Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2, 3, Working Group, 5, 12 (UNM &LBERI), 25, 26, 32, 33, 39, 40, 41,
43, 46, 49, 50
Completed milestones: 1, 16
Inactive milestones: 4, 6-11, 13-24, 27-31, 34-38, 42, 44-45, 47-48, 51-54
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/1005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. NIAID is working on the IAA with USAMRIID and a legal and financial liability review is
pending.
b. Dr. Bob Rubin, President/CEO of LRRI, is discussing access to the LVS vaccinations with
Dr. Ed Nuzum ,who is the Chief of the Product Development Section in the Office of
Biodefense Research Affairs at NIAID. Dr. Rubin wants the LVS vaccine for the LRRI
scientists working on tularemia. LRRI wants best protection for their team and is willing
to waive the indemnification issue for their scientists.
c. Another option may be through LRRI’s clinical trials subsidiary that performs I&D for
different funding agencies. Could LRRI be a site for giving the LVS vaccine through
LRRI’s subsidiary? Dr. Chuck Hobbs, of LRRI, was asked by Dr. Ed Nuzum to perform a
cost analysis.
4. Significant decisions made or pending
a. UNM and NIAID continue to wait for a change in the status of the IAA between NIAID
and USAMRIID.
b. UNM and LBERI will use their biobubbles as additional physical protective equipment
c. NIAID will need to provide UNM access to human cells from other LVS vaccinated
individuals which are needed to develop in vitro immunoassays. For possibly another
year, UNM will not have access to a local source of human cells from LVS vaccinated
individuals
d. UNM EOHS has obtained many of the laboratory documents
i. Documents pending
1. Radiology Facility Accreditation Certificate
5. Problems or concerns and strategies to address
UNM will need an external source of human cells from LVS vaccinated individuals, in order to
develop the immunoassays in humans.
6. Deliverables completed
None
1 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
7. Quality of performance
Good
8. Percentage completed
16%- no change relative to 8/15/06 report
9. Work plan for upcoming month
Ross Kelley will continue to monitor the progress of whether Martin Crumrine's IAA between
NIAID and USAMRIID will inform UNM when and whether the TVD Contractors can be
vaccinated under this IAA.
10. Anticipated travel
Travel could occur in September 2006 to September 2007, depending on the completion of the
IAA.
11. Upcoming Contract Authorization (COA) for subcontractors
UNM may request a COA to allow 1-2 UNM EOHS nurses to travel to USAMRIID for training on
LVS site vaccination evaluations. The timing of the COA request depends on the achievement of
the IAA.
Milestone 3
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions






Created a new stock of frozen LVS from Chamberlain’s (8/11/06) and titered the stock at
1.6x108 cfu/mL on CHAB. This stock is being used to perform aerosol sprays with thawed
LVS.
Performed 3 additional bioaerosol sprays with the Collison nebulizer and thawed LVS; one
experiment (8/8/06) compared the relative efficiencies of the AGI (all glass impinger) and the
biosampler for quantitating viable recovery of LVS; one experiment (8/15/06) was set up to
determine the lower limit of LVS aerosol exposure; one experiment (8/25/06) determined the
reproducibility of the lower limit of LVS aerosol exposure. Data are shown below.
Experiment 8/8/06 performed with thawed LVS demonstrated that the AGI efficiency was
best.
Experiment 8/15/06 suggested that the low limit for LVS aerosols is approximately 1x10 4
CFU/mL in the spray. Below 1x104 CFU/mL in the spray resulted in less than 5-10 colonies
per plate, which is too low due to potential variability.
Experiment 8/25/06 replicated the data from 8/15/06 and demonstrated that the lower limit for
LVS aerosols is approximately 1x104 CFU/mL in the spray
Data files are found in \\Saturn\ABSL3\Study Data (2005-2006)\Francisella tularensis\FY06078 (Tul-03)\Bioaerosol Data
Experiment 8/8/06. Comparison of AGI and Biosampler Efficiency
Sampler
AGI
Biosampler
Approximate CFU/mL
sprayed (N=3)
2x108
CFU/mL
Recovered (N=3)
1.26x105
CFU/L (N=3)
4.66x104
Spray Factor
(N=3)
3.94x10-7
2x108
1.33 x105
2.16 x104
1.67 x10-7
2 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Experiment 8/15/06. Determination of Lower Limit for LVS Bioaerosols
Target Spray
Conc (CFU/mL)
5x103
1x104
5x104
1x105
5x105
Actual Spray
Conc. (CFU/mL)
5.67E+03
1.29E+04
8.83E+04
1.68E+05
6.80E+05
CFU/mL
Recovered
1.00E+01
5.33E+01
2.77E+02
1.40E+02
1.00E+03
CFU/L
Spray Factor
3.71E+00
1.65E+01
1.00E+02
5.13E+01
3.71E+02
6.54E-07
1.28E-06
1.14E-06
3.06E-07
5.45E-07
Experiment 8/25/06. Determination of Lower Limit for LVS Bioaerosols (Replicate Sprays)
Target Spray
Conc (CFU/mL)
1x104
3x104
5x104
No. of
Replicates
3
3
3
Actual Spray
Conc. (CFU/mL)
2.52E+03
9.43E+03
1.87E+04
CFU/mL
Recovered
1.89E+01
2.33E+01
5.56E+01
CFU/L
6.98E+00
8.59E+00
2.02E+01
Spray Factor
5.42E-06
9.66E-07
1.08E-06
4. Significant decisions made or pending
a. None
5. Problems or concerns and strategies to address
a. None
6. Deliverables completed
a. None
7. Quality of performance
a. Good
8. Percentage completed
a. 22%
9. Work plan for upcoming month

Perform bioaerosol experiments on vegetative LVS with Collison generator to compare with
thawed LVS
 Repeat of studies performed on thawed LVS, but now with vegetative. The studies
will include measurement of spray factors, reproducibility, high and low doses.
 Plan to grow LVS in CB
 Plan to quantitate LVS on CHAB
10. Anticipated travel
a. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
a. None anticipated
Working Group
Milestone description: Determine appropriate solid and liquid media for growth of tularemia for
project team
Institution: LBERI/UNM
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions:
3 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
a. None for LBERI; UNM is performing virulence studies with DVC Lot#16 LVS grown in
Chamberlains versus from lyophilized vial. See UNM MS 5 below.
4. Significant decisions made or pending
a. A meeting of the working group examined blue/grey colony morphology data produced by
DSTL and determined that Chamberlain’s broth and CHAB agar outperformed the other
media tested and recommended that these media be used in growth of LVS stocks.
5. Problems or concerns and strategies to address
a. None
6. Deliverables completed
a. Determined liquid and solid media for LVS growth
7. Quality of performance
a. Good
8. Percentage completed
a. 100% for LBERI; UNM needs to report a percentage for the virulence studies.
9. Work plan for upcoming month
a. UNM is performing experiments to compare the virulence of LVS grown in Chamberlain’s
media with the virulence of freshly reconstituted LVS from a vial of DVC lot#16 LVS.
10. Anticipated travel
a. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
a. None anticipated
Milestone 5
Milestone description: Species tested for sensitivity to LVS & generation of immunity against a
pulmonary challenge of Schu4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc12, study 8 (notebook 85, pages 20-23), study 9 (notebook 85, page
29), study 10 (notebook 85, pages 39-41)
i. The purpose was to develop a method to infect Fischer 344 rats by the
pulmonary route.
ii. The major obstacle up to now has been the difficulty visualizing the trachea.
This may be attributed in part to the ketamine/xylazine anesthesia that was
used [CF Schaefer et al. J Appl Physiol. (1984) 56:533-5]. Since isoflurane
does not have these effects, we decided to use it instead.
iii. Our intention has been to infect rats using the microspray aerosolizer from
Penn Century. However, there are several disadvantages to using this
system
1. In a side-by-side in vitro comparison, the amount of bacteria
delivered by the microspray aerosolizer was only 25% of that
delivered by a 200 l pipetmen. It is possible that the microspray
aerosolizer delivered a smaller volume or that it generated enough
shear forces to kill F. tularensis.
2. The microspray aerosolizer can only deliver five 50 l or two 100 l
doses. It will therefore be necessary to frequently reload the
aerosolizer for large experiments. However, the technique for
4 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
reloading the aerosolizer makes it very likely to contaminate all work
surfaces.
iv. We are evaluating an alternative method of intratracheal inoculation using a
blunted-ended, 18-gauge, 1¾” i.v. catheter.
1. Rats were anesthetized with isoflurane
2. The plastic sheath from the i.v. catheter was inserted into the trachea
and proper placement was verified by pumping a small volume of air
into the lungs; if the sheath had been inserted into esophagus, there
would be a vacuum when drawing air back into the syringe. 100 l of
the inoculum was then delivered with the blunt-ended catheter
needle attached to a disposable 1 ml syringe and followed by 200 l
of air to ensure the entire inoculum was delivered.
3. We successfully inoculated 100% (n=4) Fischer 344 rats using this
method
a. The target dose was 6.12 x 105 CFU LVS/rat
b. An average of 3.1 ± 0.5 x 105 CFU/rat (49% of initial
inoculum) was recovered from lung homogenates.
4. We will train additional members of the team on this method
b. Experiment Ftc17 (Notebook 85, pages 44-47)
i. The purpose was to determine the intranasal LD50 of SCHU S4 in s.c.-, i.d.-,
and i.n.-LVS vaccinated NIH-Swiss and BALB/c mice.
ii. Two months after vaccination, 2 mice from each group were killed and shown
to have completely cleared LVS from the lungs, spleens, and livers
iii. I.n.-vaccinated mice were challenged i.n. with 51, 230, and 1640 CFU SCHU
S4
iv. I.d.- and s.c.-vaccinated mice were challenged i.n. with <20, 20, and 40 CFU
SCHU S4.
v. We are monitoring clinical symptoms and survival
c.
Experiment Ftc19 study 1 (Notebook 85, pages 30-31), study 2 (Notebook 85, pages
32-33), study 3 (Notebook 85, pages 34-35) and study 4 (42-43)
i. The purpose was to generate a LVS working stock from DVC’s lot 16 in
Chamberlain’s medium using the exact conditions established by the TVDC
working group. This stock will then be used for all future TVDC experiments
ii. The culture conditions were:
1. Rehydrate LVS in 1 ml sterile PBS
2. Inoculate 100 l into 100 ml Chamberlain’s medium in a 250 ml
disposable, screw-top, Erlenmeyer flask
3. Shake culture for 48 h at 37oC and 225 rpm
iii. In Ftc19 study 1, it took four days for OD600 to reach 0.391. This was
unacceptable because the TVDC working group indicated that after 2 days in
culture a blue-gray phase shift is likely to occur.
iv. In Ftc19 study 2 and study 3, no growth was observed
v. We suspected that the Chamberlain’s powder may be light sensitive since its
activity decreased over time and it was stored in a clear tube. Therefore, we
obtained a second aliquot of Chamberlain’s powder from Bob Sherwood.
This aliquot had been stored in the dark by wrapping in foil.
vi. In Ftc19 study 4, the 48 hour OD600 was 0.644, equivalent to 2-3 x 109
CFU/ml
vii. 291 aliquots (300 l each) were created and stored without preservatives in a
–80oC freezer
5 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
viii. In Ftc19 study 5, we will compare the virulence of LVS grown in
Chamberlain’s medium to that of DVC’s lot 16 LVS and will share the data
with the Working Group
4. Significant decisions made or pending
For the rat model, we will use isoflurane rather than ketamine/xylazine anesthesia and
use an iv catheter rather than a microsprayer for the intratracheal delivery of inoculations.
Powdered Chamberlain medium will be stored in the dark and kept dry.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
14%
9. Work plan for upcoming month
a. Determine the intranasal LD50 of SCHU S4 in s.c.-, i.d.-, and i.n. vaccinated NIHSwiss and BALB/c mice
b. Compare the virulence of LVS grown in Chamberlain’s medium to DVC’s lot 16 LVS
and report the results to the Working Group.
c. Determine the sensitivity of Fischer 344 rats to pulmonary SCHU S4 infection
d. Determine the resistance of s.c.- and i.d.-vaccinated Fischer 344 rats to a lethal
pulmonary SCHU S4 infection
e. Start training on handling, anesthetizing, and infecting guinea pigs
10. Anticipated travel
a. 9/26-9/27/06: Annual meeting in Albuquerque, NM
b. 10/30 to 11/4/06: Rick Lyons, Terry Wu and Barbara Griffith to attend Collaborative
meeting with DVC and NIAID and to attend 5th International Tularemia Conference in
Woods Hole MA
11. Upcoming Contract Authorization (COA) for subcontractors
COA #11: authorizes travel for 7 UNM TVDC scientists to the 5th International Tularemia
Conference in Woods Hole, MA
Milestone 12-UNM
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed
Institution: UNM
1. Date started: 7/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Ftc18 study 2 (Notebook 85, pages 25-28)
b. The purpose was to determine the best antigen for measuring antigen-specific T cell
responses
c. Three method of antigen preparation (figure 1)
i. Heat-killed - LVS and SCHU S4 were effectively killed by 3 h incubation at
70oC
ii. Formalin-fixed – LVS and SCHU S4 were effectively killed by 30 min
incubation in 3% or 10% neutral-buffered formalin with or without 60oC
iii. UV-inactivation
6 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
1. SCHU S4 was effectively killed by 60 min incubation
2. One LVS colony was detected after 60 min incubation. A longer
incubation period (90 min) may be required
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
We had initially planned to use the loss of light-emitted by LVS-luciferase as a convenient
readout for killing of intracellular bacteria. However, the assay sensitivity is low and the
dynamic range is limited. Therefore, we will measure killing of intracellular bacteria by plating
cell lysates onto cystine heart agar and incorporate more convenient readout when they
become available in the future.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
3%
9. Work plan for upcoming month
7 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
a. Determine whether splenocytes (including macrophages and T cells) from LVS
vaccinated BALB/c mice can kill F. tularensis in a co-culture system. The detection
assay will be based on plating and quantification of CFU.
b. Determine the best antigen (heat-killed, formaldehyde-fixed, or UV-inactivated F.
tularensis) for stimulating proliferation and cytokine production by antigen-specific T
cells from vaccinated mice
10. Anticipated travel
a. 9/20-9/21/06: Alexandra Scrymegeour and Tara Hendry-Hofer to Fisher
Immunoassay training course in Rockville, MD
11. Upcoming Contract Authorization (COA) for subcontractors
COA# 10: authorizes travel to the CMI Workshop in Rockville MD.
Milestone 12-LBERI
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. Purpose: Repeat protocol from the Purdue Cytometry ListSERV using Nycomed
Lymphoprep ,which to date provided the highest yield of peripheral blood mononuclear cells
(PBMCs) from cynomolgous macaque blood, not contaminated by RBCs,
i. Goal was to determine whether this protocol gave a high yield of cells which were not
highly contaminated by RBCs, and that responded vigorously and specifically to immune
stimulation (mitogenic initially and later, antigenic)
ii. Raw data:
 TVDC Binder 1 (Wilder Lab), TUL-3 (8/14/06; repeat of Purdue Cytometry
Nycomed Lymphoprep method for purification of cynomolgous macaque
PBMCs);
 C:\Documents and Settings\jwilder.LOBOS\My Documents\Tularemia
Contract\tul3 elispot 081606.xls
 C:\Documents and Settings\jwilder.LOBOS\My Documents\Tularemia
Contract\Tul 3 prolif 081806.xls
iii. Summary data:
 C:\Documents and Settings\jwilder.LOBOS\My Documents\Tularemia
Contract\TUL3 summary.xls
 C:\Documents Settings\jwilder.LOBOS\My Documents\Tularemia Contract\tul3
elispot 081606 incl summary.xls
 C:\Documents and Settings\jwilder.LOBOS\My Documents\Tularemia
Contract\PBMC assays.svv
b. Methods for purification
i. Brief outline of the Purdue Cytometry Lymphoprep protocol
1. Dilute blood 1:3 with PBS
2. Layer 2 parts blood on top of 1 part Lymphoprep
3. Spin 30 minutes at RT, no brake, 1800 RPM
4. Harvest interface and wash twice with PBS
5. Lyse RBCs, spin and count pellet
ii. Full protocol can be found in TVDC Binder 1 (Wilder Lab)
c. Results for yield and purity
8 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
i.
Summary of results shown below for TUL3 in comparison to Tul 1 and 2
(C:\Documents and Settings\jwilder.LOBOS\My Documents\Tularemia
Contract\tul 1-3 summary tables 090606)
ii. Tables show that the Purdue CML protocol proved superior in resultant yield (20-95 x
106/~4.3ml, and RBC contamination (7-10%) both times that we have tested it
d. Methods for proliferation assay with mitogenic stimuli
i. Cells were set up in a proliferation assay to test their response to mitogenic stimuli
1. Tested their response to Con A (10 g/ml) and anti-CD3 (from the
MABTECH ELISpot kit (#3420M-2HW-Plus); 100 ng/ml)
2. Cells were cultured in quadruplicate for 4 days before addition of BRDU;
BRDU was left in for 18 hours before development of the anti-BRDU ELISA as
per kit instructions (Cell Proliferation ELISA, BrdU (chemiluminescent), Roche
Applied Science, Cat. # 11 669 915 001)
e. Results for proliferation assay with mitogenic stimuli
1. observed good proliferative capacity to Con A, but not anti-CD3, at
three different cell concentrations (0.5 x 106/ml, 1 x 106/ml and 1.5 x
106/ml); see below TUL3 summary.xls “Cyno PBMC Proliferation: Tul3”
2. . Proliferation data shown below and also in TVDC Binder 1, Tul 3
a. Raw data: C:\Documents and Settings\jwilder.LOBOS\My
Documents\Tularemia Contract\ Tul 3 prolif 081806.xls
b. Summary data: C:\Documents and Settings\
jwilder.LOBOS\My Documents\Tularemia Contract\ TUL3
summary.xls
f. Methods for IFN response to mitogenic stimuli
i. Cells were set up in a IFN ELISPOT assay to test their response to
mitogenic stimuli
1. Tested their response to Con A (10 g/ml) and anti-CD3 (from the
MABTECH ELISpot kit (#3420M-2HW-Plus); 100 ng/ml)
2. Cells were cultured initially overnight in polypropylene tubes, 1.5 x
106/ml at 37 degrees (while the ELISPOT plates were coated with antiIFN antibody – normally this would be done the night before and the
cells would be cultured directly on these plates)
3. The following day, the ELISPOT plates were washed and blocked
with culture medium as per the kit instructions
4. Cells were transferred from tubes to the plates, in quadruplicate, at
the various densities/well: 225,000, 112,500, 56,250, 28,125 and 14,063
5. Plates were incubated a further 20.5 hours, a total of 38.5 hours with
the mitogens
6. Plates were washed, anti-IFN-biotin detection antibody was added
at 1 g/ml for 2 hours
7. Plates were washed and strept-avidin-HRP added for 1 hour
8. Plates were washed and TMB substrate added and incubated 20
minutes before washing extensively under tap water
9. Plates were left to air dry and read on the ELISPOT reader at UNM
on 8/18/06
g. Results for IFN response to mitogenic stimuli
i. Results are shown below, TUL-3: ELISPOT results:
1. saw good stimulation of IFN production after Con A stimulation, but not
anti-CD3
2. Con A stimulation of wells containing more than 28,125 cells resulted in
spots that were too dense to enumerate
3. Data locations:
9 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
i. Raw data:
 C:\Documents Settings\jwilder.LOBOS\MyDocuments\Tularemia
Contract\ tul3 elispot 081606.xls
 C:\Documents and Settings\jwilder.LOBOS\MyDocuments\Tularemia
Contract\PBMC assays.svd
ii.Summary data:
 C:\Documents and Settings\ jwilder.LOBOS\My
Documents\Tularemia Contract\tul3 elispot 081606 incl summary.xls

C:\Documents and Settings\jwilder.LOBOS\My
Documents\Tularemia Contract\PBMC assays.svv
Tul 1-3 summary tables 090606.doc
Yield and Purity of PBMCs
Date
7/12/06
Protocol
Purdue
CML
Animal
F2519
7/24/06
Williams’
Lab
2146C
7/24/06
NHPRR
55DIE
8/14/06
Purdue
CML
63909
Yield
19.4 x
106/4.2 ml
blood
10.4 x
106/4.7 ml
blood
0/4.8 ml
blood
94.75 x
106/4.5 ml
blood
% Viable
74%
% RBCs
10.7%
> 80%
Approx.
70.0%
n/a
n/a
82.8%
7.6%
TUL3 Summary.xls
Cyno PBMC Proliferation: Tul3
900000
800000
700000
RLU
600000
0.5 x 106/ml
1 x 106/ml
1.5 x 106/ml
500000
400000
300000
200000
100000
0
2255
15599
Nothing
Media only
Cells only
Cells + ConA
Cells + anti-CD3
Key to Graph:
-Nothing: No cells in wells; no addition of BRDU or anti-BRDU or substrate to those wells
-Media only: Media in wells for 4 days; addition of BRDU, anti-BRDU and substrate
-Cells only: Unstimulated cells in wells; addition of all reagents to detect proliferation
10 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
TUL-3: ELISPOT Results
Cell Mean for IFNg Spots
300
Media
Con A
Anti-CD3
250
200
150
100
50
0
14063
28125
56250 112500 225000
Number of Cells Plated/Well
d. Summary/Conclusions
i. Purdue cytometry mailing list protocol is superior for yield and low RBC contamination
1. Cells respond well to Con A as measured by proliferation and IFN
secretion
iv. IFN ELISPOT kit is simple and sensitive, however, the positive control provided,
anti-CD3, does not stimulate the cyno PBMCs well at 100 ng/ml
4. Significant decisions made or pending
Made: Use of Purdue Cytometry Mailing List (PCML) protocol employing Nycomed Lymphoprep
separation media
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
60% of scientific work has been completed
9. Work plan for upcoming month
1) We will prepare two batches of cynomologous macaque PBMCs from the same animal
using the PCML protocol and stimulate them in culture with Con A and PHA to test
proliferation and IFN secretion; this will test how reproducible the procedure is from
isolation to isolation.
2) We will stain the whole blood and PBMCs with antibodies to detect T cells (anti-CD4 and
–CD8), monocytes (anti-CD14) and NK cells (anti-CD56) to begin to assess the distribution of
these cells in normal cyno blood .
3) We will obtain expert help from the cytologists at LRRI who are very familiar with
cynomolgous macaque differential analysis to ascertain whether we are accurately reading
11 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
our slides and calling the correct percentage of lymphocytes, macrophages, eosinophils and
neutrophils in our cyno PBMC preparations.
10. Anticipated travel
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None for this milestone.
Milestone 25
Milestone description: Design protein-fragment library based on SCHU S4 sequence
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Pilot studies designed to evaluate our new synthetic-gene prediction program and new assembly
protocols are nearly complete. These protocols uniquely enable us to take advantage of the
newly developed microfluidic-based synthesis technologies for oligos. These new
oligonucleotides are parallel-synthesized and therefore are significantly less expensive than
standard individual-resin synthesized ones. However, oligo scale and quality is lower, and oligos
are delivered as an oligomix instead of individually arrayed. We have had 2 breakthroughs in the
past couple weeks. First, we have successfully assembled multiple subgene “building blocks” of
the intended 250bp size into full genes with high sequence fidelity. In fact, the gene quality is
greater than that from standard oligos. The second breakthrough is the successful design and
production of larger”building blocks” of 500bp each. This should further reduce production costs
since only half as many block amplifications will be necessary.
The list of 500 synthetic peptides covering MHC Class I and Class II epitopes have been
reviewed by Drs. Sykes, Johnston, Lyons, and Breen. The order has been placed but has not yet
been received.
Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\26\MHC\ftu_mhc_output.xls
4. Significant decisions made or pending
Examine fidelity, biases, and yield of assembled genes generated with micro-chip vs. resin-based
oligo-synthesis technologies. Fidelity will be assessed by cloning representative ORFs and
individually sequencing them. ORF assembling and/or amplification biases will be assessed by
comparing relative yields of sets of building blocks derived from a single oligomix. ORF yields will
be determined by nanodrop spectrophotometry.
5. Problems or concerns and strategies to address
None.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
85%
9. Work plan for upcoming month
a. Select final oligo design for library based on ORF product quality and quantity.
b. Receive, dilute, and array pools of peptides for sending to UNM for in vitro testing.
10. Anticipated travel
Travel to UNM on September 26-29 for annual TVDC meeting and WRCE meeting.
11. Upcoming Contract Authorization (COA) for subcontractors
None
12 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Milestone 26
Milestone description: Confirmation of gene expression (Design HTP SOPs, Test HTP SOPs,
ORF library production, confirm gene expression)
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
We have designed and received primers for amplifying 7 targeted F. tularensis genes (Table 1).
The ORF products have been amplified (Figure 1.)
Table 1 Selected F. tularensis genes for IVT production
1.
FTT0208c
ABC transporter
2.
FTT1695
groES chaperone
3.
FTT1712c
23 kDa protein
4.
FTT0901
TUL4
5.
FTT1419
hypothetical lipoprotein (p11)
6.
FTT1602
hypothetical lipoprotein (p12)
7.
FTT0613c
hypothetical membrane protein (p15)
Figure 1. PCR amplification of selected F. tularensis genes in Table 1
Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\26\
All 7 genes have been covalently placed in all four construct designs by overlapping PCR.
4. Significant decisions made or pending
These 28 constructs are being evaluated for protein production based on a number of criteria.
13 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
These alternative constructs will allow us to select the optimal arrangement of ORF promoters,
and protein fusions and tags for the library of antigens.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
65%
9. Work plan for upcoming month
Comparatively evaluate IVT constructs in several reaction mixes. Select the optimal construct and
IVT reactions based on ease of purification, yield and specificity of products and robustness of
the protocol.
10. Anticipated travel
Travel to UNM on September 26-29 for annual TVDC meeting and the WRCE meeting.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 32
Milestone description: Oligos selected for microarray production; Oligos list refined, 70mer
oligos procured, GDP oligos defined, Based on SCHU S4 sequence.
Institution: ASU-Johnston
1. Date started: 3/02/2006
2. Date completed: 08/28/2006
3. Work performed and progress including data and preliminary conclusions
The 70mer oligo set has been designed to cover the SCHU S4 genome; the set has been
ordered and received. The GDP primers have been designed, ordered and received.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
Oligonucleotide probes and controls (1,824, 70 mers) were arrayed into 5, 384 master and one
working spotting plates for creating spotted microarrays to assess the gene expression profile of
F. tularensis. Set of GDP primers for genome amplification.
7. Quality of performance
Good
8. Percentage completed
100%
9. Work plan for upcoming month
None
10. Anticipated travel
Travel to UNM on September 26-27 for annual TVDC meeting.
11. Upcoming Contract Authorization (COA) for subcontractors
None
14 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Milestone 33
Milestone description: Microarrays constructed and confirmed; First printing of arrays,
Testing with DNA from Ft, Arrays GDPs validated at ASU
Institution: ASU-Johnston
1. Date started: 08-01-2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
We received 19, 96 well plates containing a minimum of 65 microliters of an 80 µM stock solution
of each of the 1,824, 70mer oligonucleotides and controls. These have been re-arrayed into
master and working 384 well plates for printing. A test plate of oligonucleotide probes has been
prepared in either 3XSSC vs. Array-It Spotting buffer to determine optimal spotting conditions
(Figure 2). The test plate has been used to print microarray slides which will be used for test
hybridizations with LVS and/or SCHU S4 genomic DNA
Figure 2. Red-Reflect image (salt deposition) of a subset of F. tularensis microarray probes in either
3XSSC or Array-It Spotting Buffer
4. Significant decisions made or pending
Perform hybridization efficiency with genomic DNA in both spotting buffer conditions before final
dilution of working plates to 40 µM in the selected spotting buffer.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
30%
9. Work plan for upcoming month
Perform QC analysis of received LVS and SCHU S4RNA and DNA samples from UNM. Perform
hybridization tests using the two spotting buffer conditions with a limited set of probes. With this
result, complete the dilution of the first working set and print test slides on both Corning Ultragaps
15 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
and in-house produced poly-L-lysine-coated slides. Begin amplification studies of diluted RNA
with GDP primers for amplification efficiency.
10. Anticipated travel
Travel to UNM on September 26-29 for annual TVDC meeting and WRCE meeting.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 39
Milestone description: Create uvrA or uvrB mutant F. tularensis subsp. novicida
Institution: UTSA
1. Date started:4/3/2006
2. Date completed: Pending
3. Work performed and progress
The first part of the report will be a summary of the first deletion made in U112 (uvrB), reported
earlier, followed by the new data which is the creation of uvrA deletion in U112 (KKF72).
3.1 The primers used for making UvrB mutants are:
For UvrBUpSeq
UvrBUp 5’ggaGAATTCctg tga gtg gtg tat ttg gct cga
UvrBDn 5’ act act ggg ctg ctt cct aat gca ttg tat tgc ttg agg ctg atc gcc
For UvrBDnSeq:
UvBUp1 5’gct gct aac aaa gcc cga aag gaa gct acg aag gtt atc aaa gct ctc g
UvrBDn1 5’ gga GAA TTC ttg cac caa tcc cgg caa gtaa
For FnPErmCSeq
pET15bUniUp: 5’tgcattaggaagcagcccagtagt
pET15bUniDn: 5’ttc ctt tcg ggc ttt gtt agc agc
3.2 Set up following PCR reactions to amplify UvrBUpSeq:
10 X KOD XL Buffer
5.0 ul
dNTP 2mM
5.0 ul
UvrBUp 2uM
5.0 ul
UvrBDn 2uM
5.0 ul
U112 Chromosomal DNA 10 ng/ul
5.0 ul
KOD XL DNA polymerase
0.4 ul
dH2O
24.6 ul
and UvrBDnSeq:
10 X KOD XL Buffer
5.0 ul
dNTP 2mM
5.0 ul
UvrBUp1 2uM
5.0 ul
UvrBDn1 2uM
5.0 ul
U112 Chromosomal DNA 10 ng/ul
5.0 ul
KOD XL DNA polymerase
0.4 ul
dH2O
24.6 ul
at 94C 2’ then
94C 30”, 55C 30”, 72C 30” for 35 cycles, and at 72C for 10’.
16 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
3.3 The gel picture of UvrBUpSeq and UvrBDnSeq is shown as below:
6
5
4
3
2
1
Lane 1-3, UvrBUpSeq; Lane 4-6, UvrBDnSeq.
3.4 For overlapping PCR, set up:
Set up:
10 X KOD XL Buffer
5.0 ul
dNTP 2mM
5.0 ul
UvrBUp 2uM
5.0 ul
UvrBDn1 2uM
5.0 ul
UvrBUpSeq
3.0 ul
FpErmCSeq
3.0 ul
UvrBDnSeq
3.0 ul
KOD XL DNA polymerase
0.4 ul
dH2O
24.6 ul
at 94C 2’, then 94C 30”, 55C 30”, 72C 3’ for 35 cycles, and 72C 10’.
3.5 The gel picture was shown for overlapping PCR as below.
3
2
1
Lane 1-3, UvrBUpSeqFpErmCSeqUvrBDnSeq
3.6. Identify the UvrBFpEmrC inserted into pGEM-T vector.
The fragment from Step 3.4 was inserted into pGEM-T. White colonies from Amp/X-gal plate
was grown up, and plasmid was cut with EcoRI.
17 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
The gel picture was shown as below:
2
1
Lane 1,2 were plasmids cut with EcoRI with insert.
3.7 The plasmid from lane 1 was sequenced, and is correct. The plasmid was designated as
pKEK 951. pKEK 951 is the uvrA:ermC deletion plasmid.
3.8 The pKEK 951 was cryotransformed into U112, and grown up on TSA/ErmC plate.
Mutants were screened with colony PCR. The gel picture was shown as below.
9
8
7
6
5
4
3
2
1
Lane 1: Negative Control
Lane2: U112 wild type control
Lane 3: pKEK951 control
Lane 4-9: Mutants.
3.9 The PCR fragments from Step 3.7 were purified and cut with BamHI. The gel picture was
shown as below:
4
3
2
1
18 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Lane 1: Schu4 wild type template
Lane 2: U112 wild type template
Lane 3: pKEK951 template
Lane 4: Mutant
As only mutant has BamHI site, like plasmid pKEK951, which can be cut into two
fragments. The PCR fragments of wild type can not be cut as there is no such site in both
Schu4 and U112.
3.10 PCR fragment from step 3.8 was sequenced, and is correct. The mutant was frozen down
and designated as KKF 71. KKF71 is the uvrB::ermC mutant in U112.
3.11 The primers used for making UvrA mutants are:
For UvrAUpSeq
UvrASchu4Up 5’GGAGAATTCTGAAGCTATAGCAGAGGCTCGTGA
UvrASchu4LVSDn ’ACTACTGGGCTGCTTCCTAATGCACAACATACCTTCTTT GCCCTTCAG
For UvrADnSeq :
UvrASchu4LVSUp1 5’GCTGCTAACAAAGCCCGAAAGGAAGAAGGTGGTAGT
AAAGGAGGGCAG
UvrASchu4Dn1 5’GGAGAATTCCGCCATGCTCAACATCTCAAAGATG
For FnPErmCSeq:
pET15bUniUp: 5’ TGCATTAGGAAGCAGCCCAGTAGT
pET15bUniDn: 5’ TTCCTTTCGGGCTTTGTTAGCAGC
3.12. Set up following reaction for
UvrAUpSeq:
10 X KOD XL Buffer
dNTP 2mM
UvrAUp 2uM
UvrADn 2uM
U112 Chromosomal DNA 10 ng/ul
KOD XL DNA polymerase
dH2O
5.0 ul
5.0 ul
5.0 ul
5.0 ul
5.0 ul
0.4 ul
24.6 ul
and UvrADnSeq:
10 X KOD XL Buffer
5.0 ul
dNTP 2mM
5.0 ul
UvrAUp1 2uM
5.0 ul
UvrADn1 2uM
5.0 ul
U112 Chromosomal DNA 10 ng/ul
5.0 ul
KOD XL DNA polymerase
0.4 ul
dH2O
24.6 ul
at 94C 2’ then
94C 30”, 55C 30”, 72C 30” for 35 cycles, and at 72C for 10’.
19 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
3.13 Gel picture was shown as below:
1
2
3
4
5
6
Lane 1-3 UvrAUpSeq; Lane 4-6 UvrADnSeq.
3.14 For overlapping PCR, set up:
Set up:
10 X KOD XL Buffer
5.0 ul
dNTP 2mM
5.0 ul
UvrAUp 2uM
5.0 ul
UvrADn1 2uM
5.0 ul
UvrAUpSeq
3.0 ul
FpErmCSeq
3.0 ul
UvrADnSeq
3.0 ul
KOD XL DNA polymerase
0.4 ul
dH2O
24.6 ul
at 94C 2’, then 94C 30”, 55C 30”, 72C 3’ for 35 cycles, and 72C 10’.
3.15 The gel picture was shown for overlapping PCR as below.
1
2
3
4
Lane 1-4： UvrAUpSeqFpErmCSeqUvrADnSeq
20 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
3.16. The fragment from step 3.15 was inserted into pGEM-T. White colonies from Amp/X-gal
plate were grown up. Plasmids were cut with EcoRI.
6
5
4
3
2
1
Lane 1-6: pGEM-TUvrAErmC plasmid
The plasmid No.1 was sequenced and is correct. The plasmid was frozen away and designated as
pKEK952. pKEK952 is the uvrA::ermC deletion plasmid.
3.17 pKEK952 was cryotransformed into U112, and plated onto TSA/ErmC plate. Colony
PCR was performed to check mutant.
3.18 The gel picture was shown as below:
1
2
3
4
Lane 1: Negative control
Lane 2: U112
Lane 3: pKEK952
Lane 4: Mutant
3.19. PCR fragments were purified from step 3.18, and were cut with BamHI. The mutant can
be cut into two fragment as only it has BamHI site. The gel picture was shown as below:
21 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
1
2
3
Lane 1: U112
Lane 2: pKEK952
Lane 3: Mutant.
3.20 The PCR fragment from step 3.19 was sequenced, and is correct. The mutant was frozen
away, and designated as KKF 72. KKF72 is the uvrA::ermC mutant in U112.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
No problems so far.
6. Deliverables completed
pKEK951(UvrB deletion plasmid), KKF71( UvrB deletion mutant in U112);pKEK952(UvrA
deletion plasmid), KKF72(UvrA deletion mutant in U112); pKEK887(Francisella promoter
controlled ErmC plasmid).
7. Quality of performance
Complete.
8. Percentage completed
90% of scientific work completed on the milestone
9. Work plan for upcoming month
The double mutation uvrA, uvrB in U112 will be reported within this milestone in the coming
month, though it is an addition to this milestone.
10. Anticipated travel
None.
11. Upcoming Contract Authorization (COA) for subcontractors
None.
Milestone 40
Milestone description: Phenotyping of Ft novicida mutants; Measure degree of attenuation of
uvr mutants in macrophages and in mice
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
22 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Phenotyping of the F. tularensis ssp. novicida U112 uvrA strain from Dr. Karl Klose at UTSA is
ongoing. We previously demonstrated that the uvrB mutant has no detectable growth defect in
Chamberlain’s medium or in J774 macrophages. In order to determine whether uvrA has a
growth defect compared to uvrB, or U112, the ability to replicate within J774 murine
macrophages was measured. All three strains (uvrA, uvrB, U112) were able to replicate at the
same rate (with a doubling time of approximately 2h). The data confirm our earlier finding that the
deletion of uvrB does not render the bacteria more sensitive to macrophage-mediated killing, and
suggest that the nucleotide excision repair pathway is not required for replication in
macrophages.
Intracellular Growth Curve in J774
CFU/ml
1.00E+08
1.00E+06
U112
U112 uvrA dl
1.00E+04
U112 uvrB dl
1.00E+02
NB920-103
1.00E+00
0
10
20
30
hours post infection
4. Significant decisions made or pending
We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with
Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of Ft novicida.
5. Problems or concerns and strategies to address
Abrogation of the nucleotide excision repair pathway through uvrA or uvrB deletions does
not appear to result in a macrophage growth defect. If this trend persists in animals, it
suggests that a secondary attenuating mutation would be required if the SchuS4 strain were
to be used as the vaccine background (since LVS is already attenuated in humans it does not
require a secondary attenuating mutation). We will be screening attenuated Ft novicida
mutants that also have uvr mutations for immunogenicity in milestone 43, with the ultimate
goal of selecting an attenuating mutation to construct in SchuS4. We will also test a double
mutant uvrA, uvrB.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
20%
9. Work plan for upcoming month
23 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
In the upcoming months, the degree of virulence of U112, uvrA and uvrB mutants will be
determined in Balb/c mice using a subcutaneous model of infection. Our initial experiment will be
designed to determine the appropriate LD50 dose range of each strain ranging from 1x10 2 to
1x108.
10. Anticipated travel
Dr. Skoble, Dr. Bahjat, and Mr. Kim will be traveling to Albuquerque on September 26 to attend
the UNM TVDC annual conference.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 41
Milestone description: Optimization of psoralen treatment and characterization of KBMA F.
novicida; Determine the amount of S-59 and UVA required to inactivate uvr mutants, determine
extent of metabolic activity of uvr mutants after S-59 and UVA inactivation, determine the level
of virulence attenuation of KBMA uvr strains in mice
Institution: Cerus
1. Date started: 3/2/06
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
We previously identified the minimum concentration of S-59 required to inactivate wild type Ft
novicida U112 was 20M and the minimum concentration required to inactivate Ftn uvrB
was 5M when exposed to 6.5 J/cm 2 UVA. We found that complete inactivation was
reproducibly achieved at 4 J/cm 2. Surprisingly, we found that both U112 and uvrB
maintained metabolic activity for up to 12 hours. This month we have characterized the
sensitivity of the Ftn uvrA strain to photochemical inactivation.
1) Two experiments were performed to determine the appropriate dose of S-59 required for
complete inactivation of the uvrA mutant. In the first experiment complete inactivation was
not achieved at 1, 2, 5, or 10uM but was achieved at 20 uM. In the second experiment more
concentrations between 10 and 20 uM were tested. Complete inactivation was not achieved
at 1, 2, 5, 10, or 12uM but was achieved at 15, 18, and 20uM. Thus, 15µM was the minimum
concentration of S-59 required to achieve complete inactivation of Ftn uvrA using 4J/cm2
UVA. This is more S-59 than required for complete inactivation of the uvrB mutant and less
than for U112.
cfu/ml
S-59 + 4J/Cm2 Ftn uvrA Kill Curve
1.0×10 11
1.0×10 10
1.0×10 09
1.0×10 08
1.0×10 07
1.0×10 06
1.0×10 05
1.0×10 04
1.0×10 03
1.0×10 02
1.0×10 01
1.0×10 00
uvrA -008
uvrA -022
NB947-008
NB947-022
0
5
10
15
20
[S59] uM
24 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
2) Knowing that 15uM S-59 and 4 J/cm2 allowed for complete inactivation we next determined
the minimum amount of UVA light required for inactivation of the uvrA mutant. Below are
data from one representative experiment of two in which the raw CFU data from three
replicate plates are presented. We determined that complete inactivation of Ftn uvrA can
be achieved with 15µM S-59 using 4 or 6.5 J/cm 2 UVA, but that 2J/cm2 provides inconsistent
inactivation. This is similar to what was seen with the uvrB mutant.
Plate Well ID
B1
B2
B3
B4
B5
B6
C1
C2
C3
C4
C5
C6
A6
[S-59]
20uM
20uM
20uM
18uM
18uM
18uM
15uM
15uM
15uM
0uM
0uM
0uM
0uM
UVA
2 J/cm2
4 J/cm2
6.5 J/cm2
2 J/cm2
4 J/cm2
6.5 J/cm2
2 J/cm2
4 J/cm2
6.5 J/cm2
2 J/cm2
4 J/cm2
6.5 J/cm2
0 J/cm3
Colony Count
1:10 Dilution
0,0,0
0,0,0
0,0,0
0,0,0
0,0,0
0,0,0
0,0,0
0,0,0
0,0,0
Not Done
Not Done
Not Done
Not Done
Neat
0,0,0
0,0,0
0,0,0
0,1,0
0,0,0
0,0,0
0,2,0
0,0,0
0,0,0
Not Done
Not Done
Not Done
Not Done
10-7 Dilution
Not Done
Not Done
Not Done
Not Done
Not Done
Not Done
Not Done
Not Done
Not Done
Not Done
Not Done
Not Done
286,302,347
CFU/mL
0.00E+00
0.00E+00
0.00E+00
3.30E+00
0.00E+00
0.00E+00
6.60E+00
0.00E+00
0.00E+00
N/A
N/A
N/A
3.12E+10
(NB 948-039)
3) The metabolic activity of Ftn uvrA strain was determined when inactivated with 0, 15, 18,
and 20 uM S-59 and using 4 J/Cm 2 UVA. The metabolic activity of the cultures was
determined using Cell Titer 96 assay using a series of 3-fold dilutions of particles ranging
from 1x 109 to 3x107. Below are representative data from the nominal 1e8 group.
NB 948-039
Ft novicida uvrA
Nominal 1.1E8cfu/mL
2.0
Well B2, 20uM S59, 4J/cm2 UVA
1.8
1.6
Well B5, 18uM S59, 4J/cm2 UVA
OD490
1.4
1.2
Well C2, 15uM S59, 4J/cm2 UVA
1.0
0.8
0.6
Well C5, 0uM S59, 4J/cm2 UVA
0.4
0.2
0.0
0
2
4
6
Time, hrs
8
10
12
Well-A6 0uM S59, NO UVA
In this experiment the groups that received no UVA or no S-59 (and were therefore live and
capable of replication) demonstrated a higher degree of metabolic activity than the groups
that were killed with S-59 and UVA. All three photochemically inactivated cultures
demonstrated a reduced degree of metabolic activity that was indistinguishable from each
other, but persisted for greater than 12 hours.
4) The effect of decreasing UVA dose on metabolic activity was also assessed. Below are
curves generated using 15uM S-59 and 0, 2, 4, or 6.5 J/cm2 UVA. There was no significant
25 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
increase in the metabolic activity when UVA dose was decreased from 6.5 to 4 or 2 J/cm 2.
All experiments were repeated with similar results not shown (NB948-058).
Ft novicida uvrA
Nominal 1.1E8cfu/mL
2.0
Well C1, 15uM
S-59, 2J/cm2
UVA
1.8
Well C2, 15uM
S-59, 4J/cm2
UVA
1.6
1.4
Well C3, 15uM
S-59, 6.5J/cm2
UVA
OD490
1.2
1.0
0.8
Well C5, 0uM S59, 4J/cm2 UVA
0.6
0.4
Well-A6 0uM S59, NO UVA
0.2
0.0
0
2
4
6
8
10
12
Time, hrs
NB948-039
5) The difference in metabolic activity between KBMA Ftn uvrA and Heat killed Ftn uvrA
was assessed using the Cell Titer 96 assay. The data generated with 3.3 x 108 initial input
bacteria are shown below. While the live bacteria (UVA treated without S-59) had a higher
degree of metabolic activity than the KBMA bacteria (treated with 15µM S-59 and 4 J/cm2
UVA), the heat killed bacteria had no measurable metabolic activity.
Ft novicida uvrA
15uM S-59 4 J/cm2
Nominal 3.33e8 cfu/mL
Well C2, 15uM
S-59, 4J/cm2
UVA
3.5
3.0
Well C5, 0uM S59, 4J/cm2 UVA
2.5
OD490
2.0
1.5
Well-A1 0uM S59, NO UVA
Heat Killed
1.0
0.5
0.0
-0.5
0.0
2.0
4.0
6.0
8.0
10.0
12.0
Time, hrs
Conclusions: The uvrA mutant is slightly more sensitive to photochemical inactivation than
the WT strain, but is slightly less sensitive than the uvrB mutant. The fact that the
inactivation profiles are not identical between the two mutant strains suggests that perhaps
there is potential for a compound effect of combining the two mutations. However, all
26 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
photochemically inactivated Ft novicida demonstrate significant metabolic activity for greater
than 12 hours and display a vastly higher degree of metabolic activity than heat killed
bacteria. This might be enough metabolic activity to maintain immunogenicity.
4. Significant decisions made or pending
The minimum S-59 dose required for inactivation of U112 is 20 µM, the minimum S-59
concentration required for inactivation of Ftn uvrB is 5 µM and for Ftn uvrA is 15 µM. The
minimum UVA dose required to achieve complete inactivation is 4 J/Cm 2.
5. Problems or concerns and strategies to address
We previously have determined the concentration of S-59 required to inactivate Ftn uvrB is
only one ¼ the concentration required to inactive the wild-type U112 strain. Currently, we
have determined that the concentration of S-59 required to inactivate Ftn uvrA is ¾ the
concentration required to inactive the wild type U112 strain. We have determined that the
level of metabolic activity between Ftn U112 and uvrB or uvrA mutant strains is
indistinguishable. This difference is less than we have observed for other organisms. It is
still possible that the Ftn uvrA+uvrB strain will be more sensitive to photochemical
inactivation, and hence may display a higher degree of metabolic activity. The uvrA+ uvrB
double mutant will be evaluated as soon as it is received from UTSA .
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
25% of scientific work completed on the milestone
9. Work plan for upcoming month
We have determined the minimum concentration of S-59 required for complete inactivation of
U112, uvrB and uvrA strains (20M, 5 µM and 15M respectively). We have determined
that the lowest dose of UVA that results in reproducible complete killing (4 J/cm 2). We have
determined that the U112 and uvrB and uvrA strains have comparable metabolic activity
when inactivated. We will evaluate the sensitivity of the uvrA+ uvrB double mutant to
photochemical inactivation will be as soon as it is received from UTSA . and we will compare
the metabolic activity of the uvrA+ uvrB double mutant to the WT, uvrA, and uvrB
mutant strains. We will begin to scale up the inactivation process. Additionally, a storage
formulation will be developed for KBMA strains.
10. Anticipated travel
Dr. Skoble, Dr. Bahjat, and Mr. Kim will be traveling to Albuquerque on September 26 to attend
the UNM TVDC annual conference.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 43
Milestone description: Create uvrA or uvrB mutants in LVS
Institution: UTSA
1. Date started: 5/01/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
27 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
3.1 The pKEK1028 (pUCUvrBLVSUpSeq) and the pKEK1029 (pUCUvrBLVSDnSeq)
plasmids were digested individually with BamHI ; then subsequently, these were
digested with EcoRI enzyme to completion.
3.2 The plasmids above were run on a 1% agarose gel. The pKEK1029 plasmid was
linearized with the enzymes mentioned and this was isolated from the gel using the
Qiagen Extraction Kit mentioned in an earlier report.
3.3 The pKEK1028 generated two fragment sizes on the gel and these represented the
plasmid (pUC19) as the larger band and the smaller band represented the 5´ end of
the UvrBLVS sequence which was gel isolated with the extraction kit mentioned in 3.2.
3.4 Each of the isolates in 3.2 and 3.3 were used in a ligation reaction to generate a
plasmid that contains the entire UvrBLVS deletion. Once the ligation reaction was
complete this was phenol: chloroform extracted; ethanol precipitated; and used to
transform into Top10 competent cells.
3.5 Ten plasmid preparations were made from some of the resulting transformants in 3.4.
These where digested with EcoRI and compared to the parent vector (KEK1029). The
correct construct yielded about a 1700 bp shift compared to the parent vector. Two
candidates looked correct therefore, these were both digested with EcoRI and BamHI
together to yield two bands on the gel. The smaller band represents the 5’ end of the
UvrB fragment which looked correct for both clones.
3.6 A larger plasmid preparation was made from one of the potential candidates above to
send for sequencing.
3.7 In the meantime, started to prepare the kanamycin fragment that we want to insert in
the middle to the deletion to help in selecting for the desired UvrB deletion in the LVS
strain. Will use KEK964 (pUC118 containing the Francisella promoter (Ft) in front of
the kanamycin gene) to remove the fragment Ft+kanamycin gene by digestion with Bgl
II then BamHI.
All the data were documented in page 58-61, TVD UTSA notebook #2.
4.Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
Approximate 38% scientific work completed on the milestone
9. Work plan for upcoming month
3.1 Prepare Ft+Kanamycin fragment to use in ligation reaction with confirmed UvrBLVS
deletion sequence (plasmid in step 3.6).
3.2 Perform transformation of Top10 cells with this ligation and screen clones by digestion.
3.3 Once the correct construct with the UvrB deletion along with the Ft+Kan fragment is
confirmed will proceed with crytransformation of LVS to generate the desired mutant.
10. Anticipated travel
None.
11. Upcoming Contract Authorization (COA) for subcontractors
None.
28 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Milestone 46
Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale
Francisella tularensis culture conditions, Establish 3L culture scale purification conditions,
Optimize 3L scale photochemical inactivation process, Verify protective immunogenicity of
vaccine candidates produced by optimized large-scale process
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
We have demonstrated previously that LVS grows robustly in Chamberlain’s defined medium
(CDM) and that WT Ft novicida and Cerus’ strain of LVS are inactivated with similar
concentrations of S-59. We have received our APHIS permit from USDA for import of LVS
and Ft novicida (permit # 54834) and have received requested vials of DVC LVS.
1) Working cell banks of DVC lot# 16 LVS were prepared by growing cultures in CMD for 36
hours and were harvested at an OD of 1.0 and stored at –80 oC.
2) We attempted to calculate the ratio of Blue/Gray variants in the DVC material and compare
to a single passage in CDM, but colonies failed to grow on cysteine peptone agar plates
(provided by UNM from PML Microbiologicals). The expected number of colonies grew when
the same dilutions were plated on CHAH plates. These data suggest that the cysteine
peptone agar does not support robust growth of LVS, and therefore represent a selective
growth condition and would be inappropriate for the quantification of colony phenotype. We
will confer with other TVDC members about a standard assay we can all use for determining
the LPS phase variation.
3) We have performed a S-59 dose-titration for photochemical inactivation of DVC LVS using
the Cerus_Ft_protocol_005 to determine the minimum concentration of S-59 required for
complete inactivation (focusing on concentrations between 1 and 50 µM). Complete
inactivation of DVC LVS was achieved at all concentrations of S-59 greater than or equal to
5uM. This is the same concentration of S-59 required for inactivation of the uvrB mutant of
Ftn. This is likely due to differences in sensitivity between the holarctia and the novicida
subspecies. The sensitivity of the uvr mutants of LVS will be determined when the mutants
are constructed.
29 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
NB 934-080
DVC Ft LVS Kill Curve (6-Well Format)
8.00E+01
7.00E+01
Initial Titer = 2.43e9
6.00E+01
cfu/mL
5.00E+01
4.00E+01
Series 1
3.00E+01
2.00E+01
1.00E+01
0.00E+00
0
5
10
15
20
25
30
35
40
45
50
[S-59] (uM)
4. Significant decisions made or pending
We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with
Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of LVS. We have
switched from glycerol to DMSO for cryopreservation of stocks. We have determined the
minimum concentration of S-59 psoralen required for complete inactivation is 5uM. .
5. Problems or concerns and strategies to address
We do not know why LVS failed to grow in CDM in the fermentor but grows well in CDM in shaker
flasks. In the future we will keep the media in a dark environment prior to cultivation as the media
appears to be light sensitive.
6. Deliverables completed
None
7. Quality of performance
fair progress
8. Percentage completed
13% of scientific work completed on the milestone
9. Work plan for upcoming month
We will repeat the DVC LVS S-59 titration with more concentrations between 0 and 5 uM.
We will modify the large-scale propagation procedure so that the inoculum going into the
fermentor is in early stationary phase rather than late stationary phase and attempt 3L-scale
propagation using media stored in the dark. During the cultivation we will monitor the pH,
dissolved oxygen concentration, and optical density of the bacteria and determine the
number of colony forming units at various time points.
10. Anticipated travel
Dr. Skoble, Dr. Bahjat, and Mr. Kim will be traveling to Albuquerque on September 26 to attend
the UNM TVDC annual conference.
11. Upcoming Contract Authorization (COA) for subcontractors
None
30 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
I. Cloning of igLC:
a) Prepared10 more mini plasmid preparations from the transformation
resulting from the ligation reaction of the IgLC deletion PCR product and
the pUC118 KEK964 construct. Ran diagnostic digestions with NdeI and
EcoRI; there were no promising candidates.
b) Therefore, decided to try a lower copy number plasmid KEK229 to clone
in the igLC deletion fragment. This plasmid is essentially pCVD442
containing the Multiple cloning site from pwsk30 vector instead of it’s own
(see figure 1). It is imperative that we clone this deletion into a E.coli
strain (via a plasmid) in order to continue our work in getting the deletion
in Schu4. The igLC sequence seems to be toxic to these strains which
makes it very unstable . Using a lower copy number plasmid may help
offset this instability and allow us to clone this deletion in our E. coli strain
via the plasmid.
Figure 1
The bold print on the multiple cloning site bars indicate these restriction
endonuclease sites are not unique.
31 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
c) The pCVD442 was created by Ried and Collmer (Gene 57:239-46, 1987)
and contains the following features:
i. a pir dependent origin of replication from R6K
ii. a bla gene encoding resistance to ampicillin
iii.
a mob gene region allowing efficient transfer by conjugation from
strains containing the tra locus
iv. the sacB gene conferring sensitivity to sucrose in Gram-negative
bacteria
d. The plasmid containing the IgLC deletion with no resistance marker (KEK906will use the 3000 bp NotI/Sal I fragment) and KEK229 were both digested with
Not I then subsequently with Sal I. Both were then run on an agarose gel and
each were gel purified as previously described. The resulting isolates were
used in ligation reaction.
e. Transformation was performed with SM10λpir competent cells using the
cleaned up ligation (i.e. phenol:chloroform extracted then ethanol precipitated)
generated in d. The first attempt did not yield any colonies therefore, prepare
fresh competent cells of SM10λpir and DH5αλpir. In addition, prepared fresh
digestions and isolations of the two plasmids in d
f. Prepared a new ligation reaction with new isolates and performed another
transformation using both bacteria strains above, independently.
g. Only two colonies resulted in the DH5αλpir strain; these were screened and
found to be only re-ligation products (i.e. the original vector KEK229 with no
insert).
h. The SM10λpir transformation yielded 15 colonies; however, the background
(i.e. religation plate was high, about 9 colonies). Have not been screened yet
and will be screened next month.
i. Data located in TVD UTSA Notebook 3, page 22-24.
II. Experiments to generate deletions in Schu4: We are working with the MglA gene to show
that we can create a deletion in SCHU S4; it is a single copy gene in this organism and that
is easier to screen for than the genes we will be deleting in the project. We have a
construct in hand which contains over 1000 bp homology at the 5´ and 3´ ends of this gene
therefore, it is ideal to use in the development of deletion protocol.
a. Using a plasmid (KEK1023) containing about 1200 bp homologous flanking regions of a
gene called MglA; performed an electro-transformation into Schu4.
b. This plasmid is pUC118 containing the F. tularensis promoter driving the expression of
the kanamycin gene which encodes resistance to kanamycin. Immediately, downstream
of this fragment is the MglA deletion gene (about 2400 bp fragment). We hoped that the
homology would be long enough to allow recombination with the Schu4 chromosome as
the plasmid enters the cell.
c. The selection of the transformants were on 50 ug/ml (final concentration) kanamycin
(Kan) Tryptic Soy Agar (TSA +++) plates containing various supplements and described
earlier. Also, a negative control (i.e. Schu4 with no plasmid used in electroporation) was
also plated on these plates to follow any spontaneous kanamycin resistant cells that may
occur during our five day 37° C incubation that was used following the electroporation.
d. After five days did not see any spontaneous resistant cells on the negative control plates.
However, only five clones resulted from the electroporation with the KEK1023.
e. Chromosomal preparations were made of these “parent” transformants to check for
recombination into the Schu4 chromosome. Used primer set MglAB H3 and MglAB BHI
to look for the deletion. If the plasmid got cross-over with Schu4 you will see two bands;
one size will equal what you would see in wild type and the other will reflect the deletion
size. According to DNA sequence information on Schu4 there is only one MglA gene in
Schu4 therefore, if the deletion is complete then we should be left with only one product
with this oligo set. (See figure 2)
32 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
f.
These transformants were passaged onto non-selective plates to try and get the plasmid
out of the chromosome. The single colonies were struck on these TSA+++ plates to
generate single colonies and these were patched on Kan plates and TSA+++ nonselective to look for sensitivity to Kan. Each cycle of passage would be taken from the
previously passaged plate to create the next cycled plate.
g. Performed four passages by plates and never generated a sensitive Kan colony
therefore, did four passages in liquid culture, made dilution from each passage and
spread on non-selective TSA+++ plates. These were patched onto Kan and TSA +++
plates to look for Kan sensitive clones. No Kan sensitive clones resulted but I did make
chromosomal preparations from some representative singles generated from each
passage to check by PCR to see if the deletion was in the chromosome with the plasmid
or if the deletion was lost and the plasmid was left in the chromosome (very unlikely).
(See figure 2)
Figure 2:
a. Below represents one of the PCR screens run with the five clones generated from KEK1023
electrotransformed into Schu4. The Legend identifies the strain, clone, or plasmid used as the
template for the PCR reaction. The oligo set used here is MgLAB H3 & MgLAB BHI. Those
clones that do not have “TK” in their name are single colonies from one of the passages made in
the experiment. The Schu4 WT product is the reference for native MgLA gene product. The
KEK1023 is the plasmid containing the MgLA gene deletion that should have entered the
chromosome therefore, can serve as the deletion product size. The KKF34 is the MgLA deletion
in F.novicida strain, this is just to verify primer set is working correctly. Data located in TVD
UTSA Notebook 3, page 33. The deletion sequence did cross-over into the Schu4
chromosome;however, since the plasmid also has entered the chromosome
the PCR profile will give both the wild-type (WT) and the deletion size band (it
is not a completed deletion). The control WT strains on the gel have no
plasmid and the profile is yielding only the WT gene size as expected.
1 2
3 4
5
6 7
8 9 10 11 12 13 14
Legend Figure 2a:
1. 1 Kb ladder
2. Schu4 WT
3. KKF34 U112dMgLA
4. KEK1023
5. 3TKA
6. 3AI
7. 3TKB
8. Schu4 WT
9. TypeB WT
10. 3BI
11. 3TKC
12. 3TKD
13. 3TKE
14. 3DI
b. This represents another PCR screen using the indicated strain, clone or plasmid used as a
template. The oligo set here used in the reaction are PUCori XhoI and PUCori EcoRI. The set
is used to confirm whether or not a second recombination has occurred causing the plasmid to
be lost from the chromosome. The Schu4 WT should not have the PUC origin; as well as, the
KKF34 strain, since the deletion was made with a PCR product with no plasmid. The KEK1023
is the vector used in experiment and yields the correct PUC origin PCR product size that should
result from the oligos used in this screen. The passaged clones used in this set are later single
isolates which still remain Kan resistant. We did not generate any Kan sensitive mutants
however, I checked a few passage single clones to verify primer set is working properly. Data
located in TVD UTSA Notebook 3, page 35. Since we did not generate any Kan sensitive
33 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
mutants, I checked a few passage single clones to verify primer set is working properly. This is
checking for the plasmid’s origin of replication sequence; a oligo set checking for the kanamycin
gene itself was also used and it yielded a PCR product as expected (data not shown).
1
2
3 4
5
6 7
8 9 10 11 12 13 14
Legend Figure 2b:
15. 1 Kb ladder
16. Schu4 WT
17. KKF34 U112DMgLA
18. KEK1023
19. 3TKA
20. 3A6
21. 3TKB
22. 3B4
23. 3TKC
24. 3C4
25. 3TKD
26. 3D7
27. 3D8
28. 3D9
.
h. The deletion seems to remain in the chromosome but we are unable to get the second
recombination to occur to remove the plasmid. It may be possible if we use the SacB
gene expressed from the Ft promoter we may be able to force the second recombination
and loose the plasmid.
i. Data located in TVD UTSA Notebook 3, page 31-36.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
We are using various approaches to deleting the IglC gene in SCHU S4 and in summary our
stratagies are:
1. The first plasmid used to clone in the entire igLC deletion (about 3000 bp fragment) was in
KEK903 which was the original mating plasmid proposed to use in creating deletions in Schu S4.
We were able to get a correct clone from our transformations.
2. Secondly, we tried using pKEK999 which is a pUCvector containing a F. tularensis promoter
driving the Kanamycin gene expression. This was going to be used to create mutants in Schu S4
by way of cryotransformation or electroporation instead of a mating method. We were unable to
get the deletion in this plasmid.
3. Currently, we will attempt to clone this deletion in a pKEK229 which is a mating vector used in
our lab and is a low copy number plasmid. More detail on this plasmid is given in the text of this
report.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
17%
9. Work plan for upcoming month
a. Prepare more mini plasmid preparations from the transformation resulting from
KEK229+iglC deletion sequence in section I.h. above. We are hopeful that this set will
yield the correct construct containing the longer iglC deletion to use in making the Schu4
igLC deletion.
b. Once we verify the correct construct, I will try cryotransformation and
electrotransformation to attempt to generate the IglC deletion in Schu4.
34 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
c.
Will work also in cloning in the SacB gene in KEK1023 to check if this would be helpful in
pushing the second recombination event needed to generate a mutation in Schu4.
d. Order more supplies as needed
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS
uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD,
iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA,
iglB strains
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
a. These experiments were performed to verify and obtain basal level of information on
respiratory cellular responses with Ft LVS and Ft novicida and will be used comparatively
with the attenuated mutants that will be created by Dr. Klose. Mice (BALB/C 6-week-old
females) were challenged intranasally with 10 LD50 of Ft LVS (20,000 CFU, live or UVinactivated) or Ft. novicida (Fn, 100 CFU, live or UV-inactivated). Lungs were collected
from Ft-infected mice 24h-, 48h-, and 72h-post challenge (3 mice/time point/group),
single cells were made and subjected to flow cytometric analysis to determine the
infiltrating populations of antigen presenting cells-macrophages, dendritic cells,
neutrophils and NK cells (Note Book #4 page:31-33, 34-36). Naive and PBS-treated
mice were used as a base line control. In our July report, we have shown that populations
of T cells and B cells did not differ among all examined groups and a similar phenotype
analyses on spleen cells from those infected animals did not show any remarkable
differences.
Summary of the Flow Cytometric Analyses
1. Whereas there was minimal influx of APCs (Antigen Presenting Cells) at 24 hr with F.
novicida challenge, UV-inactivation of the organism greatly increased the numbers of
cells in the lung at this time point (Table 1, File name: 0806 infiltrate.doc).
2. At 48 hr, there was an increase in the cellular infiltration after challenge with
F.novicida, while the response with the UV-inactivated organism has begun to wane.
3. By 72 hr the cellular response in the lungs of either F.novicida or UV-inactivated
organism had dropped back to a baseline. In contrast, very minimal differences were
observed with LVS and UV-inactivated LVS, presumably because of the attenuated
nature of the strain. Together these results, suggest that F. novicida may be
suppressing/interfering with the initial cellular response in the lung as early as 24 hr
as evidenced by the differences in cellular infiltration between the replicating and
killed organism. To our knowledge, although this phenomenon has been reported in
the literature, there has been no substantial data to really show this effect in vivo.
35 of 36
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2006 to 8/31/2006
Due Date: 9/15/2006 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob Sherwood, Julie
Wilder, Ed Barr, Mitch Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Justin Skoble
Table 1. Cellular infiltration in lungs of mice upon pulmonary Francisella infection
Lungs
24 hr
Isotype
CD11b
2.2
CD11c
1.2
CD59
1.2
Ly6
1.2
Naive
2.2
PBS
2.1
6
TOTAL
UV-Fn
3.8
10.1
6.7
5.2
13.5
3.9
2.2
7.6
5.9
3.9
12.9
4.5
4.6
48 hr
F nov
14.9
21
Lungs
15.1
44.1
PBS
UV-Fn
10.5
3.6
7
12
1
6.5
5.1
13.4
4.7
2.8
15.9
24 hr
Isotype
CD11b
0.3
CD11c
0.1
CD59
0.3
Ly6
0.1
TOTAL
Naive
6.4
PBS
4
2.1
8.8
21.3
F nov
UV-Fn
3.4
5.4
5.7
6.6
6.3
8.2
7.9
1.9
2
4.6
3.8
4.8
7.1
6.6
42.4
16.8
PBS
16.5
48 hr
LVS
UV-LVS
5.2
2.8
4.8
4.3
2.8
3.2
1.9
1
7.1
5.7
18.5
72 hr
F nov
UV-LVS
6.6
2.1
4.2
3.6
2.1
2.9
1.2
1.3
0.5
1
5.9
7.5
2.7
6.2
15.1
19
7.4
24
72 hr
LVS
12.3
PBS
25.3
14.3
PBS
LVS
UV-LVS
6.8
5.8
4.5
5.6
4
3
1.6
1.2
1.3
8
7.7
5.7
22
18.7
Mice (BALB/C 6-week-old females) were challenged intranasally with 10 LD 50 of Ft. subspecies novicida (100CFU,
live or UV-inactivated) or Ft LVS (20,000 CFU, live or UV-inactivated). Lungs were collected from Ft-infected mice
24h-, 48h-, and 72h-postinfection (3 mice/time point/group), single cells were made and subjected to flow cytometry
analysis to determine the population of inflammatory cells. CD11b, CD11c, CD59, and Ly6, are commonly used
markers for macrophages, dendritic cells, NK cells, and neutrophils, respectively .
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good”
8. Percentage completed
Provide approximate 15% of scientific work completed on the milestone
9. Work plan for upcoming month
a. Receive Ft subsp. novicida uvrA strain from Dr. Klose for characterization
b. Determine the LD50 of Ft subsp. novicida uvrA
c. Measure intramacrophage (J774) survival of uvrA
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
36 of 36
14.5