Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2, 3, Working Group, 5, 12, 25, 26, 32, 39, 40, 41, 43, 46, 49, 50
Completed milestones: 1, 16
Inactive milestones: 4, 6-11, 13-24, 27-30, 33-38, 42, 44-45, 47-48, 51-54
Milestone 1
Milestone description: Subcontracts finalized
Institution: UNM/All subcontractors
1. Date Started: 11/1/2005
2. Date Completed: 5/14/2006 (4 subcontracts completed)
3. Work performed and progress including data and preliminary conclusions
a. UNM Strategic Work Plan: Final electronic copy emailed to Ross, Vicki and Marlene on
5/17/06
b. UNM Semi-Annual report: final hardcopy was sent on 5/14/06 by Federal Express to
Vicki/Marlene and to Ross
c. UNM, ASU, LBERI and UTSA submitted semi-annual subcontracting plan reports on eSRS
in April and May 2006. At the 6/26/06 contract call, we will confirm with Ross Kelley that he
can access these 4 electronic submissions.
d. COA# 8 of 5/126 permitted purchase of the Biomek system, including accessories
4. Significant decisions made or pending
a. None
5. Problems or concerns and strategies to address
a. None
6. Deliverables completed
4 fully executed subcontracts have been signed, finalized and returned to Ross Kelley (Cerus,
ASU, UTSA and LBERI)
7. Quality of performance
Excellent
8. Percentage completed
100%
9. Work plan for upcoming month
a. From 6/15/06 onward, UNM will report the status of the Strategic work plans, the
subcontracting plan reports, the semi-annual reports and the annual reports at the monthly
Contract call meetings rather than through the monthly Technical Reports on milestones.
10. Anticipated travel
None
1 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
11. Upcoming Contract Authorization (COA) for subcontractors
a. Cerus may request a COA to shift some direct labor funds to a part-time management
consultant, to allow the Cerus scientists to focus on the scientific milestones. Cerus
anticipates no change in the subcontract expenses.
b. COA# 7 and #8: covered budgeted accountable property that had been requested to date.
c. Currently, there are no pending COA requests.
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/1005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
NIAID is working on the IAA with USAMRIID and discussions regarding funding transfers are in
progress. Kristin DeBoord indicated that a legal and financial liability review may be pending.
4. Significant decisions made or pending
a. UNM and NIAID continue to wait for a change in the status of the IAA between NIAID
and USAMRIID.
b. UNM has notified NIAID that if vaccinations are not administered by February 2006, or no
later than June 2006, additional protective equipment will be necessary to prevent a
stoppage of work. LBERI is purchasing a biobubble as additional protective equipment
c. UNM will be discussing with NIAID, the impact of not having human cells from LVS
vaccinated individuals which are needed to develop in vitro immunoassays
d. UNM EOHS has obtained many of the laboratory documents
i. Documents received:
1. Laboratory’s CLIA certificate,
2. Laboratory Directors’ signed and dated CV
3. Laboratory’s State Medical licenses
4. Radiology Director’s sign/dated CV
5. Radiology Director’s Medical License.
ii. Documents pending
1. Laboratory CAP Certificate
2. Radiology Facility Accreditation Certificate
5. Problems or concerns and strategies to address
When will the NIAID-USAMRIID IAA be completed and when can UNM begin the prehealth
screenings?
6. Deliverables completed
None
7. None Quality of performance
Good
8. Percentage completed
14%
9. Work plan for upcoming month
Ross Kelley will continue to monitor the progress of whether Martin Crumrine's IAA between
NIAID and USAMRIID will inform UNM when and whether the TVD Contractors can be
vaccinated under this IAA.
2 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
10. Anticipated travel
Travel could occur in June and August 2006, as soon as the IAA is reached and NIAID approves
the travel.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 3
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a.
b.
c.
d.
e.
Received vials of LVS from UNM
Received micropump
Received sparging generator
Received Sonik LDI generator
Submitted draft LVS bioaerosol testing protocol
4. Significant decisions made or pending
a. None
5. Problems or concerns and strategies to address
a. None
6. Deliverables completed
a. None
7. Quality of performance
a. Good
8. Percentage completed
a. 2%
9. Work plan for upcoming month
a. Initiate LVS bioaerosol studies with Collison generator
b. Prepare seed and working stocks of LVS
10. Anticipated travel
a. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
a. None anticipated
Working Group
Milestone description: Determine appropriate solid and liquid media for growth of tularemia for
project team
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions(Data
found in folder on Saturn server entitled ABSL3/Study Data/Tularemia)
a.
b.
c.
d.
Prepared 10 agar media and 7 liquid media
Compared LVS growth on 10 agar media
Compared LVS growth on 7 liquid media
Prepared draft report of media growth characteristics
3 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
4. Significant decisions made or pending
a. Chamberlains broth outperformed most other broths
5. Problems or concerns and strategies to address
a. None
6. Deliverables completed
a. None
7. Quality of performance
a. Good
8. Percentage completed
a. 50%
9. Work plan for upcoming month
a. Determine % recovery for best agar media
b. Repeat broth study
c. Examine whether blue/gray colony color can be discriminated
10. Anticipated travel
a. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
a. None anticipated
Milestone 5
Milestone description: Species tested for sensitivity to LVS & generation of immunity against a
pulmonary challenge of Schu4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc7B (notebook 81, page 79)
i. We had indicated in the 5/15/06 UNM technical report that neither BALB/c
nor NIH-Swiss mice cleared LVS 5 weeks after inoculation. We sampled a
second group of mice 7 weeks after LVS inoculation and found the lung,
spleen and liver to be free of LVS. The remaining mice, now considered
vaccinated, were divided into groups of 3 or 4 mice and challenged i.n. with
23 or 112 CFU (actual lung deposition) SCHU S4. We will report these
results in the next technical report when the experiment is completed
b. Experiment Ftc13 (notebook 81, page 87-88, 94, 96) and Ftc15 (notebook 85, page13)
i. The purpose of these experiments is to determine the intranasal LD50 of
SCHU S4 in NIH-Swiss and BALB/c mice
ii. In Ftc13, NIH-Swiss mice (n = 5) were infected i.n. with ~1, 14, or 127 CFU
SCHU S4 and monitored daily for survival (data not shown). The lowest
dose was below our level of detection and therefore was estimated based on
the two higher doses. The experiment was terminated 20 days after infection
because the no additional death occurred for two weeks. We calculated the
i.n. LD50 of SCHU S4 in NIH-Swiss mice to be less than 1 CFU, using the
method developed by Reed and Muench [Am. J. Hyg. (1938) 27:493-497].
4 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
iii. In Ftc15, NIH-Swiss mice (n = 10) and BALB/c mice (n=6) were infected i.n.
with ~2, 23, or 111 CFU SCHU S4 (Figure 1). Again, the lowest dose was
below our level of detection and therefore was estimated based on the two
higher doses. The i.n. LD50 calculated 12 days after infection was 2 CFU for
NIH-Swiss mice and 7.2 CFU for BALB/c.
Figure 1. Intranasal LD50 of SCHU S4 in NIH-Swiss and BALB/c mice. NIH-Swiss mice (n = 10)
and BALB/c mice (n = 6) were infected i.n. with the indicated doses of SCHU S4 and monitored
for survival.
c.
Experiment Ftc11 (notebook 81, pages 84-86)
i. The purpose of this experiment was to determine the conditions for
homogenizing rat tissues using BeadBeaters (Biospec Products; Bartlesville,
OK)
1. The size of rat tissues required that we use larger, 7 ml BeadBeater
tubes instead of 2 ml tubes that we usually use to homogenize
mouse tissues. We were concerned that the larger volume would
prevent efficient heat dissipation and therefore affect viability of
Francisella tularensis.
2. To simulate experimental conditions, we made two tubes containing
2 ml of 2.5 mm Zirconia/silica beads, 5 ml PBS and 3.2 x 103 CFU/ml
LVS. One tube was homogenized for five 1-minute intervals without
cooling while the second tube was cooled in an ice/water bath for 1
minute between each interval. 200 l was removed after each
interval and plated in triplicate onto cystine heart agar plates to
determine the percent recovery.
3. Beadbeating in the 7 ml tubes generated sufficient heat to cause
rapid loss of bacterial viability (Figure 2). However, bacterial viability
can be preserved by cooling the tubes in an ice/water bath for 1
minute between each interval of bead beating.
5 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
d. Experiment Ftc12, study 1 (notebook 85, page 5)
i. The purpose of this experiment was to determine: 1) the conditions for
anaesthetizing Fischer 344 rats with isofluorane and 2) whether a Fischer
344 rat can tolerate 400 l PBS delivered i.n.
ii. We determined that Fischer 344 rats can be effectively anaesthetized in an
18” x 8” x 14” cage with 5% isoflurane at a flow rate of 2 liters per minute.
This anaesthetized the rats deeply enough in 5 to 10 minutes to be handled
and infected i.n.
iii. We also determined that Fischer 344 rats can tolerate 400 l of fluids
delivered i.n. without any adverse reaction.
e. Experiment Ftc12, study 2 (notebook 85, page 6)
i. The purpose of this experiment was to determine the conditions for
homogenizing lung, spleen and liver from Fischer 344 with BeadBeaters.
ii. We determined by visual inspection and pipetting with 200 l and 1000 l
pipetman that all three tissues can be completely homogenized with two 1
minute homogenization with a 1 minute cooling step in between.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
a. We have to standardize the procedure for culturing and freezing LVS as soon as
possible because 1) we have more vial-to-vial variability when working with
lyophilized LVS than with SCHU S4 suspended in freezing medium and 2) the low
LVS concentration is forcing us to deplete our stock faster than anticipated
b. NIH-Swiss mice are consistently back-ordered at Harlan Sprague Dawley. However,
this will not affect our schedule for completing milestone 5
6. Deliverables completed
None
6 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
7. Quality of performance
Good
8. Percentage completed
8%
9. Work plan for upcoming month
a. Mice: Based on the result from Ftc6 A & B and Ftc7 A & B, we will vaccinate BALB/c
and NIH-Swiss mice with LVS so that statistically significant numbers of vaccinated
mice will be available to determine the i.n. LD50 of SCHU 4 in vaccinated mice.
b. Rats:
i. We will continue to develop Standard Operating Procedures (SOPs) for
working with rats. These will include methods for infecting rats i.n., s.c. and
i.d., monitoring their health status, and processing the lungs, spleens, and
livers to determine the bacterial load.
ii. We will determine the i.n. LD50 of SCHU S4. It is possible that Fischer rats
are completely resistant to SCHU S4 and if so, we will cease developing this
model
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 12
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
Ms. Monier and Wilder continue to meet weekly with the UNM team to discuss the
development of immunoassays. Dr. Wilder received IACUC approval to secure some
cynomologous monkey blood with which to practice the preparation on mononuclear cells
and to select the best protocol for their preparation among 3 – 4 published protocols. Ms.
Monier and Dr. Wilder are currently completing training at LRRI in preparation for working
with non-human primate blood. Ms. Monier has completed IACUC training and continues
to train on immunoassays currently ongoing in Dr. Wilder’s laboratory.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
0.2% of scientific work has been completed
7 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
9. Work plan for upcoming month
a. We will order the reagents necessary for preparing cynomologous macaque PBMCs.
b. We will purify cynomologous PBMCs using 2 – 3 different protocols for and test them as
to their purity and ability to mount a proliferative response to a T cell mitogen.
10. Anticipated travel
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None for this milestone.
Milestone 16
Milestone description: Luciferase generating F. tularensis LVS delivered to UNM
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: 04/30/2006
3. Work performed and progress including data and preliminary conclusions
a. The firefly luciferase gene was amplified from pGPL01 and cloned into pFNLTP8
downstream of the Francisella groEL promoter (plasmid construct was named
pKEK871, see figure J1)
b. The E. coli cloning strain DH5 was transformed with pKEK871 and luciferase
activity was measured using a Bertolt luminometer (attached figure LVSluc.jpg)
c. pKEK871 was then electroporated into LVS and luciferase activity was compared
to LVS w/o plasmid and LVS with empty plasmid (pFNLTP8)
d. Results demonstrate pKEK871 as an effective plasmid for expressing luciferase
in Francisella LVS (see figure J2) (documented in TVD UTSA notebook #1,
experiment JB1, page 7)
e. Sequencing and restriction digest confirmed the plasmid pKEK871 to be correct
(documented in TVD UTSA notebook #1, experiment JB1, page 4)
4. Significant decisions made or pending
none
5. Problems or concerns and strategies to address
none
6. Deliverables completed
The LVS strain containing pKEK871 (named KKF51) was sent to UNM
7. Quality of performance
excellent
8. Percentage completed
100 %
9. Work plan for upcoming month
Milestone Completed
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
8 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
Figure J1
Figure J2
Milestone 25
Milestone description: Design protein-fragment library based on SCHU S4 sequence
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
The initial design of an overlapping 200 amino acid library of the complete SCHU S4 proteome
has been completed and we have designed primers for amplification but have yet not ordered
them.
Protein fragments are designed for straightforward PCR amplification from genomic DNA. Test
samples have been amplified.
Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\25\ftu_proteins_segs.xls
4. Significant decisions made or pending
We are considering a redesign of this milestone that would encompass an ORF assembling
technique that would significantly improve the quality of the ORFs without increasing costs. This
will not change the scope of the milestone.
We have decided to design and synthesize 500 20-mer peptides corresponding to F. tularensis
protein-epitopes predicted to bind MHCI or MHC II molecules. We will use several MHC
prediction programs to search the coding sequence for consensus motifs. The outputs will be
compared to identify those commonly predicted by more than one algorithm. These peptides will
be used as a pilot study to the high throughput, multiplexed T cell assay screening protocols.
5. Problems or concerns and strategies to address
See 4. No problems have been encountered at this time. Protocols and reagents are being
tested and the strategies have been improved.
9 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
6. Deliverables completed
7. Quality of performance
Good
8. Percentage completed
50%
9. Work plan for upcoming month
Perform testing of the new design for production of optimal DNA templates for IVT reactions.
Continue primer design quality control checks. Prepare and order primers for amplification of
fragments
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 26
Milestone description: Confirmation of gene expression (Design HTP SOPs, Test HTP SOPs,
ORF library production, confirm gene expression)
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Utilizing the Invitrogen Expressway E. coli IVT production system, we have successfully produced
IVT proteins for constructs for CPV 100a, CPV110a, CPV030a as shown by SDS page analysis
of IVT products indicating the correct size product is produced. Western blot analyses will be
done as confirmation. Additional kits need to be screened however. With the assistance of Dr.
Lyons, we have identified several proteins for initial production to include the 17 kDa major
membrane protein (J. Immunol 145:311, 1990, AAA24919) and the 23 kDa protein (Infect.
Immun. 65:2183, 1997, Y08861). Interestingly, the 17 kDa protein was an epitope mapped with
cells from humans immunized with LVS and several epitopes were identified. (amino acids 66-85,
116-135, and 126-149). We are beginning to utilize the analysis tools at the immune epitope
website (http://www.immuneepitope.org/home.do).
Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\26\
4. Significant decisions made or pending
5. Problems or concerns and strategies to address
Describe
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
20%
9. Work plan for upcoming month
Complete testing of various kits for the in vitro transcription/translation. Finalize the design of the
next version of the HTP 3’ and 5’ constructs for creating the linear IVT constructs. Perform
10 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
additional immune epitope analyses in batch mode. Identify, design, and build F. tularensis
protein fragments with optimized IVT protocol
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 32
Milestone description: Oligos selected for microarray production; Oligos list refined, 70mer
oligos procured, GDP oligos defined, Based on SCHU S4 sequence.
Institution: ASU-Johnston
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
The 70mer oligo set has been designed to cover the SCHU S4 genome
4. Significant decisions made or pending
The original oligo set that was designed utilized the 2002 annotation and confirmation of
alignment of these probes with the 2005 genome show some variances.
Files are stored at R:\GeneVac\FTU\Contract\Microarray\Milestones\32\ FTU_final_oligo.xls
5. Problems or concerns and strategies to address
We compared the oligonucleotide sequences with the 2005 annotation of F. tularensis SCHU4
and found some significant differences. In the original data set, there were 2050 probe
sequences, with controls, in the oligo set but of these only 860 probes aligned with 100% identity
with the 2005 sequence. This left 1,190 with less than perfect match. Of these 1,190, 1086 were
disparate at only one nucleotide, but 12 differed by more than 10 nucleotides, 12 by more than 20
nucleotides, 4 by more than 30 nucleotides and 72 by more than 40 nucleotides. In addition,
there were 67 genes in the 2005 sequence that were not identified by any probe in the set. We
will perform a re-design of the microarray probe set for these problematic sequences.
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
20%
9. Work plan for upcoming month
We will perform a re-design of the microarray probe set for the problematic sequences. We will
order and receive Oligos; reconstitute & QC Oligos, and make master printing plates
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
11 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
Milestone 39
Milestone description: Create uvrA or uvrB mutant F. tularensis subsp. novicida
Institution: UTSA
1. Date started: 5/1/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1 UvrB upstream fragment was amplified using UvrBUp and UvrBDn primers; UvrB
downstream fragment was amplified using UvrBUp1 and UvrBDn1 with Schu4 DNA as
template ; FpErmc fragment was amplified using pET15bUniUp and pET15bUniDn primers
with pKEK888(pET15bFpEmrC) as a template.
3.2 UvrB upstream fragment, UvrB downstream fragment and FpErmC fragment were purified on
agarose gel with Qiagen Gel Purification Kit. The fragments were eluted with 50 ul of distilled
water.
3.3 For overlapping PCR, the following reaction is set up:
10 X KOD XL Buffer
5.0ul
dNTP 2mM
5.0ul
UvrBUp primer 2uM
5.0ul
UvrBDn1 primer 2uM
5.0ul
UvrBUp fragment
3.0ul
UvrBDn fragment
3.0ul
FpErmC fragment
3.0ul
dH2O
20.6ul
KOD DNA polymerase (2.5u/ul) 0.4ul
95C 2’, then
95C 30”
55C 30”
72C 3’
For 35 cycles.
3.4 The PCR product is purified, and ligated to pGEM-T vector purchased from Promega
company. The plasmid is identified by restriction enzyme digestions and sequenced. The
plasmid is named as pKEK 951 and stored in -70C.
3.5 pKEK 951 was cryotransformed into U112 using standard operation procedure of
cryotransformation. The mutant was identified by PCR, restriction enzyme digestion and
sequencing. The UvrB mutant is named as KKF71, and stored in -70C.
All the data for UvrB were documented in page 6-10, TVD UTSA notebook #2.
3.6 The primers used for amplifying UvrA Upstream fragment are:
(All
the primers can be used for Schu4 strain, as there are some minor differences
between LVS and Schu4 strains, the labeling Schu4LVS means the primers can
be used to amplify both strains as a remind.)
UvrASchu4Up 5’GGAGAATTCTGAAGCTATAGCAGAGGCTCGTGA
UvrASchu4LVSDn ’ACTACTGGGCTGCTTCCTAATGCACAACATACCTTCTTT
GCCCTTCAG
The primers used for amplifying UvrA Downstream fragment are:
12 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
UvrASchu4LVSUp1 5’GCTGCTAACAAAGCCCGAAAGGAAGAAGGTGGTAGT
AAAGGAGGGCAG
UvrASchu4Dn1 5’GGAGAATTCCGCCATGCTCAACATCTCAAAGATG
The primers for amplifying FnPErmC are:
pET15bUniUp: 5’ TGCATTAGGAAGCAGCCCAGTAGT
pET15bUniDn: 5’ TTCCTTTCGGGCTTTGTTAGCAGC
The UvrAUpstream and Downstream fragments were amplified, and purified.
All the data were documented in page 12-14, TVD UTSA notebook #2.
4
Significant decisions made or pending
5
Problems or concerns and strategies to address
6
Deliverables completed
7
Quality of performance
8
Percentage completed
9
Work plan for upcoming month
9.1 Through overlapping PCR to make construction of pGEM-T plasmid with UvrAUpSeq-FnP-
None
No problems so far.
pKEK951 (UvrB deletion plasmid), KKF71 (UvrB deletion mutant in U112)
Excellent progress.
Approximate 50% of scientific work completed on the milestone
ErmC-UvrADnSeq, which will be used to make deletion of UvrA in F. tularensis subsp.
Novicida.
9.2 If plasmid from step 1 is correct (will be sequenced), the plasmid will be transformed into F.
tularensis subsp. Novicida to make UvrA mutant (deletion of the most part of UvrA gene in the
strain).
10 Anticipated travel
None.
11 Upcoming Contract Authorization (COA) for subcontractors
None.
Milestone 40
Milestone description: Phenotyping of Ft novicida mutants; Measure degree of attenuation of
uvr mutants in macrophages and in mice
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
1) We have received the F. tularensis ssp. novicida U112 uvrB strain from Dr. Karl Klose at
UTSA and have performed some preliminary experiments in vitro with this strain that will be
described below in 3).
2) Completion of this milestone requires robust cultivation methods for Ft novicida, and during the
past month optimization of cultivation conditions has continued. In a number of experiments, we
have found that Cystine heart agar plates supplemented with hemoglobin (CHAH), prepared in-
13 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
house, actually perform better than commercially-supplied CHAB plates (Remel) and are
significantly less expensive. When a suspension of frozen cells was thawed, diluted, and plated
on CHAB or CHAH plates, we found that the CHAH plates yield more CFU than CHAB plates.
The colony size also appears slightly larger and the colonies are enumerable after shorter
incubation periods. A representative example is summarized below:
Table I
Average cfu
(n=3 plates)
Ftn U112
Ftn uvrB
Fth LVS
Fth LVS
Cerus CHAH
Remel CHAB
52.5
93.7
14.7
10.3
23.7
47.3
0
0
(NB 934 p.018 and others)
One possible explanation for this decrease in CFU on the CHAB plates is that this formulation
comes from the manufacturer supplemented with antibiotics (penicillin and polymyxin B) that do
not normally suppress the Ft growth. Perhaps after thawing, however, Ft strains are more
susceptible to these antibiotics. Since we will need accurate titers of our frozen seed stocks of Ft
novicida and LVS and we do not yet know the effect of cultivation inside mammalian cells on
resistance to antibiotics, we have selected CHAH plates for the purpose of enumerating CFU of
Ft novicida and LVS and will continue to prepare them in house. The recipe and protocol for
production of the CHAH plates is attached as Cerus_Ft_protocol_004.
In the previous technical report we described the rationale for selection of Chamberlain’s defined
media for liquid cultivation of Ft novicida. We also identified our source for a premixed dry
formulation (Teknova Inc.) After our May Prime/sub conference call, we were requested to
provide documentation of the QA and QC procedures that Teknova uses in preparation of the
media, and certification that the components are animal product free. We also provided a small
amount of the material to Bob Sherwood at LBERI for evaluation of Ft tularensis ScuS4 growth.
Attached is the letter of response from Teknova outlining their QA/QC procedures and certifying
that that none of the components contains animal products.
3) In order to determine the degree to which the uvrB mutant strain is attenuated in vivo, we
must first establish that this mutation does not cause any growth defects in vitro. To this end, we
have determined that U112 and Ftn uvrB replicate in Chamberlain’s medium with identical
growth kinetics. Both strains have a doubling time of approximately 1 hour, and both grow to a
maximal optical density at 600nm of approximately 4.0. This corresponds to approximately 1 x
1010 cfu/ml.
Growth of Francisella tularensis ssp. novicida in
Chamberlain's defined medium
OD600
10
U112
1
uvrB
0.1
0
2
4
time (h)
6
8
10
(NB 837 p. 14)
14 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
4) We have produced frozen cell banks of U112, (NB 934-004), Ftn uvrB (NB 935-001) and LVS
(NB 935-024). Cells were harvested at early stationary phase and suspended in fresh
Chamberlains medium with 15% glycerol and frozen at –80oC. The cfu/ml titer was determined
before freezing and after thawing by plating dilutions on CHAH plates:
Table II Titer of frozen cell banks
Average CFU (n=3)
Pre freeze
Post thaw
U112
4.2 x109
2.4 x109
uvrB
4.6 x109
1.2 x109
LVS
1.0 x108
2.0 x108
The Ft novicida strains lost 50-75% viability during the freezing and thawing process,
whereas the LVS maintained complete viability. This freezing medium will be tested again
and in comparison to an alternate freezing protocol containing DMSO and sucrose to
determine which preserves a higher degree of viability with Ft novicida strains. These cell
banks are to be used to standardize cultivation practices; however we found that strains that
are thawed and directly added to liquid medium undergo an extensive lag phase that
precludes us from using a frozen cell bank as our direct inoculation material for cultivation.
The frozen cell banks can, however, be used to set up standardized overnight cultures that
are used the following day.
4. Significant decisions made or pending
We have selected Cystine Heart Agar with Hemoglobin (CHAH) for cultivation and enumeration
Ft novicida colonies.
5. Problems or concerns and strategies to address
Frozen Ft novicida undergo a severe lag phase after thawing using our standard freezing
medium. The lag phase after thawing in an alternative freezing medium containing DMSO
and sucrose will be evaluated. If the lag phase after thawing cannot be eliminated, frozen
cell banks will be used to set up standardized overnight cultures that can be used for rapid
cultivation.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
5%
9. Work plan for upcoming month
Alternate freezing media will be compared with the standard freezing medium and evaluated for
preservation of cell viability (as determined by CFU on CHAH plates), and decreased lag phase
post-thaw in Chamberlain’s medium. We will infect murine macrophages with U112 and uvrB to
determine the intracellular growth rate of both strains.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 41
Milestone description: Optimization of psoralen treatment and characterization of KBMA F.
novicida; Determine the amount of S-59 and UVA required to inactivate uvr mutants, Determine
extent of metabolic activity of uvr mutants after S-59 and UVA inactivation, Determine the level
of virulence attenuation of KBMA uvr strains in mice
Institution: Cerus
15 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
1. Date started: 3/2/06
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
In order to determine whether the uvrB mutant has increased sensitivity to S-59
photochemical treatment, we performed an initial experiment to compare the sensitivity of
uvrB to wild type U112. Inactivation was performed as described previously following
Cerus_Ft_protocol_003 that includes a 1 hour incubation period with S-59.
log CFU
Photochemical Inactivation of F. tularensis ssp. novicida
1.E+09
1.E+08
1.E+07
1.E+06
1.E+05
1.E+04
1.E+03
1.E+02
1.E+01
1.E+00
U112
uvrB
0
1000
2000
3000
[S-59] nM
4000
5000
The uvrB mutant strain showed a loss in ability to replicate in a S-59 dose dependent
manner, and was completely inactivated at a concentration of 5 µM, while the U112 parental
strain required higher concentrations of S-59 to achieve similar degrees of inactivation.
These data demonstrate that, as expected, the uvrB mutant stain has decreased nucleotide
excision repair capabilities. However, the relatively modest degree of difference between the
inactivation profile between the wild type and mutant strains is consistent with the hypothesis
that the Ft. novicida outer membrane could potentially be acting as a permeability barrier
using this inactivation protocol.
Photochemical Inactivation of uvrB Using Alternate method
1.E+10
CFU/ml
1.E+08
1.E+06
cfu/mL
1.E+04
1.E+02
1.E+00
0
5
10
[S-59] M
15
20
Notebook 934 p. 20
Using an alternate protocol for inactivation in which the bacteria are incubated continuously
with various concentrations S-59 (see Cerus_Ft_protocol_005, attached), we found that we
were able to achieve complete inactivation of the uvrB strain at a concentration of 10 M S59. In the past it has been necessary to increase the S-59 concentration by approximately
16 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
100-fold when switching to this protocol because the bacteria metabolize the S-59 compound
during growth. In this case, however, the concentrations required for complete inactivation of
uvrB were similar, suggesting that either F. tularensis does not metabolize S-59, or that the
increased incubation time allows for more diffusion of the S-59 through the bacterial
membranes. We are in the process of determining the level of S-59 required for inactivation
of the parental U112 strain.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
Our data remain consistent with the hypothesis that the Ft. novicida outer membrane represents
a permeability barrier for S-59. It appears that the increased incubation time with S-59 may at
least partially alleviate this problem. We are in the process of comparing the sensitivity to
photochemical treatment of wild-type U112 and Ft. novicida uvrB using this continuous S-59
exposure protocol.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
4% of scientific work completed on the milestone
9. Work plan for upcoming month
Using the alternate protocol for inactivation, we will determine the minimum concentration
required for inactivation of Ft novicida U112 using a range of concentrations between 1 and 100
M S-59. We will more-precisely define the minimum concentration required for inactivation of
uvrB using a range of concentrations between 1 and 10M. Once we have determined the
minimum concentration of S-59 required for complete inactivation of both strains, we will
determine the level of metabolic activity of each strain after photochemical inactivation using an
MTS assay.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 43
Milestone description: Create uvrA or uvrB mutants in LVS
Institution: UTSA
1. Date started: 5/01/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1 The basic process of making mutant in LVS:
To make UvrA or UvrB deletion, we first have to amplify each fragment
upstream(UpSeq) and downstream(DnSeq) of UvrA or UvrB gene using LVS
chromosomal DNA, and antibiotic resistance gene, then through overlapping PCR, we
will ligate the UpSeq, Antibiotic Resistance Marker, DnSeq together, and finally put the
fragment into a plasmid like pGEM-T. Then plasmid will be used to transform LVS to
make the mutant. The procedure is exactly same as making mutant in U112, except that
we have to make a long homologous fragment more than 1.5 kb at each end of the gene,
and we can only use kanamycin cassette as LVS is resistant to erythromycin.
17 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
Primers were designed for UvrB based on LVS genome sequence as following:
For UvrBLVSUpSeq:
UvrBLVSUp 5’GGAGAATTCGCAGCAGATGATATTGCACGCACA
UvrBDn
5’ACTACTGGGCTGCTTCCTAATGCATTGTATTGCTTGAGGCTGATCGCC
For UvrBLVSDnSeq:
UvrBUp1 5’GCTGCTAACAAAGCCCGAAAGGAAGCTACGAAGGTTATCAAAGCTCT
CG
UvrBLVSDn1 5’GGAGAATTCTTGCACCAATCCCGGCAAGTAA
The NCBI accession number for UvrB gene of LVS is AM233362.1, coordinate number is
733522-738965.
3.2 The erythromycin resistance marker in pET-15bFpErmC plasmid(pKEK888) will be
replaced with kanamycin resistance marker.
3.3 The primers used for amplification of kanamycin resistance marker are:
KanFNdeI: GGAATTCCATATGAGCCATATTCAACGGGAA
KanRBamHI: CGCGGATCCTTAGAAAAACTCATCGAGCATCAAATG
All the data were documented in page 50-54, TVD UTSA notebook #2.
4
Significant decisions made or pending
5
Problems or concerns and strategies to address
6
Deliverables completed
7
Quality of performance
8
Percentage completed
9
Work plan for upcoming month
None
No problems so far.
None
In progress.
Approximate 5% of scientific work completed on the milestone
9.1 Replacement of erythromycin resistance marker with kanamycin resistance marker in
pKEK888(pET15bFpErmC).
9.2 Amplifying UvrB upstream and downstream fragments in LVS strains.
9.3 Trying overlapping PCR with the fragments if plasmid made by step 9.1 is correct by
sequencing. (The overlapping PCR will be more difficult after 3 kbs(the optimal range) as
we have to make a construct around the 5kb with antibiotic marker for LVS mutant. It is
really difficult as the genomic DNA of Schu4, U112, LVS is so AT-rich, and there will
always be nonspecific amplification after certain size limit.)
10 Anticipated travel
None.
11 Upcoming Contract Authorization (COA) for subcontractors
None.
18 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
Milestone 46
Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale
Francisella tularensis culture conditions, Establish 3L culture scale purification conditions,
Optimize 3L scale photochemical inactivation process, Verify protective immunogenicity of
vaccine candidates produced by optimized large-scale process
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
1) Equipment required for fermentation and concentration of LVS has arrived at Cerus and is
being set up to initiate large-scale cultivation experiments. We have received detailed
protocols from Andrew Hoover at DVC with their media recipe and fermentation conditions.
2) The growth rate and bacterial load of LVS grown in liquid Chamberlain’s medium was
compared with Veggie peptone phosphate (VPP) (Oxoid) supplemented with cystine. We
found that Chamberlains media supports a more rapid growth rate and a significantly higher
density of growth than does VPP.
LVS Growth Curve
10.000
OD600
1.000
Chamberlain's
0.100
VPP Cystine
0.010
0.001
0
10
20
30
Time in hours
40
50
NB 937 p. 35-37
3) A working cell bank of LVS has been produced and formulated in Chamberlains medium
with 15% glycerol and stored at –80 oC (NB 935-024). When the titer of this cell bank was
assessed, Cystine Heart Agar with Hemoglobin (CHAH) plates were found to provide a
higher number of CFU than CHAB plates (see table I, above). The viability of the LVS before
and after freezing in 15% glycerol was essentially equivalent (see table II).
4. Significant decisions made or pending
We have selected Cystine Heart Agar with Hemoglobin (CHAH) for cultivation and enumeration of
Ft holarctica LVS colonies.
5. Problems or concerns and strategies to address
The preliminary experiments performed to date with LVS have not been performed with the DVC
LVS. We are still awaiting our permit from the USDA for import of F. tularensis before we request
vials from UNM. We have made follow-up calls with the USDA to assure them that we are not
requesting a permit for importation of select agents and have now been assured that our
application will receive “rush” status.
6. Deliverables completed
None
19 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
7. Quality of performance
good progress
8. Percentage completed
4% of scientific work completed on the milestone
9. Work plan for upcoming month
We will cultivate LVS using Chamberlain’s defined medium in the fermentor. During the
cultivation we will monitor the pH, dissolved oxygen concentration, and optical density of the
bacteria and determine the number of colony forming units at various time points. We will
purchase the required reagents to follow the DVC protocol for propagation of LVS in the
fermentor. We will compare the growth characteristics of LVS in Chamberlain’s medium and
the DVC medium.
We will photochemically inactivate LVS using the Cerus_Ft_protocol_0005 to determine the
range of S-59 concentrations required for complete inactivation of LVS.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. Used existing plasmid KEK 882, which is pwsK30 vector containing a Lac Z gene cloned
in at EcoRV site; Chloramphenicol (Cm) gene cloned into BamHI site and a
Erythromycin (Ery) gene cloned into EcoRI to Pst I Sites. This vector will allow cloning of
a 5´ IgLC gene fragment (1504 bp) and a 3´ IgLC gene fragment (1505 bp) independently
with some counter selection markers that will make screening for the correct construct
easier.
The Multiple Cloning Site (MCS) of pwsk30 organization in this plasmid:
Etc…--Sal I ClaI HindIII EcoRV(LacZ gene)-EcoRI (Ery gene)-PstI- SmaI BamHI(Cm
gene) SpeI XbaI NotI …etc
b. Designed oligos to use to amplify 1500 bp segment of IgLC DNA at the 5´ and 3´ end,
respectively . Refer to PCR Protocol I of standard operating procedure submitted earlier.
5´ oligo set: iglc schu4 down SalI 5 -gcg gcg gtc gac ggg gga tct aca gaa gtt gat ag -3
delta iglc schu4 up PstI 5 –gcg ctc cag tat cat ctc act cat aat cat tc -3
3´ oligo set: iglc schu4 up NotI 5 –gcg gcg gcg cgg ccg cga aga atc tcc acc aga agc -3
delta iglc schu4 down PstI 5 –gcg ctg cag tat att gca gct gca tag -3
20 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
c.
Used Schu4 genomic DNA as template to amplify the needed fragments using the above
oligo sets. The PCR products along with KEK882 were digested with appropriate
enzymes to clone igLC gene fragments into the plasmid. Worked with the 3´ IgLC gene
product by using restriction endonuclease enzymes Pst I and Not I. The digested PCR
product and KEK882 were purified from an agarose gel with Qiagen Gel Purification Kit
and eluted with 40 ul of distilled water (sterile). The resulting isolates were used in
ligation reaction (T4 DNA Ligase from New England Biolabs) using plasmid : insert ratio
of 1:3.
d. The ligation reaction was cleaned up via chloroform: phenol extraction then ethanol precipitated; the resulting pellet was reconstituted in 10 ul distilled water. Then 3 ul of 3´
IgLC ligation was used to transform DH5α cells via electroporation.
e. The transformed cells were plated on 100 ug/ml Ery Miller Luria Agar plates. Since I
cloned the 3´ IgLC fragment, such that, the Cm gene is removed I was able to look for
Cm sensitive clones to screen for the correct constructs. Plasmid preparations were
prepared (set of 10) using the QIAprep Spin Miniprep Kit column purification method.
These plasmids were cut with restriction endonuclease EcoRI along with the parent
plasmid (KEK882) and compared on agarose gel ethidium bromide stained. The plasmid
which looked correct was sent for sequencing and confirmed. Currently, the 3´ IgLC
fragment is cloned into KEK882 named KEK 900. Data located in TVD UTSA Notebook 3
pages 31-35.
f.
Continuation of optimizing the conditions for Schu4 conjugation consisted of screening
the resulting cloning from the mating for transconjugates (steps 10 – 13 in Exp Design S4
Conjugation submitted earlier). Found that the plasmid is going into the chromosome but
once we remove from the selection pressure and thru sucrose selection the entire
deletion is removed. That is the second recombination that is resulting is reverting to wild
type gene instead of leaving the deletion. We believe that larger homology to gene on
both the 5´and 3´end of the gene, respectively, will stabilize this deletion. Therefore, we
will wait for a construct containing larger (>1000 bp homology) flanking homology to
continue optimizing the mating conditions for Schu4. Data located in TVD UTSA
Notebook 3 pages 9-12.
21 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
Oligo set PucOri XhoI; pucOri EcoR I
This is an example of one screen set by PCR; most templates are
chromosomal DNA unless otherwise stated. This screen is
verifying if the plasmid was integrated into the Schu4 chromosome.
In addition, a few were run to verify the loss of the plasmid after
cycling and/or sucrose selection. The sensitive clones 7, 8 and 13
were run with another set of oligos to check for the blac2 deletion
compared to Schu4 and KEK931 and were found that these
reverted back to wild type genotype. Data in TVD UTSA Notebook
3, page 12.
Legend:
1 Kb Ladder
KEK931 mating plasmid (+ cont)
KKV34 U112 deletion (MglA)
Schu4 Chromosomal (- cont)
TypeB Chromosomal (-)
S391a original Ery resistant
S391a after Sucrose Erys
S391b after Sucrose Erys
S391b original Ery resistant
S392a original Ery resistant
S392b original Ery resistant
S393a original Ery resistant
S393a after Sucrose Erys
S394b original Ery resistant
S395a original Ery resistant
S395b original Ery resistant
S395c original Ery resistant
S396a original Ery resistant
S396b original Ery resistant
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
The two bands resulting in the above photo is due to some cross reactivity between the
pucOri oligo sequence and other regions in the plasmid, as well as in the Type B and F.
novicida genomic DNA. That is, only a small portion of the sequence is annealing to a
region of the template and it is not the targeted site. If we increase the annealing
temperature on the thermocycler, we may be able to avoid the nonspecific bands. However,
this part of the procedure is for screening only, possible candidates will be subject to more
site specific oligos that will target the deletion itself.
4. Significant decisions made or pending
none
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
3%
9. Work plan for upcoming month
a. Continue with construction of mating plasmid by cloning the 5´ end of IgLC (1504 bp) into
KEK900.
b. Once this is done will transfer the entire IgLC deletion into the desired mating plasmid
KEK903. First, will design oligos containing the desired cloning sites (SphI and XmaI)
c. The KEK903 will be cut with SphI and EcoRV (blunt site) restriction endonucleases gel
purified and used in ligation with the entire amplified IgLC deletion (3009 bp) from
plasmid generated in 9.a. which has been digested only with SphI and gel purified.
22 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
d. The resulting construct with have the IgLC deletion contruct cloned in the KEK903 by
SphI site and blunt into the EcoRV of this plasmid. Will screen by restriction
endonuclease profile, PCR and then sent for sequencing.
e. Order more supplies for media and cloning enzymes.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS
uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD,
iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA,
iglB strains
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
a. Determination of LD50 of LVS (Note book #4 page 2-5): LD50 of LVS in the intranasal
challenge model (C57BL/6 mice) was determined to be ~ 2000 CFU (Fig. 1, file name:
0506 LVS LD50.ppt). This challenge inocula will be used as a reference point for all LVSbased experiments.
b. Humoral response of mice against LVS infection (Note book #4 page 6-7): C57BL/6 mice
were infected intranasally with LVS (1000 CFU) and sera were collected 2-week postchallenge to measure humoral response (SOP: assessment of humoral response). The
primary immunization resulted in low production of antigen-specific total Ig. We have
boosted the corresponding animals with LVS and will follow serum antibody titers and
specific isotypes produced.
c. Cell mediated response (Note book #4 page 8-9): Spleen and lymph nodes were
collected from mice 14 days after primary i.n. challenge with LVS (1000 CFU). Single
23 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
cells were made, pooled, and recalled with various amounts of UV-irradiated LVS (SOP:
assessment of CMI responses). Results of ELISA indicated that both total splenocytes
and lymph node cells produced significant amount of IFN-γ, but not IL-4 upon in vitro
stimulation with LVS (Fig. 2, file name:0506 LVS CMI.ppt).
d. Measurement of cellular influx into the respiratory compartment following pulmonary
Francisella challenge (Note book #4 page 10-12): Lungs from three naïve BALB/c mice
were collected, single cells were made and subjected to flow cytometry analysis (SOP:
assessment of respiratory cellular responses). This set of experiment allowed us to
optimize the conditions for determining the population of dendritic cells, macrophages,
NK cells, B-cells, CD4+ T cells and CD8+ T cells. Comparisons of cellular infiltration in the
respiratory compartment by flow cytometry after LVS and F. novicida intranasal
challenges will now carried out with these optimized conditions.
4. Significant decisions made or pending
N.A.
5. Problems or concerns and strategies to address
N.A.
6. Deliverables completed
Describe
7. Quality of performance
good
8. Percentage completed
6% of scientific work completed on the milestone
9. Work plan for upcoming month
a. Determine the LD50 of Ft subsp. novicida uvrB
b. Monitor F. novicida uvrB replication and dissemination in lungs and livers of mice 24 hr,
48hr, and 72hr post-infection by dilution plating
c. Measure intramacrophage (J774) survival of uvrB
24 of 25
Tularemia Vaccine Development Contract: Technical Report
Period: 5/01/2006 to 5/31/2006
Due Date: 6/15/2006 and Prepared by: Barbara Griffith,
Terry Wu, Rick Lyons, Justin Skoble, Kathryn Sykes, Stephen Johnston, Robert Sherwood,
Karl Klose
d. Contrast and compare cellular infiltration in the respiratory compartment by flow
cytometry after LVS and F. novicida intranasal challenges.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
25 of 25