Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2, 3, Working Group, 5, 12, 25, 26, 32, 39, 40, 41, 43, 46, 49, 50
Completed milestones: 1, 16
Inactive milestones: 4, 6-11, 13-24, 27-31,, 33-38, 42, 44-45, 47-48, 51-54
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/1005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
NIAID is working on the IAA with USAMRIID and a legal and financial liability review is pending.
4. Significant decisions made or pending
a. UNM and NIAID continue to wait for a change in the status of the IAA between NIAID
and USAMRIID.
b. LBERI has ordered a biobubble as additional protective equipment
c. UNM will be discussing with NIAID, the impact of not having human cells from LVS
vaccinated individuals which are needed to develop in vitro immunoassays
d. UNM EOHS has obtained many of the laboratory documents
i. Documents pending
1. Laboratory CAP Certificate
2. Radiology Facility Accreditation Certificate
e. UNM EOHS is prepared to send 1 or 2 nurses to USAMRIID to train to read the LVS
vaccination sites and to report adverse reactions to USAMRIID
i. USAMRIID conveyed that the UNM nurses would have no more risk in evaluating
a tularemia skin vaccination site than they have reviewing a PPD test.
f. UNM has received copies of USAMRIID’s informed consent document, physician order
sheet, and Tularemia vaccination site evaluation document,
5. Problems or concerns and strategies to address
When will the NIAID-USAMRIID IAA be completed and when can UNM begin the prehealth
screenings?
6. Deliverables completed
None
7. None Quality of performance
Good
8. Percentage completed
15%
1 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
9. Work plan for upcoming month
Ross Kelley will continue to monitor the progress of whether Martin Crumrine's IAA between
NIAID and USAMRIID will inform UNM when and whether the TVD Contractors can be
vaccinated under this IAA.
10. Anticipated travel
Travel could occur in August through November 2006, as soon as the IAA is reached and NIAID
approves the travel.
11. Upcoming Contract Authorization (COA) for subcontractors
UNM may request a COA to allow 1-2 UNM EOHS nurses to travel to USAMRIID for training on
LVS site vaccination evaluations. The timing of the COA request depends on the achievement of
the IAA.
Milestone 3
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions


Performed stability testing for LVS recovery from bioaerosol samplers
 Tested recovery from Chamberlain’s, PBS, BHIB, and 1% peptone at up to 4 hrs after
spiking at RT and 4°C (see Table 1 below)
 The four media had similar stability except that the microbial titer in Chamberlain’s
appeared to drop over time at RT. PBS, BHIB, and 1% peptone appeared stable at
RT and all four had similar stability at 4°C.
 \\Saturn\ABSL3\ABSL3 Study Data\Tularemia\Tularemia Milestone 3 (Bioaerosol
Development)
Performed 2 initial bioaerosol sprays
 Sprayed approx. 1x106 CFU/mL for 10 min
 No viable LVS recovered in impinger
 Viable cells were recovered from the spray suspension while no viable cells were
recovered from the impingers. Conclusions are that 1) spray vehicle failed to protect
the cells, 2) impinger fluid failed to protect the cells, 2) Collison nebulizer killed the
cells, 4) the cells which were reconstituted from lyophilized state were susceptible to
damage from aerosolization, or 5) a combination of the previous four assumptions.
 \\Saturn\ABSL3\ABSL3 Study Data\Tularemia\Tularemia Milestone 3 (Bioaerosol
Development)
4. Significant decisions made or pending
a. None
5. Problems or concerns and strategies to address
a. None
6. Deliverables completed
a. None
7. Quality of performance
a. Good
8. Percentage completed
a. 12%
9. Work plan for upcoming month

Continue preliminary bioaerosol experiments with reconstituted LVS and Collison generator
 Plan to quantitate LVS on CHAB
2 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,


 Will test bioaerosol w/ and w/o antifoam
 Will test different LVS concentrations to determine spray factors
Perform bioaerosol experiments on vegetative LVS with Collison generator
 Repeat of studies performed on reconstituted LVS
 Plan to grow LVS in CB
 Plan to quantitate LVS on CHAB
Prepare seed and working stock of LVS
10. Anticipated travel
a. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
a. None anticipated
Table 1.
Effect of Time and Temp on Recovery of LVS from Various Possible AGI
Sampling Media
Media
Temp
Time (Hrs)
T=2
T=3
T=4
Chamberlains
RT
2.15E+08
1.00E+08
7.00E+07
PBS
RT
7.50E+08
3.40E+08
1.01E+09
BHIB
RT
9.80E+08
1.50E+09
1.40E+09
1% peptone
RT
7.45E+08
1.00E+09
8.15E+08
Chamberlains
4°C
1.75E+08
2.40E+08
3.65E+08
PBS
4°C
1.20E+09
5.75E+08
1.00E+09
BHIB
4°C
5.60E+08
9.10E+08
1.01E+09
1% peptone
4°C
7.70E+08
3.25E+08
4.15E+08
Working Group
Milestone description: Determine appropriate solid and liquid media for growth of tularemia for
project team
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions(Data
found in folder on Saturn server entitled ABSL3/Study Data/Tularemia)
a. Prepared growth curves for LVS in Chamberlain’s (see figures below) and MCPHI
b. OD curves for MCPHI were flat
c. Verified that pH affects Chamberlain’s growth curve
3 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
d. Found better growth at pH 6.2 as indicated by CERUS
e. These experiments were performed to provide necessary data to DSTL for their
upcoming blue/grey variant tests. OD determinations were ineffective for measuring
growth in MCPHI. Cell counts and OD determinations indicate that LVS grown in
Chamberlain’s at 37°C with shaking is in log phase growth for at least 48 hrs. Growth is
at late log at 72 hrs and in lag phase at 96 hrs.
f. \\Saturn\ABSL3\ABSL3 Study Data\Tularemia\Tularemia Milestone 3 (Bioaerosol
Development)
4. Significant decisions made or pending
a. Chamberlains broth outperformed most other broths tested. We plan to utilize
Chamberlain’s broth for future LVS broth studies until a final decision is made on cell
phenotype in Chamberlain’s.
5. Problems or concerns and strategies to address
a. None
6. Deliverables completed
a. None
7. Quality of performance
a. Good
8. Percentage completed
a. 50%
9. Work plan for upcoming month
a. Repeat 48 hr growth curve
b. Repeat broth study to obtain appropriate cell counts. The broth growth was greater than
anticipated in the initial study and adequate cell counts were not obtained. Appropriate
cell counts are needed to assign proper OD values to cell concentrations.
10. Anticipated travel
a. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
a. None anticipated

Chamberlain's
0.450
Each point is the average of 3 values
OD(600)
0.400
0.350
0.300
0.250
0.200
0.150
0.100
0.050
0.000
24
48
72
96
Grow th Tim e (Hrs)
4 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
72 Hr Curve

Each point is the average of 3 values

Each point is the average of 3 values
8.00
Log10 CFU/mL
7.50
7.00
6.50
6.00
5.50
5.00
0.400
0.207
0.107
0.067
0.036
0.011
OD(600)
96 Hr Curve
7.50
Log10 CFU/mL
7.00
6.50
6.00
5.50
5.00
0.402
0.213
0.089
0.044
0.015
OD(600)
5 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Milestone 5
Milestone description: Species tested for sensitivity to LVS & generation of immunity against a
pulmonary challenge of Schu4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc12, study 3 (notebook 85, page 6)
i. The purpose was to determine the optimal volume for intranasal delivery of
F. tularensis into rat lungs
ii. Rats were anesthetized with isoflurane and infected with a target dose of 104
CFU in 100, 200, and 400 l. A fourth group was included to determine
whether a 100 l wash would increase the number of LVS delivered into the
lungs with a 200 l inoculum
iii. The number of LVS in the lungs one hour after infection is shown below. 400
l delivered the most consistent, reproducible, and largest number of LVS in
the lung. 200 l delivered fewer LVS into the lung and the efficiency was not
improved noticeably by a 100 l PBS wash (50 l per nostril). 100 l was
most inconsistent and delivered the fewest LVS into the lung; in fact, we
failed to detect LVS in one of the three rats.
iv. A troubling issue is our inability to maintain rats at the proper level of
anesthesia to deliver 400 l inocula
1. Rats anesthetized too deeply with isoflurane (5%) are likely to drown
from the large inoculation volume
2. Rats not anesthetized enough (3.5%) are likely to wake up and blow
out some inoculum.
6 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
v. Conclusion: we must refine isoflurane anesthesia conditions
b. Experiment Ftc12, Study 4 (notebook 85, page 13)
i. The purpose was to refine the isoflurane anesthesia conditions such that
300-400 l inoculum can be delivered intranasally.
ii. We varied:
1. The length of time rats are induced at 5% isoflurane
2. The percent of isoflurane (1-5%) used to maintain anesthesia
3. The oxygen flow rate (1-2 liters per minute)
4. The size of anesthesia box
a. Rat cage bottom (480 x 375 x 210 mm)
b. Mouse cage bottom (365 x 207 x 140 mm)
iii. We could not find conditions that allowed us to deliver 400 l intranasally in a
controlled manner without harming the rats
iv. Conclusion: we must investigate an alternative method of anesthesia that
allows for controlled intranasal inoculation of rats
c.
Experiment Ftc12, study 5 (notebook 85, page 14)
i. The purpose was to determine whether ketamine/xylazine provides better
anesthesia than isoflurane for controlled intranasal inoculation of Fischer 344
rats
ii. The recommended dose for rats is 40-60 mg/kg ketamine and 3-5 mg/kg
xylazine administered by intraperitoneal injection
iii. We found that a dose of 51 mg/kg ketamine and 3.8 mg/kg effectively
induced anesthesia within 5 minutes of i.p. administration and the rats
remained anesthetized for over 30 minutes
iv. Similar to isoflurane, ketamine/xylazine made rats very susceptible to
drowning when a large inoculum is delivered intranasally
v. Conclusion:
1. We will abandon intranasal inoculation in favor of alternative
methods that do not require such a high inoculation volume, such as
microspray aerosolizer or intratracheal instillation
2. We will only use ketamine/xylazine to anesthetize rats
4. Significant decisions made or pending
a. Vicki Pierson approved our request to generate a working LVS stock from DVC’s lot
16 using Cerus’s Chamberlain’s medium formulation.
b. Abandon intranasal inoculation for Fischer 344 rats in favor of alternative methods
such as the Microspray Aerosolizer or intratracheal inoculation
5. Problems or concerns and strategies to address
a. We will standardize the procedure for culturing LVS lot # 16 in Chamberlains media
and freezing LVS because 1) we have more vial-to-vial variability when working with
lyophilized LVS than with SCHU S4 suspended in freezing medium and 2) the low
LVS concentration causes us to deplete our stock faster than anticipated. UNM has
used 65 of the 160 vials of LVS received in January 2006 from DVC.
b. Fischer 344 rats deeply anesthetized with isoflurane or ketamine/xylazine are
susceptible to drowning by large inoculum volumes delivered intranasally. Thus, we
are evaluating microspray aerosolizer and possibly intratracheal inoculation as
alternative methods of pulmonary infection.
c. Lung homogenates produced with Beadbeater becomes viscous and difficult to
pipette accurately. We will try to troubleshoot this problem by adding DNase I to the
buffer, increasing the volume or using an alternative homogenization method
6. Deliverables completed
7 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
None
7. Quality of performance
Good
8. Percentage completed
10%
9. Work plan for upcoming month
a. We will continue to develop Standard Operating Procedures (SOPs) for:
i. Pulmonary delivery of F. tularensis into Fischer 344 rats, focusing primarily
on microspray aerosolizer and secondarily on intratracheal instillation.
ii. Processing rat lungs, spleens, and livers to determine the bacterial load
b. Once the SOP for pulmonary delivery has been established, we will determine the
pulmonary LD50 of SCHU S4. It is possible that Fischer rats are completely resistant
to SCHU S4 and if so, we will abandon this model.
c. We will vaccinate Fischer 344 rats subcutaneously with LVS now so they can recover
from LVS vaccination while we develop the SOP for pulmonary delivery of F.
tularensis. By the time this SOP has been fully developed, the vaccinated rats
should be ready to be challenged with SCHU S4.
d. Mice: Based on the result from Ftc6 A & B and Ftc7 A & B, we will vaccinate BALB/c
and NIH-Swiss mice with LVS so that statistically significant numbers of vaccinated
mice will be available to determine the i.n. LD50 of SCHU 4 in vaccinated mice
e. Prepare working LVS stocks from cultures in Chamberlains media
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 12
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed
Institution: LBERI/UNM
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
 LBERI:Ms. Monier and Wilder continue to meet weekly with the UNM team to discuss the
development of immunoassays. Dr. Wilder ordered reagents to begin comparing various
protocols to purify cynomologous monkey mononuclear cells and test their proliferative
activity. Comparison of the protocols will begin the week of July 10th. Ms. Monier
successfully completed ABSL3 training at LRRI in preparation for working with infected
tissues.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
20% of scientific work has been completed
8 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
9. Work plan for upcoming month
 LBERI: We will begin preparing cynomologous macaque PBMCs using 3 different



protocols and we will compare their purity and their activity in a proliferative assay.
UNM: We will develop standard operating procedures for measuring correlates of
protection
Correlate 1: Antigen-specific T cell proliferation and cytokine production
1. We will determine the best antigen (heat-killed, formaldehyde-fixed, or UVinactivated F. tularensis) for stimulating proliferation and cytokine production by
antigen-specific T cells from vaccinated mice
Correlate 2: Control of F. tularensis growth in murine macrophages
1. We will determine the following using LVS-luciferase provided by Dr. Karl Klose:
1. Is the luciferase construct functional?
2. Can live LVS take up exogenous substrate?
3. Is luciferase activity an indicator of bacterial viability?
4. Is intracellular LVS-luciferase detectable?
5. Can IFN or TNF-induced intracellular killing of LVS-luciferase be
measured?
6. Can T cell-mediated killing be measured?
10. Anticipated travel
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None for this milestone.
Milestone 25
Milestone description: Design protein-fragment library based on SCHU S4 sequence
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
The design of a set of overlapping 600bp open-reading frames (ORFs) spanning all SCHU S4
coding sequences is complete, and a list of PCR primers is in hand. This library of ORFs is
designed for construction into an in vitro translation system and the production of a library of 200
amino acid subprotein (”peptide”) fragments constituting the tularensis proteome. Test ORFs are
under construction.
Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\25\ftu_proteins_segs.xls
4. Significant decisions made or pending
We have implemented a redesign of the ORF library to deliver higher yields and quality sub
protein fragments. The essential feature of the new approach is to move away from PCR-based
synthesis to chemical ORF synthesis. New gene designing codes have been written and new
building protocols are in place. This will not change the scope of the milestone.
We have presented to UNM and NIH our proposal to design and synthesize 500 20-mer peptides
corresponding to F. tularensis protein-epitopes predicted to bind BALB/c MHC I or MHC II
molecules. We have performed MHC I and MHC II analysis using the website
(http://www.immuneepitope.org/home.do). We have used two MHC prediction algorithms to
search the genomic coding sequence for consensus binding motifs. These outputs are being
integrated to identify those epitopes predicted by both algorithms. From this predicted-epitope
9 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
list, those MHCI or MHCII motifs mapping to the same protein will be identified and only the best
scored of these will be selected for the final list. In this way any protein will only be represented
once, but the greatest number of proteins can be sampled. The exception will be TUL4. All 3
previously identified human T cell stimulating peptides within this protein will be included an
addition to a 4th from this protein that will correspond to the best epitope predicted for the BALB/c
haplotype. This final list will be sent out for production and subsequently arrayed into 30
overlapping pools of 50 peptides each. These peptide pools simulate the multiplexing plan for the
full library will be used by the UNM team in pilot studies for their upcoming high throughput,T cell
assays.
MHC Class I binding analysis identified, 2380 peptides with IC50 < 50 (high affinity) representing
397 distinct proteins. MHC Class II binding analyses identified 274 peptides with IC50 < 50. The
results of the MHC class II analysis needs to be further analyzed to identify how many distinct
proteins contain the 274 peptides. We will perform additional analyses to corroborate the first
results before finalizing our top 500 list. In using more than one software program, we will be
identifying candidates predicted by more than one algorithm, and thereby their selection
assuming a higher level confidence. We will be submitting these by 7/12/2006 to Drs Lyons and
Breem, prior to submitting hte peptide order.
Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\26\MHC\ftu_mhc_output.xls
5. Problems or concerns and strategies to address
See 4. No problems have been encountered at this time. Protocols and reagents are being
tested and the strategies have been improved.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
60%
9. Work plan for upcoming month
Perform testing of the new design for production of optimal DNA templates for IVT reactions.
Continue primer design quality control checks. Prepare and order primers for amplification of
fragments. Perform the final selection of the 500 peptides in conjunction with Dr. Lyons and
Breen and order these peptides for synthesis.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
10 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Milestone 26
Milestone description: Confirmation of gene expression (Design HTP SOPs, Test HTP SOPs,
ORF library production, confirm gene expression)
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Utilizing the Invitrogen Expressway E. coli IVT production system, we have successfully produced
IVT proteins for constructs for CPV 100a, CPV110a, CPV030a as shown by SDS page analysis
of IVT products indicating the correct size product is produced. Western blot analyses will be
done as confirmation. Additional kits need to be screened however. With the assistance of Dr.
Lyons, we have identified several proteins for initial production to include the 17 kDa major
membrane protein (J. Immunol 145:311, 1990, AAA24919) and the 23 kDa protein (Infect.
Immun. 65:2183, 1997, Y08861). Interestingly, the 17 kDa protein was epitope mapped with cells
from humans immunized with LVS and several epitopes were identified. (amino acids 66-85, 116135, and 126-149). We are beginning to utilize the analysis tools at the immune epitope website
(http://www.immuneepitope.org/home.do).
Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\26\
We are designing the primers for amplification of these genes for generating the IVT constructs
for these proteins and these should be received by 7/15/2006.
4. Significant decisions made or pending
5. Problems or concerns and strategies to address
Describe
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
30%
9. Work plan for upcoming month
Finalize the design of the next version of the HTP 3’ and 5’ constructs for creating the linear IVT
constructs. Perform additional immune epitope analyses in batch mode. Identify, design, and
build F. tularensis protein fragments with optimized IVT protocol . Send 25 micrograms of IVT
produced protein to Dr. Lyons.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
11 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Milestone 32
Milestone description: Oligos selected for microarray production; Oligos list refined, 70mer
oligos procured, GDP oligos defined, Based on SCHU S4 sequence.
Institution: ASU-Johnston
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
The 70mer oligo set has been designed to cover the SCHU S4 genome
4. Significant decisions made or pending
The original oligo set that was designed utilized the 2002 annotation and confirmation of
alignment of these probes with the 2005 genome show some variances.
Files are stored at R:\GeneVac\FTU\Contract\Microarray\Milestones\32\ FTU_final_oligo.xls
Because of the problems noted in section 5 below, we performed a complete re-design of the
microarray probe set for F. tularensis SCHU4. The probe set has been analyzed and shown that
the majority of the probes are in the last half of the interrogated gene (Table 1) and good
distribution of hybridization Tm’s (Table 2).
# of probes
1st quarter of gene
122
2nd quarter of gene
324
3rd quarter of gene
906
Tm distribution
350
last quarter of gene
452
number of probes
300
250
200
150
100
50
Tm
Table 1. Location of probes
Figure 1. Melting temperature (Tm)
File is located at
R:\GeneVac\FTU\Contract\Microarray\Milestones\32\FTU_Microarray_Probe_Order.xls
The 70mer probes have been ordered and delivery is expected by 07/12/2006.
5. Problems or concerns and strategies to address
The initial design of the GDP’s yielded a very large set of primers (367) that would need to be
ordered to amplify the 99.7% of the genome. This has resulted from the restraints to ensure that
the amplicon is within the probe design. We are evaluating the GDP parameters to attempt
reduce the number of needed primers
12 of 27
99
97
95
93
91
89
87
85
83
81
79
77
75
0
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
60%
9. Work plan for upcoming month
Perform initial prints and test hybridization conditions using RNA and DNA provided by Dr. Lyons.
Finish the GDP primer design and order GDPs and begin testing amplifications for sensitivity and
specificity.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 39
Milestone description: Create uvrA or uvrB mutant F. tularensis subsp. novicida
Institution: UTSA
1. Date started: 4/1/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1 In the last funding period, the uvrB::ermC mutant was constructed, named KKF71, stored in
-70C, and transferred to Cerus Corp. 5/31/2006.
All the data for uvrB strain construction were documented in page 6-10, TVD UTSA notebook
#2.
3.2 To begin the generation of a uvrA::ermC mutant in Ft subsp. novicida:
The primers used for amplifying UvrA Upstream fragment are:
UvrASchu4Up 5’GGAGAATTCTGAAGCTATAGCAGAGGCTCGTGA
UvrASchu4LVSDn ’ACTACTGGGCTGCTTCCTAATGCACAACATACCTTCTTT
GCCCTTCAG
The primers used for amplifying UvrA Downstream fragment are :
UvrASchu4LVSUp1 5’GCTGCTAACAAAGCCCGAAAGGAAGAAGGTGGTAGT
AAAGGAGGGCAG
UvrASchu4Dn1 5’GGAGAATTCCGCCATGCTCAACATCTCAAAGATG
The primers for amplifying FnPErmC are:
pET15bUniUp: 5’ TGCATTAGGAAGCAGCCCAGTAGT
pET15bUniDn: 5’ TTCCTTTCGGGCTTTGTTAGCAGC
The UvrAUpstream and Downstream fragments were amplified, and purified. The whole
fragment was amplified with UvrASchu4Up and UvrASchu4Dn1, and cloned into pGEMT
vector. The plasmid was sequenced, and is correct. The plasmid is designated as pKEK952.
Crytotransformation was performed with pKEK952, but we did not get any colonies.
All the data were documented in page 12-14, TVD UTSA notebook #2
13 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
4
Significant decisions made or pending
5
Problems or concerns and strategies to address
6
Deliverables completed
None
No problems so far.
pKEK951(uvrB::ermC deletion plasmid), KKF71( uvrB::ermC mutant in U112),
pKEK952(uvrA::ermC deletion plasmid).
7
Quality of performance
8
Percentage completed
Excellent progress.
Approximate 60% of scientific work completed on the milestone
9
Work plan for upcoming month
Increasing the concentration of the plasmid, and repeating the cryotransformation.
10 Anticipated travel
None.
11 Upcoming Contract Authorization (COA) for subcontractors
None.
Milestone 40
Milestone description: Phenotyping of Ft novicida mutants; Measure degree of attenuation of
uvr mutants in macrophages and in mice
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Phenotyping of the F. tularensis ssp. novicida U112 uvrB strain from Dr. Karl Klose at UTSA is
ongoing. We previously demonstrated that the uvrB mutant has no detectable growth defect in
Chamberlain’s medium.
1) We infected the J774 murine macrophage cell line with U112 or uvrB and added gentamicin
to the medium to prevent extracellular bacterial growth. We monitored the number of intracellular
bacteria by washing the cells and lysing the macrophage monolayer with hypotonic shock and
plating dilutions of the cell lysate on CHAH plates to determine the number of CFU present in
each well. Both the U112 strain and the uvrB strain were able to infect macrophages and
replicate intracellularly at high and low multiplicities of infection. In both cases the uvrB strain
replicated at the same rate as U112. The data are preliminary and the assay is still being
optimized for F. tularensis, but the similarity of the growth curves is striking and suggests the
deletion of uvrB does not render the bacteria more sensitive to macrophage-mediated killing.
Further optimization of the assay will include measuring the rate of growth inside J774 cells in the
absence of gentamicin (as some groups have performed this assay without antibiotic addition and
shown that replication in the medium is minimal).
14 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
CFU/ml
Intracellular Growth of Ft novicida in J774 Cells
1.E+09
1.E+08
1.E+07
1.E+06
1.E+05
1.E+04
1.E+03
1.E+02
0.0
U112 MOI 33
uvrB MOI 33
U112 MOI 7
uvrB MOI 7
5.0
10.0
15.0
20.0
25.0
30.0
35.0
40.0
Cerus_Ft_Protocol_007
Notebook 920 p. 75
Time (h)
Because of increased emphasis on L VS, alternative freezing conditions were evaluated
using LVS instead of U112 and therefore will be described in Milestone 46.
4. Significant decisions made or pending
We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with
Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of Ft novicida.
5. Problems or concerns and strategies to address
Mutation of uvrB gene does not appear to result in a macrophage growth defect. If this
continues to hold true in animals, this suggests that another attenuating mutation would be
required if the SchuS4 strain were to be used as the vaccine background.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
10%
9. Work plan for upcoming month
Intracellular growth of uvrB mutant will be repeated in J774 cells with and without gentamicin.
Another macrophage cell line (RAW) will be used for intracellular growth. These macrophages
are more bactericidal when activated with LPS or interferon gamma.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 41
Milestone description: Optimization of psoralen treatment and characterization of KBMA F.
novicida; Determine the amount of S-59 and UVA required to inactivate uvr mutants, Determine
extent of metabolic activity of uvr mutants after S-59 and UVA inactivation, Determine the level
of virulence attenuation of KBMA uvr strains in mice
Institution: Cerus
1. Date started: 3/2/06
2. Date completed: pending
15 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
3. Work performed and progress including data and preliminary conclusions
We previously identified the concentration of S-59 required to inactivate uvrB at between 110M. We next wanted to determine the minimum concentration required for complete
inactivation of wild type Ft novicida U112, and more-precisely define the minimum
concentration required for inactivation of uvrB using a range of concentrations between 1
and 10M.
Ft novicida kill curve
(Continuous incubation method)
1.E+10
1.E+08
U112
cfu
1.E+06
uvrB
1.E+04
1.E+02
1.E+00
0
5
10
[S59] uM
15
20
Notebook 934 p. 38
Using Cerus_Ft_protocol_005 protocol for photochemical inactivation (in which the bacteria
are incubated continuously with various concentrations S-59), we found that we were able to
achieve complete inactivation of the uvrB strain at a concentration of 5 M S-59. Whereas
the wild type U112 strain required a concentration of 20 M S59. This demonstrates that the
uvrB mutation results in an increase in sensitivity to S-59 and UVA photochemical
inactivation. At 5 M S-59 there are greater than 3 logs of viable U112 per Ml.
We have begun to characterize the metabolic activity of the inactivated Ft novicida strains
using the Cell Titer 96 assay (Cerus_Ft_protocol_006 is attached). This assay uses the MTS
reagent which is a tetrazolium salt that is reduced to a formazan dye by an enzyme involved
in the electron transport chain, thus the rate of conversion correlates with the number of
organisms and the metabolic capacity of the organisms. The conversion to a formazan
results in a colorimetic change that is detected in real time using a microplate absorbance
reader at 490nm.
5uMS-59 Ftn uvrB
Nominal 1.1E7 cfu/mL
Nominal 1.0E8 cfu/mL
0.40
+UVA Ftn uvrB
0.20
NO UVA Ftn uvrB
0.35
0.15
0.30
OD490
OD490
0.25
0.20
0.10
0.15
0.05
0.10
0.05
0.00
0.00
0.0
1.0
2.0
3.0
Time, hrs
4.0
5.0
6.0
0.0
1.0
2.0
3.0
4.0
5.0
6.0
Time, hrs
16 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Notebook 933 p. 001
The Ft novicida uvrB mutant demonstrated a high degree of metabolic activity when
inactivated with 5 M S-59. The degree of metabolic activity was indistinguishable to the
metabolic activity measured with UVA treatment alone (without psoralen). The organisms
treated with neither UVA nor S-59 appeared to have higher degree of metabolic activity that
was more pronounced when fewer bacteria were included in the assay. In the past we have
found only a nominal reduction in CFU after UVA irradiation in the absence of S-59. This
result suggests that the UVA irradiation alone is altering the metabolic activity of the
organisms.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
We have determined the concentration of S-59 required to inactivate Ft. novicida uvrB is only
one fourth the concentration required to inactive the wild-type U112 strain using the continuous S59 exposure protocol. This difference is less than we have observed for other organisms. It is
still formally possible that the uvrA or the uvrA+uvrB strain will be more sensitive to
photochemical inactivation. The 6.5 J/cm 2 dose of UVA given to inactivate the uvrB strain
results in a decrease in metabolic activity. The UVA dosage will be optimized to the minim M
required to achieve complete inactivation with 5M S-59.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
10% of scientific work completed on the milestone
9. Work plan for upcoming month
We have determined the minimum concentration of S-59 required for complete inactivation of
U112 and uvrB strains (20M and 5M respectively). We will compare the degree of metabolic
activity of the two strains inactivated at the minimum concentration of S-59 that results in
complete inactivation using the MTS assay. During the upcoming month, we will vary the dose of
UVA administered to determine the lowest concentration required to achieve complete
inactivation of uvrB at 5M S-59. We will analyze UVA doses ranging from 2 J/CM2 to 7 J/CM2
we will measure the number of CFU and the level of metabolic activity after photochemical
inactivation using an MTS assay.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
17 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Milestone 43
Milestone description: Create uvrA or uvrB mutants in LVS
Institution: UTSA
1. Date started: 5/01/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1
Kanamycin resistance marker gene was amplified with KanFNdeI and KanRBamHI primers,
cut with NdeI and BamHI, ligated to pKEK888 plasmid backbone treated with NdeI and
BamHI, and electroporated into E.coli. After colony identification with restriction enzyme
digestion, one plasmid has been sequenced and is correct. The plasmid is designated as
pKEK898.
3.2
The Francisella promoter plus kanamycin resistance marker gene(FpKan) was amplified
with pET15bUniUp and pET15bUniDn primers, and gel purified, eluted with water.
3.3
UvrBLVSUpSeq was amplified with UvrBLVSUp and UvrBDn primers; UvrBLVSDnSeq was
amplified with UvrBUp1 and UvrBLVSDn1 primers. Both up and down fragments were
purified on the gel for overlapping PCR.
3.4
Overlapping PCR was attempted with UvrBLVSUp and UvrBLVSDn1 primers with
UvrBLVSUpSeq, FpKan, UvrBLVSDnSeq at the following condition:
10X KOD XL Buffer
dNTP 2mM
UvrBLVSUp 2uM
UvrBLVSDn1 2uM
3.5
5.0 ul
5.0 ul
5.0 ul
We have been unable to obtain the correct construct by this overlapping PCR technique; in
our experience the longer the flanking fragments, the more difficult it is to PCR-amplify. We
are now cloning each fragment individually and sequentially into a plasmid, while
simultaneously attempting variations on the overlap PCR technique.
The NCBI accession number for UvrB gene of LVS is AM233362.1, coordinate number is
733522-738965.
All the data were documented in page 50-54, TVD UTSA notebook #2.
3
Significant decisions made or pending
4
Problems or concerns and strategies to address
None
No major problems so far. Since the overlapping PCR technique hasn’t work so far, we plan to
vary the overlapping PCR conditions and also to try sequential cloning of the fragments to
complete the construct.
5
Deliverables completed
6
Quality of performance
7
Percentage completed
None
Good
18 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Approximate 15% of scientific work completed on the milestone
8
Work plan for upcoming month
8.1 Trying varying conditions to get overlapping PCR to amplify uvrB::Kan with the
fragments amplified above.
8.2 Construct uvrB::Kan by sequential cloning of the fragments amplified above.
9
Anticipated travel
None.
10 Upcoming Contract Authorization (COA) for subcontractors
None.
Milestone 46
Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale
Francisella tularensis culture conditions, Establish 3L culture scale purification conditions,
Optimize 3L scale photochemical inactivation process, Verify protective immunogenicity of
vaccine candidates produced by optimized large-scale process
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
1) The stability of –80o C stocks of LVS has been assessed in two freezing medias. LVS cultures
were grown overnight in Chamberlain’s medium and formulated in either 10% glycerol or 10%
DMSO. Cell viability was determined by CFU on CHAH plates before and 2.5 weeks after
freezing at –80 degrees C.
Viability of LVS After 2.5 Weeks at -80 Degrees C
log 10 CFU
1.E+10
1.E+08
1.E+06
1.E+04
1.E+02
1.E+00
prefreeze
10% glycerol
10% DMSO
Notebook: 937 p.39-42
After 2 ½ weeks in freezer, DMSO stock did not lose significant titer, however, glycerol stock had
lost about 1 log. We will continue to evaluate viability on a monthly basis and will switch to
DMSO as a preservation agent for frozen seed stocks of LVS and Ft novicida.
.
19 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
2) Evaluation of cultivability of frozen stocks of LVS harvested at mid-log vs. stationary phase.
LVS was grown in Chamberlain’s media to stationary phase overnight and frozen in DMSO.
LVS was grown in Chamberlain’s media to mid-log phase (9h) to OD 0.474 and frozen in
DMSO and glycerol. Each of the 3 frozen stocks was inoculated 1:50 into Chamberlain’s
broth and growth was monitored by absorbance at 600nm.
A: LVS mid-log glycerol
B: LVS early-stationary DMSO
C: LVS mid-log DMSO
5h OD
0.020
0.347
0.042
7h OD
0.027
0.596
0.061
ON OD
2.43
4.44
3.24
Notebook: 937 p. 43-48
The mid-log cultures started with about 1 log fewer organisms than the early stationary culture, so
a direct comparison is difficult, however, the mid-log frozen cultures did not grow more rapidly
than the stationary phase frozen cultures, so freezing at mid-log does not appear to provide any
benefit. Stocks formulated with DMSO performed better than those with glycerol, supporting the
use of DMSO as a cryopreservation agent. The titer of each stock will be evaluated after 2 weeks
of at –80o C to determine whether they retain superior viability.
During the June 13 conference call, Rick suggested prioritizing S-59 and UVA inactivation of
LVS to compare with Ft novicida. The suggestion was that perhaps the pronounced capsule
of Ft novicida was acting as a permeability barrier. A preliminary dose-finding kill curve with
LVS was performed using Cerus_Ft_protocol_005 to determine the range of S-59
concentrations required for complete inactivation of LVS. The minimum concentration
required to achieve complete inactivation was 20 uM. This concentration is the same as was
required to inactivate Ft novicida U112 (see Milestone 46). This demonstrates that Ft
novicida and LVS behave in a similar manner and that the data generated with Ft novicida
may be useful in determining the optimal nucleotide excision repair mutation for LVS.
LVS S-59 + UVA Kill Curve
1.E+10
cfu/mL
1.E+08
1.E+06
1.E+04
1.E+02
1.E+00
0
5
10
15
20
[S-59], uM
Notebook 934 p. 46
4. Significant decisions made or pending
We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with
Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of LVS. We have
switched from glycerol to DMSO for cryopreservation of stocks.
5. Problems or concerns and strategies to address
The preliminary experiments performed to date with LVS have not been performed with the DVC
LVS. We are still awaiting our permit from the USDA for import of F. tularensis before we request
20 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
vials from UNM. We have made follow-up calls with the USDA but do not have an estimated date
for the permit. We do not know why the LVS did not grow in the fermentor, we assume at this
point that this was operator error and will repeat the protocol.
6. Deliverables completed
None
7. Quality of performance
good progress
8. Percentage completed
8% of scientific work completed on the milestone
9. Work plan for upcoming month
We will repeat our attempt to cultivate LVS using Chamberlain’s defined medium in the
fermentor. During the cultivation we will monitor the pH, dissolved oxygen concentration, and
optical density of the bacteria and determine the number of colony forming units at various
time points. We will compare the growth characteristics of LVS in Chamberlain’s medium
and the DVC medium. We will repeat photochemical inactivation of LVS using the
Cerus_Ft_protocol_005 to determine the range of S-59 concentrations required for complete
inactivation of LVS; we will focus on concentrations between 10 and 20 uM.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. Cloned the 5´ end of iglC (1504 BP) into KEK900 (already contains 3’ end of iglC); the
construct is named KEK906 (iglC) and was confirmed by PCR and sequencing. Oligo
sets used were iglC schu4 up NotI (i); iglC schu4 down Sal I (ii) as the outside primer set
should yield a product of ≈2900 base pair () size; and delta iglC schu4 up PstI (iii); and
delta schu4 down PstI (iv) as the inner primer set should yield a product of ≈ 1300 bp size
for the correct construct (see figure 1).
i.
5´ -gcg gcg gcg cgg ccg cga aga atc tcc acc aga agc- 3´
ii.
5´ -gcg gcg gtc gac ggg gga tct aca gaa gtt gat ag- 3´
iii.
5´ -gcg ctg cag tat cat ctc act cat aat cat tc- 3´
iv.
5´ -gcg ctg cag tat att gca gct gca tag- 3´
21 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Legend:
1.
2.
3.
4.
1 Kb ladder
KEK906 product with outer primer set
KEK906 product with inner primer set
KEK900 non-specific products with outer primer set
Note: This is a PCR profile generated from the KEK906 construct believed to be correct. In lane 4, these
are non-specific products. Data in TVD UTSA Notebook 3, page 14.
b. The entire IgLC deletion was obtained from KEK906 via PCR with oligos providing the
cloning sites to be used to transfer into the desired mating plasmid KEK903. The
designed oligos were named as follows: iglC schu4 deletion up SphI (i) and iglC schu4
deletion down XmaI (ii)
i.
5´ -gcg gcg gca tgc gaa gaa tct cca cca gaa gc- 3´
ii.
5´ -gcg ccc ggg atc tac aga agt tga tag tgt ac- 3´
c.
The pKEK903 was cut with SphI and EcoRV (blunt site) restriction endonucleases gel
purified and used in a ligation reaction with the entire amplified IgLC deletion (3009 bp)
from KEK906 which has been digested only with SphI and gel purified (see Figure 2).
Legend:
5.
6.
7.
1 Kb ladder
KEK906 product SphI
KEK906 product SphI
Note: This represents the band gel isolated IgLC gene deletion PCR products that were previously cut
with SphI. This was used with one of four ligation reactions with the prepared KEK903 mating vector
(C). Data in TVD UTSA Notebook 3, page 15.
d. Attempted four different ligation reactions with independently generated iglC PCR
product component and the vector KEK903 treated as described in c.; transformed DH5α
cells with the resulting ligations and screened about 100 colonies by restriction digestion
with EcoRI; none of which resulted in the correct construct (see figure 3). The most
22 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
common construct was sent for sequencing and was inconclusive. Data located in TVD
USTA Notebook 3, pages 13-17.
Legend:
8.
9.
10.
11.
1 Kb ladder
KEK903
C7 KEK903 + AIgLC
C20 KEK903 + AIgLC
Note: This profile was recurring we sent these for sequencing to try and figure out what is going
wrong. This represents EcoRI digestion of the cloning vector pKEK903 and the possible correct
constructs clone 7 (C&) and clone 20 (C20). The correct profile should separate 3 bands on the vector
KEK903 and the known ∆ IgLC sequenced deletion (they are ≈7000 bp, ≈2700 bp and ≈800 bp bands).
Data in TVD UTSA Notebook 3, page 17.
e. Ordered gloves, tyvex suits and enzymes for cloning.
4. Significant decisions made or pending
none
5. Problems or concerns and strategies to address
UTSA didn’t find the desired ligated plasmid in the DH5alpha cells. So the strategy is to create
a new plasmid construct with Kan selection and try cryotransformation or electroporation to
generate the IglC deletion.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
9%
9. Work plan for upcoming month
a. Will design oligos to clone the IglC deletion from pKEK906 into a pUC118 vector
(pKEK999) which contains a F. tularensis promoter in front of Kanamycin gene.
b. The pKEK999 will be cut with appropriate endonuclease enzymes along with the
3009 bp PCR product generated from the pKEK906 construct. These will be gel
purified and used in ligation reaction.
c. Once this deletion is in the pKEK999 will try and transform by both
Cryotransformation and electroporation, respectively, to generate the desired
IgLC deletion in Schu4.
d. Order more supplies as needed
10. Anticipated travel
None
23 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS
uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD,
iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA,
iglB strains
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
a. Determine LD50 of Ft subsp. novicida uvrB mutant (Note book #4 page 13-15): LD50 of
uvrB in the intranasal infection model (BALB/c mice) is calculated to be less than 15 CFU
(Fig.1, File name: 0606 uvrB LD50.ppt). The LD50 of the parental strain of Ft novicida has
previously determined to be less than 10 CFU in the same i.n. infection model. The
virulence of uvrB is not significantly reduced.
Fig.1. Survival of mice infected with Ft subsp. novicida uvrB mutant . Groups of BALB/c mice (female,
6-week old) were challenged intra-nasally with 4 doses (15, 60, 270, and 1250 CFU) of uvrB to
determine LD50 of this strain.
b. Monitor uvrB replication and dissemination in mice (Note book #4 page 19-20): Bacterial
burden were determined in the lungs, liver and spleen from uvrB-infected BALB/c mice
(200 CFU, intranasal challenge) 24h-, 48h-, and 72h- post-infection by dilution plating.
The uvrB mutant replicated rapidly in the infection site (a 4 log increase in 24h in lungs)
and quickly disseminated to liver and spleen (Fig.2, file name: 0606 uvrB
Bacteremia.ppt). The replication and dissemination of uvrB in BALB/c mice is comparable
to the parental novicida strain.
24 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
Fig.2. Replication and dissemination of uvrB mutant in mice. BALB/c mice were challenged with 200
CFU of uvrB intranasally. Bacterial burdens in lungs, liver, and spleen were measured at 24h-, 48hand 72h-postinfection.
c.
Measure intramacrophage (J774) survival of uvrB (Note book #4 page 16-18): Murine
macrophage cell line (J774) were seeded in a 96-well plate (105/200 μl/well) overnight
and infected with the uvrB mutant or its parental strain using an inoculum of 10 or 100
MOI (protocol is attached, File name:phagocytosis protocol.doc). Numbers of viable
bacteria in macrophages were measured at 1 hr and 24 hr post-infection. Results
indicated uvrB was able to survive and replicate in macrophages and the growth rate was
comparable to its parental strain (Fig.3, file name: 0606 uvrB Phagocytosis.ppt).
d. Base on the results described above (a-c), the uvrB mutant of Ft novicida is not
attenuated in the murine infection model.
Fig. 3. Intramacrophage survival of uvrB mutant. Murine macrophage cell line (J774) were infected with
the uvrB mutant or its parental strain (F. novicida) using an inoculum of 10 or 100 MOI. Numbers of
viable bacteria in macrophages were measured at 1hr and 24 hrs post infection.
e. Humoral response of mice against LVS infection (Note book #4 page 23-24): Three
C57BL/6 mice were infected intranasally with LVS (1000 CFU), boosted two week later
25 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
and sera were collected 2-week after boost to determine their humoral response to the
bacteria (SOP: assessment of humoral response). Results of ELISA indicated that a high
titer (1:10,000) of anti-LVS specific antibody (Ig) was generated by the boost (Fig.4, file
name: 0606 LVS Ab Titer.ppt). Isotyping analyses of the sera suggested that host
immunity against LVS infection is Th1 dominant (high IgG2a and low IgG1 antibody
production).
Fig. 4. Humoral response to LVS infection. C57BL/6 mice were intranasally challenged with 1000 CFU
of LVS or PBS alone as mock infection (NMS) and re-challenged 2 weeks later. Sera were collected 2week after the re-challenge and used to determine titers of anti-LVS specific antibody.
f.
Respiratory cellular responses: We have performed one set of the flow cytometry
analysis to determine the population of dendritic cells, macrophages, NK cells, B-cells,
CD4+ T cells and CD8+ T cells in the lungs of LVS- or F. novicida- infected mice. We
need to repeat this experiment to obtain a conclusive result.
4. Significant decisions made or pending
Describe
5. Problems or concerns and strategies to address
Describe
6. Deliverables completed
Describe
7. Quality of performance
Excellent
8. Percentage completed
9 % of scientific work completed on the milestone
9. Work plan for upcoming month
a. Contrast and compare cellular infiltration in the respiratory compartment by flow
cytometry after LVS and F. novicida intranasal challenges.
26 of 27
Tularemia Vaccine Development Contract: Technical Report
Period: 6/01/2006 to 6/30/2006
Due Date: 7/15/2006
Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen
Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble,
b. Analyze cytokine (TNF-α, IL-4, IL-12, IFN-γ) production in the lung by ELISA after LVS
and F. novicida intranasal challenges. This would allow us to correlate the cellular
infiltrate results and provide a better understanding of cytokine induction during the early
stages of infection.
10. Anticipated travel
Describe request
11. Upcoming Contract Authorization (COA) for subcontractors
Describe request
27 of 27