Genet 248: 1–8.
Kolb, A., Igarashi, K., Ishihama, A., Lavigne, M., Buckle, M.,
and Buc, H. (1993) E. coli RNA polymerase, deleted in the
C-terminal part of its a-subunit, interacts differently with the
cAMP-CRP complex at the lacP1 and at the galP1
promoter. Nucleic Acids Res 21: 319–326.
Kuldell, N., and Hochschild, A. (1994) Amino acid substitutions in the -35 recognition motif of s70 that result in defects
in phage l repressor-stimulated transcription. J Bacteriol
176: 2991–2998.
Kulkarni, R.D., and Summers, A.O. (1999) MerR cross-links
to the a, b, and s70 subunits of RNA polymerase in the
preinitiation complex at the merTPCAD promoter. Biochemistry 38: 3362–3368.
Lee, J.H., and Hoover, T.R. (1995) Protein crosslinking
studies suggest that Rhizobium meliloti C4-dicarboxylic
acid transport protein D, a s54-dependent transcriptional
activator, interacts with s 54 and the b subunit of RNA
polymerase. Proc Natl Acad Sci USA 92: 9702–9706.
Malan, T.P., Kolb, A., Buc, H., and McClure, W.R. (1984)
Mechanism of CRP-cAMP activation of lac operon transcription initiation activation of the P1 promoter. J Mol Biol
180: 881–909.
Martin, R.G., Gillette, W.K., Martin, N.I., and Rosner, J.L.
(2002) Complex formation between activator and RNA
polymerase as the basis for transcriptional activation by
MarA and SoxS in Escherichia coli. Mol Microbiol 43: 355–
370.
Miller, J.H. (1992) A Short Course in Bacterial Genetics; a
Laboratory Manual and Hand Book of Escherichia coli and
Related Bacteria. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
Miller, A., Wood, D., Ebright, R.H., and Rothman-Denes, L.B.
(1997) RNA polymerase b′ subunit: a target of DNA
binding-independent activation. Science 275: 1655–1657.
Mukhopadhyay, J., Sineva, E., Knight, J., Levy, R.M., and
Ebright, R.H. (2004) Antibacterial peptide microcin J25
inhibits transcription by binding within and obstructing the
RNA polymerase secondary channel. Mol Cell 14: 739–
751.
Nechaev, S., Kamali-Moghaddam, M., Andre, E., Leonetti,
J.P., and Geiduschek, E.P. (2004) The bacteriophage T4
late-transcription coactivator gp33 binds the flap domain of
Escherichia coli RNA polymerase. Proc Natl Acad Sci USA
101: 17365–17370.
Niu, W., Kim, Y., Tau, G., Heyduk, T., and Ebright, R.H. (1996)
Transcription activation at class II CAP-dependent promoters: two interactions between CAP and RNA polymerase.
Cell 87: 1123–1134.
Nussbaum-Shochat, A., and Amster-Choder, O. (1999) BglG,
the transcriptional antiterminator of the bgl system, interacts with the b’ subunit of the Escherichia coli RNA
polymerase. Proc Natl Acad Sci USA 96: 4336–4341.
Pande, S., Makela, A., Dove, S.L., Nickels, B.E., Hochschild,
A., and Hinton, D.M. (2002) The bacteriophage T4 transcription activator MotA interacts with the far-C-terminal
region of the s70 subunit of Escherichia coli RNA
polymerase. J Bacteriol 184: 3957–3964.
Paul, B.D., Kanhere, A., Chakraborty, A., Bansal, M., and
Nagaraja, V. (2003) Identification of the domains for DNA
binding and transactivation function of C protein from
bacteriophage Mu. Proteins 52: 272–282.
Ptashne, M., and Gann, A. (1997) Transcriptional activation
by recruitment. Nature 386: 569–577.
Qin, Y., Luo, Z.Q., and Farrand, S.K. (2004) Domains formed
within the N-terminal region of the quorum-sensing activator TraR are required for transcriptional activation and
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185
Promoter clearance by activator–RNA polymerase interaction 1185
direct interaction with RpoA from Agrobacterium. J Biol
Chem 279: 40844–40851.
Ramesh, V., and Nagaraja, V. (1996) Sequence-specific DNA
binding of the phage Mu C protein: footprinting analysis
reveals altered DNA conformation upon protein binding.
J Mol Biol 260: 22–33.
Ramesh, V., De, A., and Nagaraja, V. (1994) Engineering
hyperexpression of bacteriophage Mu C protein by
removal of secondary structure at the translation initiation
region. Protein Eng 7: 1053–1057.
Rao, X., Deighan, P., Hua, Z., Hu, X., Wang, J., Luo, M., et al.
(2009) A regulator from Chlamydia trachomatis modulates
the activity of RNA polymerase through direct interaction
with the b subunit and the primary s subunit. Genes Dev
23: 1818–1829.
Ren, Y.L., Garges, S., Adhya, S., and Krakow, J.S. (1988)
Cooperative DNA binding of heterologous proteins: evidence for contact between the cyclic AMP receptor protein
and RNA polymerase. Proc Natl Acad Sci USA 85: 4138–
4142.
Rhodius, V.A., and Busby, S.J. (1998) Positive activation of
gene expression. Curr Opin Microbiol 1: 152–159.
Roe, J.H., Burgess, R.R., and Record, M.T., Jr (1984) Kinetics and mechanism of the interaction of Escherichia coli
RNA polymerase with the l PR promoter. J Mol Biol 176:
495–522.
Roy, S., Garges, S., and Adhya, S. (1998) Activation and
repression of transcription by differential contact: two sides
of a coin. J Biol Chem 273: 14059–14062.
Saecker, R.M., Tsodikov, O.V., McQuade, K.L., Schlax, P.E.,
Jr, Capp, M.W., and Record, M.T., Jr (2002) Kinetic studies
and structural models of the association of E. coli s70 RNA
polymerase with the lPR promoter: large scale conformational changes in forming the kinetically significant
intermediates. J Mol Biol 319: 649–671.
Sen, R., King, R.A., Mzhavia, N., Madsen, P.L., and Weisberg, R.A. (2002) Sequence-specific interaction of nascent
antiterminator RNA with the zinc-finger motif of Escherichia
coli RNA polymerase. Mol Microbiol 46: 215–222.
Sevostyanova, A., Svetlov, V., Vassylyev, D.G., and Artsimovitch, I. (2008) The elongation factor RfaH and the initiation
factor sigma bind to the same site on the transcription
elongation complex. Proc Natl Acad Sci USA 105: 865–
870.
Shah, I.M., and Wolf, R.E., Jr (2004) Novel protein–protein
interaction between Escherichia coli SoxS and the DNA
binding determinant of the RNA polymerase a subunit:
SoxS functions as a co-sigma factor and redeploys RNA
polymerase from UP-element-containing promoters to
SoxS-dependent promoters during oxidative stress. J Mol
Biol 343: 513–532.
Sun, W., and Hattman, S. (1998) Bidirectional transcription in
the mom promoter region of bacteriophage Mu. J Mol Biol
284: 885–892.
Sun, W., Hattman, S., Fujita, N., and Ishihama, A. (1998)
Activation of bacteriophage Mu mom transcription by C
protein does not require specific interaction with the
carboxyl-terminal region of the a or s70 subunit of Escherichia coli RNA polymerase. J Bacteriol 180: 3257–3259.
Svetlov, V., Belogurov, G.A., Shabrova, E., Vassylyev, D.G.,
and Artsimovitch, I. (2007) Allosteric control of the RNA
polymerase by the elongation factor RfaH. Nucleic Acids
Res 35: 5694–5705.
Szalewska-Palasz, A., Wegrzyn, A., Blaszczak, A., Taylor, K.,
and Wegrzyn, G. (1998) DnaA- stimulated transcriptional
activation of ori l: Escherichia coli RNA polymerase b
subunit as a transcriptional activator contact site. Proc Natl
Acad Sci USA 95: 4241–4246.
Szambowska, A., Pierechod, M., Wegrzyn, G., and
Glinkowska, M. (2011) Coupling of transcription and replication machineries in lDNA replication initiation: evidence
for direct interaction of Escherichia coli RNA polymerase
and the lO protein. Nucleic Acids Res 39: 168–177.
Vassylyev, D.G., Vassylyeva, M.N., Perederina, A., Tahirov,
T.H., and Artsimovitch, I. (2007a) Structural basis for transcription elongation by bacterial RNA polymerase. Nature
448: 157–162.
Vassylyev, D.G., Vassylyeva, M.N., Zhang, J., Palangat, M.,
Artsimovitch, I., and Landick, R. (2007b) Structural basis
for substrate loading in bacterial RNA polymerase. Nature
448: 163–168.
Vassylyeva, M.N., Svetlov, V., Dearborn, A.D., Klyuyev, S.,
Artsimovitch, I., and Vassylyev, D.G. (2007) The carboxyterminal coiled-coil of the RNA polymerase b′-subunit is the
main binding site for Gre factors. EMBO Rep 8: 1038–
1043.
Yamamoto, K., Yata, K., Fujita, N., and Ishihama, A. (2001)
Novel mode of transcription regulation by SdiA, an Escherichia coli homologue of the quorum-sensing regulator. Mol
Microbiol 41: 1187–1198.
Yuan, A.H., Nickels, B.E., and Hochschild, A. (2009) The
bacteriophage T4 AsiA protein contacts the b-flap domain
of RNA polymerase. Proc Natl Acad Sci USA 106: 6597–
6602.
Supporting information
Additional supporting information may be found in the online
version of this article.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials supplied
by the authors. Any queries (other than missing material)
should be directed to the corresponding author for the article.
© 2011 Blackwell Publishing Ltd, Molecular Microbiology, 80, 1169–1185