Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Contract No. HHSN266200500040-C ADB Contract No. N01-AI-50040 Section I: Purpose and Scope of Effort The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal models and cellular assays vital for testing vaccine efficacy. Sections II and III: Progress and Planning Presented by Milestone Active milestones: 2, 3, Working Group, 5, 12, 25, 26, 32, 39, 40, 41, 43, 46, 49, 50 Completed milestones: 1, 16 Inactive milestones: 4, 6-11, 13-24, 27-31,, 33-38, 42, 44-45, 47-48, 51-54 Milestone 2 Milestone description: Vaccinations performed on relevant personnel Institution: UNM/LRRI 1. Date started: 11/01/1005 2. Date completed: pending 3. Work performed and progress including data and preliminary conclusions NIAID is working on the IAA with USAMRIID and a legal and financial liability review is pending. 4. Significant decisions made or pending a. UNM and NIAID continue to wait for a change in the status of the IAA between NIAID and USAMRIID. b. LBERI has ordered a biobubble as additional protective equipment c. UNM will be discussing with NIAID, the impact of not having human cells from LVS vaccinated individuals which are needed to develop in vitro immunoassays d. UNM EOHS has obtained many of the laboratory documents i. Documents pending 1. Laboratory CAP Certificate 2. Radiology Facility Accreditation Certificate e. UNM EOHS is prepared to send 1 or 2 nurses to USAMRIID to train to read the LVS vaccination sites and to report adverse reactions to USAMRIID i. USAMRIID conveyed that the UNM nurses would have no more risk in evaluating a tularemia skin vaccination site than they have reviewing a PPD test. f. UNM has received copies of USAMRIID’s informed consent document, physician order sheet, and Tularemia vaccination site evaluation document, 5. Problems or concerns and strategies to address When will the NIAID-USAMRIID IAA be completed and when can UNM begin the prehealth screenings? 6. Deliverables completed None 7. None Quality of performance Good 8. Percentage completed 15% 1 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 9. Work plan for upcoming month Ross Kelley will continue to monitor the progress of whether Martin Crumrine's IAA between NIAID and USAMRIID will inform UNM when and whether the TVD Contractors can be vaccinated under this IAA. 10. Anticipated travel Travel could occur in August through November 2006, as soon as the IAA is reached and NIAID approves the travel. 11. Upcoming Contract Authorization (COA) for subcontractors UNM may request a COA to allow 1-2 UNM EOHS nurses to travel to USAMRIID for training on LVS site vaccination evaluations. The timing of the COA request depends on the achievement of the IAA. Milestone 3 Milestone description: Bioaerosol technique selected and optimized Institution: LBERI 1. Date started: 2/23/2006 2. Date completed: in progress 3. Work performed and progress including data and preliminary conclusions Performed stability testing for LVS recovery from bioaerosol samplers Tested recovery from Chamberlain’s, PBS, BHIB, and 1% peptone at up to 4 hrs after spiking at RT and 4°C (see Table 1 below) The four media had similar stability except that the microbial titer in Chamberlain’s appeared to drop over time at RT. PBS, BHIB, and 1% peptone appeared stable at RT and all four had similar stability at 4°C. \\Saturn\ABSL3\ABSL3 Study Data\Tularemia\Tularemia Milestone 3 (Bioaerosol Development) Performed 2 initial bioaerosol sprays Sprayed approx. 1x106 CFU/mL for 10 min No viable LVS recovered in impinger Viable cells were recovered from the spray suspension while no viable cells were recovered from the impingers. Conclusions are that 1) spray vehicle failed to protect the cells, 2) impinger fluid failed to protect the cells, 2) Collison nebulizer killed the cells, 4) the cells which were reconstituted from lyophilized state were susceptible to damage from aerosolization, or 5) a combination of the previous four assumptions. \\Saturn\ABSL3\ABSL3 Study Data\Tularemia\Tularemia Milestone 3 (Bioaerosol Development) 4. Significant decisions made or pending a. None 5. Problems or concerns and strategies to address a. None 6. Deliverables completed a. None 7. Quality of performance a. Good 8. Percentage completed a. 12% 9. Work plan for upcoming month Continue preliminary bioaerosol experiments with reconstituted LVS and Collison generator Plan to quantitate LVS on CHAB 2 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Will test bioaerosol w/ and w/o antifoam Will test different LVS concentrations to determine spray factors Perform bioaerosol experiments on vegetative LVS with Collison generator Repeat of studies performed on reconstituted LVS Plan to grow LVS in CB Plan to quantitate LVS on CHAB Prepare seed and working stock of LVS 10. Anticipated travel a. None anticipated at the present time 11. Upcoming Contract Authorization (COA) for subcontractors a. None anticipated Table 1. Effect of Time and Temp on Recovery of LVS from Various Possible AGI Sampling Media Media Temp Time (Hrs) T=2 T=3 T=4 Chamberlains RT 2.15E+08 1.00E+08 7.00E+07 PBS RT 7.50E+08 3.40E+08 1.01E+09 BHIB RT 9.80E+08 1.50E+09 1.40E+09 1% peptone RT 7.45E+08 1.00E+09 8.15E+08 Chamberlains 4°C 1.75E+08 2.40E+08 3.65E+08 PBS 4°C 1.20E+09 5.75E+08 1.00E+09 BHIB 4°C 5.60E+08 9.10E+08 1.01E+09 1% peptone 4°C 7.70E+08 3.25E+08 4.15E+08 Working Group Milestone description: Determine appropriate solid and liquid media for growth of tularemia for project team Institution: LBERI 1. Date started: 2/23/2006 2. Date completed: in progress 3. Work performed and progress including data and preliminary conclusions(Data found in folder on Saturn server entitled ABSL3/Study Data/Tularemia) a. Prepared growth curves for LVS in Chamberlain’s (see figures below) and MCPHI b. OD curves for MCPHI were flat c. Verified that pH affects Chamberlain’s growth curve 3 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, d. Found better growth at pH 6.2 as indicated by CERUS e. These experiments were performed to provide necessary data to DSTL for their upcoming blue/grey variant tests. OD determinations were ineffective for measuring growth in MCPHI. Cell counts and OD determinations indicate that LVS grown in Chamberlain’s at 37°C with shaking is in log phase growth for at least 48 hrs. Growth is at late log at 72 hrs and in lag phase at 96 hrs. f. \\Saturn\ABSL3\ABSL3 Study Data\Tularemia\Tularemia Milestone 3 (Bioaerosol Development) 4. Significant decisions made or pending a. Chamberlains broth outperformed most other broths tested. We plan to utilize Chamberlain’s broth for future LVS broth studies until a final decision is made on cell phenotype in Chamberlain’s. 5. Problems or concerns and strategies to address a. None 6. Deliverables completed a. None 7. Quality of performance a. Good 8. Percentage completed a. 50% 9. Work plan for upcoming month a. Repeat 48 hr growth curve b. Repeat broth study to obtain appropriate cell counts. The broth growth was greater than anticipated in the initial study and adequate cell counts were not obtained. Appropriate cell counts are needed to assign proper OD values to cell concentrations. 10. Anticipated travel a. None anticipated at the present time 11. Upcoming Contract Authorization (COA) for subcontractors a. None anticipated Chamberlain's 0.450 Each point is the average of 3 values OD(600) 0.400 0.350 0.300 0.250 0.200 0.150 0.100 0.050 0.000 24 48 72 96 Grow th Tim e (Hrs) 4 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 72 Hr Curve Each point is the average of 3 values Each point is the average of 3 values 8.00 Log10 CFU/mL 7.50 7.00 6.50 6.00 5.50 5.00 0.400 0.207 0.107 0.067 0.036 0.011 OD(600) 96 Hr Curve 7.50 Log10 CFU/mL 7.00 6.50 6.00 5.50 5.00 0.402 0.213 0.089 0.044 0.015 OD(600) 5 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Milestone 5 Milestone description: Species tested for sensitivity to LVS & generation of immunity against a pulmonary challenge of Schu4 Institution: UNM 1. Date started: 12/12/2005 2. Date completed: pending 3. Work performed and progress including data and preliminary conclusions a. Experiment Ftc12, study 3 (notebook 85, page 6) i. The purpose was to determine the optimal volume for intranasal delivery of F. tularensis into rat lungs ii. Rats were anesthetized with isoflurane and infected with a target dose of 104 CFU in 100, 200, and 400 l. A fourth group was included to determine whether a 100 l wash would increase the number of LVS delivered into the lungs with a 200 l inoculum iii. The number of LVS in the lungs one hour after infection is shown below. 400 l delivered the most consistent, reproducible, and largest number of LVS in the lung. 200 l delivered fewer LVS into the lung and the efficiency was not improved noticeably by a 100 l PBS wash (50 l per nostril). 100 l was most inconsistent and delivered the fewest LVS into the lung; in fact, we failed to detect LVS in one of the three rats. iv. A troubling issue is our inability to maintain rats at the proper level of anesthesia to deliver 400 l inocula 1. Rats anesthetized too deeply with isoflurane (5%) are likely to drown from the large inoculation volume 2. Rats not anesthetized enough (3.5%) are likely to wake up and blow out some inoculum. 6 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, v. Conclusion: we must refine isoflurane anesthesia conditions b. Experiment Ftc12, Study 4 (notebook 85, page 13) i. The purpose was to refine the isoflurane anesthesia conditions such that 300-400 l inoculum can be delivered intranasally. ii. We varied: 1. The length of time rats are induced at 5% isoflurane 2. The percent of isoflurane (1-5%) used to maintain anesthesia 3. The oxygen flow rate (1-2 liters per minute) 4. The size of anesthesia box a. Rat cage bottom (480 x 375 x 210 mm) b. Mouse cage bottom (365 x 207 x 140 mm) iii. We could not find conditions that allowed us to deliver 400 l intranasally in a controlled manner without harming the rats iv. Conclusion: we must investigate an alternative method of anesthesia that allows for controlled intranasal inoculation of rats c. Experiment Ftc12, study 5 (notebook 85, page 14) i. The purpose was to determine whether ketamine/xylazine provides better anesthesia than isoflurane for controlled intranasal inoculation of Fischer 344 rats ii. The recommended dose for rats is 40-60 mg/kg ketamine and 3-5 mg/kg xylazine administered by intraperitoneal injection iii. We found that a dose of 51 mg/kg ketamine and 3.8 mg/kg effectively induced anesthesia within 5 minutes of i.p. administration and the rats remained anesthetized for over 30 minutes iv. Similar to isoflurane, ketamine/xylazine made rats very susceptible to drowning when a large inoculum is delivered intranasally v. Conclusion: 1. We will abandon intranasal inoculation in favor of alternative methods that do not require such a high inoculation volume, such as microspray aerosolizer or intratracheal instillation 2. We will only use ketamine/xylazine to anesthetize rats 4. Significant decisions made or pending a. Vicki Pierson approved our request to generate a working LVS stock from DVC’s lot 16 using Cerus’s Chamberlain’s medium formulation. b. Abandon intranasal inoculation for Fischer 344 rats in favor of alternative methods such as the Microspray Aerosolizer or intratracheal inoculation 5. Problems or concerns and strategies to address a. We will standardize the procedure for culturing LVS lot # 16 in Chamberlains media and freezing LVS because 1) we have more vial-to-vial variability when working with lyophilized LVS than with SCHU S4 suspended in freezing medium and 2) the low LVS concentration causes us to deplete our stock faster than anticipated. UNM has used 65 of the 160 vials of LVS received in January 2006 from DVC. b. Fischer 344 rats deeply anesthetized with isoflurane or ketamine/xylazine are susceptible to drowning by large inoculum volumes delivered intranasally. Thus, we are evaluating microspray aerosolizer and possibly intratracheal inoculation as alternative methods of pulmonary infection. c. Lung homogenates produced with Beadbeater becomes viscous and difficult to pipette accurately. We will try to troubleshoot this problem by adding DNase I to the buffer, increasing the volume or using an alternative homogenization method 6. Deliverables completed 7 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, None 7. Quality of performance Good 8. Percentage completed 10% 9. Work plan for upcoming month a. We will continue to develop Standard Operating Procedures (SOPs) for: i. Pulmonary delivery of F. tularensis into Fischer 344 rats, focusing primarily on microspray aerosolizer and secondarily on intratracheal instillation. ii. Processing rat lungs, spleens, and livers to determine the bacterial load b. Once the SOP for pulmonary delivery has been established, we will determine the pulmonary LD50 of SCHU S4. It is possible that Fischer rats are completely resistant to SCHU S4 and if so, we will abandon this model. c. We will vaccinate Fischer 344 rats subcutaneously with LVS now so they can recover from LVS vaccination while we develop the SOP for pulmonary delivery of F. tularensis. By the time this SOP has been fully developed, the vaccinated rats should be ready to be challenged with SCHU S4. d. Mice: Based on the result from Ftc6 A & B and Ftc7 A & B, we will vaccinate BALB/c and NIH-Swiss mice with LVS so that statistically significant numbers of vaccinated mice will be available to determine the i.n. LD50 of SCHU 4 in vaccinated mice e. Prepare working LVS stocks from cultures in Chamberlains media 10. Anticipated travel None 11. Upcoming Contract Authorization (COA) for subcontractors None Milestone 12 Milestone description: Assays for detecting relevant immune responses in animals & humans developed Institution: LBERI/UNM 1. Date started: 2/23/2006 2. Date completed: in progress 3. Work performed and progress including data and preliminary conclusions LBERI:Ms. Monier and Wilder continue to meet weekly with the UNM team to discuss the development of immunoassays. Dr. Wilder ordered reagents to begin comparing various protocols to purify cynomologous monkey mononuclear cells and test their proliferative activity. Comparison of the protocols will begin the week of July 10th. Ms. Monier successfully completed ABSL3 training at LRRI in preparation for working with infected tissues. 4. Significant decisions made or pending None 5. Problems or concerns and strategies to address None 6. Deliverables completed None 7. Quality of performance Good 8. Percentage completed 20% of scientific work has been completed 8 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 9. Work plan for upcoming month LBERI: We will begin preparing cynomologous macaque PBMCs using 3 different protocols and we will compare their purity and their activity in a proliferative assay. UNM: We will develop standard operating procedures for measuring correlates of protection Correlate 1: Antigen-specific T cell proliferation and cytokine production 1. We will determine the best antigen (heat-killed, formaldehyde-fixed, or UVinactivated F. tularensis) for stimulating proliferation and cytokine production by antigen-specific T cells from vaccinated mice Correlate 2: Control of F. tularensis growth in murine macrophages 1. We will determine the following using LVS-luciferase provided by Dr. Karl Klose: 1. Is the luciferase construct functional? 2. Can live LVS take up exogenous substrate? 3. Is luciferase activity an indicator of bacterial viability? 4. Is intracellular LVS-luciferase detectable? 5. Can IFN or TNF-induced intracellular killing of LVS-luciferase be measured? 6. Can T cell-mediated killing be measured? 10. Anticipated travel None anticipated at the present time 11. Upcoming Contract Authorization (COA) for subcontractors None for this milestone. Milestone 25 Milestone description: Design protein-fragment library based on SCHU S4 sequence Institution: ASU-Sykes 1. Date started: 3/02/2006 2. Date completed: Pending 3. Work performed and progress including data and preliminary conclusions The design of a set of overlapping 600bp open-reading frames (ORFs) spanning all SCHU S4 coding sequences is complete, and a list of PCR primers is in hand. This library of ORFs is designed for construction into an in vitro translation system and the production of a library of 200 amino acid subprotein (”peptide”) fragments constituting the tularensis proteome. Test ORFs are under construction. Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\25\ftu_proteins_segs.xls 4. Significant decisions made or pending We have implemented a redesign of the ORF library to deliver higher yields and quality sub protein fragments. The essential feature of the new approach is to move away from PCR-based synthesis to chemical ORF synthesis. New gene designing codes have been written and new building protocols are in place. This will not change the scope of the milestone. We have presented to UNM and NIH our proposal to design and synthesize 500 20-mer peptides corresponding to F. tularensis protein-epitopes predicted to bind BALB/c MHC I or MHC II molecules. We have performed MHC I and MHC II analysis using the website (http://www.immuneepitope.org/home.do). We have used two MHC prediction algorithms to search the genomic coding sequence for consensus binding motifs. These outputs are being integrated to identify those epitopes predicted by both algorithms. From this predicted-epitope 9 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, list, those MHCI or MHCII motifs mapping to the same protein will be identified and only the best scored of these will be selected for the final list. In this way any protein will only be represented once, but the greatest number of proteins can be sampled. The exception will be TUL4. All 3 previously identified human T cell stimulating peptides within this protein will be included an addition to a 4th from this protein that will correspond to the best epitope predicted for the BALB/c haplotype. This final list will be sent out for production and subsequently arrayed into 30 overlapping pools of 50 peptides each. These peptide pools simulate the multiplexing plan for the full library will be used by the UNM team in pilot studies for their upcoming high throughput,T cell assays. MHC Class I binding analysis identified, 2380 peptides with IC50 < 50 (high affinity) representing 397 distinct proteins. MHC Class II binding analyses identified 274 peptides with IC50 < 50. The results of the MHC class II analysis needs to be further analyzed to identify how many distinct proteins contain the 274 peptides. We will perform additional analyses to corroborate the first results before finalizing our top 500 list. In using more than one software program, we will be identifying candidates predicted by more than one algorithm, and thereby their selection assuming a higher level confidence. We will be submitting these by 7/12/2006 to Drs Lyons and Breem, prior to submitting hte peptide order. Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\26\MHC\ftu_mhc_output.xls 5. Problems or concerns and strategies to address See 4. No problems have been encountered at this time. Protocols and reagents are being tested and the strategies have been improved. 6. Deliverables completed None 7. Quality of performance Good 8. Percentage completed 60% 9. Work plan for upcoming month Perform testing of the new design for production of optimal DNA templates for IVT reactions. Continue primer design quality control checks. Prepare and order primers for amplification of fragments. Perform the final selection of the 500 peptides in conjunction with Dr. Lyons and Breen and order these peptides for synthesis. 10. Anticipated travel None 11. Upcoming Contract Authorization (COA) for subcontractors None 10 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Milestone 26 Milestone description: Confirmation of gene expression (Design HTP SOPs, Test HTP SOPs, ORF library production, confirm gene expression) Institution: ASU-Sykes 1. Date started: 3/02/2006 2. Date completed: Pending 3. Work performed and progress including data and preliminary conclusions Utilizing the Invitrogen Expressway E. coli IVT production system, we have successfully produced IVT proteins for constructs for CPV 100a, CPV110a, CPV030a as shown by SDS page analysis of IVT products indicating the correct size product is produced. Western blot analyses will be done as confirmation. Additional kits need to be screened however. With the assistance of Dr. Lyons, we have identified several proteins for initial production to include the 17 kDa major membrane protein (J. Immunol 145:311, 1990, AAA24919) and the 23 kDa protein (Infect. Immun. 65:2183, 1997, Y08861). Interestingly, the 17 kDa protein was epitope mapped with cells from humans immunized with LVS and several epitopes were identified. (amino acids 66-85, 116135, and 126-149). We are beginning to utilize the analysis tools at the immune epitope website (http://www.immuneepitope.org/home.do). Files are stored at R:\GeneVac\FTU\Contract\Proteome\Milestones\26\ We are designing the primers for amplification of these genes for generating the IVT constructs for these proteins and these should be received by 7/15/2006. 4. Significant decisions made or pending 5. Problems or concerns and strategies to address Describe 6. Deliverables completed None. 7. Quality of performance Good 8. Percentage completed 30% 9. Work plan for upcoming month Finalize the design of the next version of the HTP 3’ and 5’ constructs for creating the linear IVT constructs. Perform additional immune epitope analyses in batch mode. Identify, design, and build F. tularensis protein fragments with optimized IVT protocol . Send 25 micrograms of IVT produced protein to Dr. Lyons. 10. Anticipated travel None 11. Upcoming Contract Authorization (COA) for subcontractors None 11 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Milestone 32 Milestone description: Oligos selected for microarray production; Oligos list refined, 70mer oligos procured, GDP oligos defined, Based on SCHU S4 sequence. Institution: ASU-Johnston 1. Date started: 3/02/2006 2. Date completed: Pending 3. Work performed and progress including data and preliminary conclusions The 70mer oligo set has been designed to cover the SCHU S4 genome 4. Significant decisions made or pending The original oligo set that was designed utilized the 2002 annotation and confirmation of alignment of these probes with the 2005 genome show some variances. Files are stored at R:\GeneVac\FTU\Contract\Microarray\Milestones\32\ FTU_final_oligo.xls Because of the problems noted in section 5 below, we performed a complete re-design of the microarray probe set for F. tularensis SCHU4. The probe set has been analyzed and shown that the majority of the probes are in the last half of the interrogated gene (Table 1) and good distribution of hybridization Tm’s (Table 2). # of probes 1st quarter of gene 122 2nd quarter of gene 324 3rd quarter of gene 906 Tm distribution 350 last quarter of gene 452 number of probes 300 250 200 150 100 50 Tm Table 1. Location of probes Figure 1. Melting temperature (Tm) File is located at R:\GeneVac\FTU\Contract\Microarray\Milestones\32\FTU_Microarray_Probe_Order.xls The 70mer probes have been ordered and delivery is expected by 07/12/2006. 5. Problems or concerns and strategies to address The initial design of the GDP’s yielded a very large set of primers (367) that would need to be ordered to amplify the 99.7% of the genome. This has resulted from the restraints to ensure that the amplicon is within the probe design. We are evaluating the GDP parameters to attempt reduce the number of needed primers 12 of 27 99 97 95 93 91 89 87 85 83 81 79 77 75 0 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 6. Deliverables completed None. 7. Quality of performance Good 8. Percentage completed 60% 9. Work plan for upcoming month Perform initial prints and test hybridization conditions using RNA and DNA provided by Dr. Lyons. Finish the GDP primer design and order GDPs and begin testing amplifications for sensitivity and specificity. 10. Anticipated travel None 11. Upcoming Contract Authorization (COA) for subcontractors None Milestone 39 Milestone description: Create uvrA or uvrB mutant F. tularensis subsp. novicida Institution: UTSA 1. Date started: 4/1/2006 2. Date completed: In progress 3. Work performed and progress including data and preliminary conclusions 3.1 In the last funding period, the uvrB::ermC mutant was constructed, named KKF71, stored in -70C, and transferred to Cerus Corp. 5/31/2006. All the data for uvrB strain construction were documented in page 6-10, TVD UTSA notebook #2. 3.2 To begin the generation of a uvrA::ermC mutant in Ft subsp. novicida: The primers used for amplifying UvrA Upstream fragment are: UvrASchu4Up 5’GGAGAATTCTGAAGCTATAGCAGAGGCTCGTGA UvrASchu4LVSDn ’ACTACTGGGCTGCTTCCTAATGCACAACATACCTTCTTT GCCCTTCAG The primers used for amplifying UvrA Downstream fragment are : UvrASchu4LVSUp1 5’GCTGCTAACAAAGCCCGAAAGGAAGAAGGTGGTAGT AAAGGAGGGCAG UvrASchu4Dn1 5’GGAGAATTCCGCCATGCTCAACATCTCAAAGATG The primers for amplifying FnPErmC are: pET15bUniUp: 5’ TGCATTAGGAAGCAGCCCAGTAGT pET15bUniDn: 5’ TTCCTTTCGGGCTTTGTTAGCAGC The UvrAUpstream and Downstream fragments were amplified, and purified. The whole fragment was amplified with UvrASchu4Up and UvrASchu4Dn1, and cloned into pGEMT vector. The plasmid was sequenced, and is correct. The plasmid is designated as pKEK952. Crytotransformation was performed with pKEK952, but we did not get any colonies. All the data were documented in page 12-14, TVD UTSA notebook #2 13 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 4 Significant decisions made or pending 5 Problems or concerns and strategies to address 6 Deliverables completed None No problems so far. pKEK951(uvrB::ermC deletion plasmid), KKF71( uvrB::ermC mutant in U112), pKEK952(uvrA::ermC deletion plasmid). 7 Quality of performance 8 Percentage completed Excellent progress. Approximate 60% of scientific work completed on the milestone 9 Work plan for upcoming month Increasing the concentration of the plasmid, and repeating the cryotransformation. 10 Anticipated travel None. 11 Upcoming Contract Authorization (COA) for subcontractors None. Milestone 40 Milestone description: Phenotyping of Ft novicida mutants; Measure degree of attenuation of uvr mutants in macrophages and in mice Institution: Cerus 1. Date started: 3/2/2006 2. Date completed: pending 3. Work performed and progress including data and preliminary conclusions Phenotyping of the F. tularensis ssp. novicida U112 uvrB strain from Dr. Karl Klose at UTSA is ongoing. We previously demonstrated that the uvrB mutant has no detectable growth defect in Chamberlain’s medium. 1) We infected the J774 murine macrophage cell line with U112 or uvrB and added gentamicin to the medium to prevent extracellular bacterial growth. We monitored the number of intracellular bacteria by washing the cells and lysing the macrophage monolayer with hypotonic shock and plating dilutions of the cell lysate on CHAH plates to determine the number of CFU present in each well. Both the U112 strain and the uvrB strain were able to infect macrophages and replicate intracellularly at high and low multiplicities of infection. In both cases the uvrB strain replicated at the same rate as U112. The data are preliminary and the assay is still being optimized for F. tularensis, but the similarity of the growth curves is striking and suggests the deletion of uvrB does not render the bacteria more sensitive to macrophage-mediated killing. Further optimization of the assay will include measuring the rate of growth inside J774 cells in the absence of gentamicin (as some groups have performed this assay without antibiotic addition and shown that replication in the medium is minimal). 14 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, CFU/ml Intracellular Growth of Ft novicida in J774 Cells 1.E+09 1.E+08 1.E+07 1.E+06 1.E+05 1.E+04 1.E+03 1.E+02 0.0 U112 MOI 33 uvrB MOI 33 U112 MOI 7 uvrB MOI 7 5.0 10.0 15.0 20.0 25.0 30.0 35.0 40.0 Cerus_Ft_Protocol_007 Notebook 920 p. 75 Time (h) Because of increased emphasis on L VS, alternative freezing conditions were evaluated using LVS instead of U112 and therefore will be described in Milestone 46. 4. Significant decisions made or pending We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of Ft novicida. 5. Problems or concerns and strategies to address Mutation of uvrB gene does not appear to result in a macrophage growth defect. If this continues to hold true in animals, this suggests that another attenuating mutation would be required if the SchuS4 strain were to be used as the vaccine background. 6. Deliverables completed None 7. Quality of performance Good progress 8. Percentage completed 10% 9. Work plan for upcoming month Intracellular growth of uvrB mutant will be repeated in J774 cells with and without gentamicin. Another macrophage cell line (RAW) will be used for intracellular growth. These macrophages are more bactericidal when activated with LPS or interferon gamma. 10. Anticipated travel None 11. Upcoming Contract Authorization (COA) for subcontractors None Milestone 41 Milestone description: Optimization of psoralen treatment and characterization of KBMA F. novicida; Determine the amount of S-59 and UVA required to inactivate uvr mutants, Determine extent of metabolic activity of uvr mutants after S-59 and UVA inactivation, Determine the level of virulence attenuation of KBMA uvr strains in mice Institution: Cerus 1. Date started: 3/2/06 2. Date completed: pending 15 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 3. Work performed and progress including data and preliminary conclusions We previously identified the concentration of S-59 required to inactivate uvrB at between 110M. We next wanted to determine the minimum concentration required for complete inactivation of wild type Ft novicida U112, and more-precisely define the minimum concentration required for inactivation of uvrB using a range of concentrations between 1 and 10M. Ft novicida kill curve (Continuous incubation method) 1.E+10 1.E+08 U112 cfu 1.E+06 uvrB 1.E+04 1.E+02 1.E+00 0 5 10 [S59] uM 15 20 Notebook 934 p. 38 Using Cerus_Ft_protocol_005 protocol for photochemical inactivation (in which the bacteria are incubated continuously with various concentrations S-59), we found that we were able to achieve complete inactivation of the uvrB strain at a concentration of 5 M S-59. Whereas the wild type U112 strain required a concentration of 20 M S59. This demonstrates that the uvrB mutation results in an increase in sensitivity to S-59 and UVA photochemical inactivation. At 5 M S-59 there are greater than 3 logs of viable U112 per Ml. We have begun to characterize the metabolic activity of the inactivated Ft novicida strains using the Cell Titer 96 assay (Cerus_Ft_protocol_006 is attached). This assay uses the MTS reagent which is a tetrazolium salt that is reduced to a formazan dye by an enzyme involved in the electron transport chain, thus the rate of conversion correlates with the number of organisms and the metabolic capacity of the organisms. The conversion to a formazan results in a colorimetic change that is detected in real time using a microplate absorbance reader at 490nm. 5uMS-59 Ftn uvrB Nominal 1.1E7 cfu/mL Nominal 1.0E8 cfu/mL 0.40 +UVA Ftn uvrB 0.20 NO UVA Ftn uvrB 0.35 0.15 0.30 OD490 OD490 0.25 0.20 0.10 0.15 0.05 0.10 0.05 0.00 0.00 0.0 1.0 2.0 3.0 Time, hrs 4.0 5.0 6.0 0.0 1.0 2.0 3.0 4.0 5.0 6.0 Time, hrs 16 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Notebook 933 p. 001 The Ft novicida uvrB mutant demonstrated a high degree of metabolic activity when inactivated with 5 M S-59. The degree of metabolic activity was indistinguishable to the metabolic activity measured with UVA treatment alone (without psoralen). The organisms treated with neither UVA nor S-59 appeared to have higher degree of metabolic activity that was more pronounced when fewer bacteria were included in the assay. In the past we have found only a nominal reduction in CFU after UVA irradiation in the absence of S-59. This result suggests that the UVA irradiation alone is altering the metabolic activity of the organisms. 4. Significant decisions made or pending None 5. Problems or concerns and strategies to address We have determined the concentration of S-59 required to inactivate Ft. novicida uvrB is only one fourth the concentration required to inactive the wild-type U112 strain using the continuous S59 exposure protocol. This difference is less than we have observed for other organisms. It is still formally possible that the uvrA or the uvrA+uvrB strain will be more sensitive to photochemical inactivation. The 6.5 J/cm 2 dose of UVA given to inactivate the uvrB strain results in a decrease in metabolic activity. The UVA dosage will be optimized to the minim M required to achieve complete inactivation with 5M S-59. 6. Deliverables completed None 7. Quality of performance Good progress 8. Percentage completed 10% of scientific work completed on the milestone 9. Work plan for upcoming month We have determined the minimum concentration of S-59 required for complete inactivation of U112 and uvrB strains (20M and 5M respectively). We will compare the degree of metabolic activity of the two strains inactivated at the minimum concentration of S-59 that results in complete inactivation using the MTS assay. During the upcoming month, we will vary the dose of UVA administered to determine the lowest concentration required to achieve complete inactivation of uvrB at 5M S-59. We will analyze UVA doses ranging from 2 J/CM2 to 7 J/CM2 we will measure the number of CFU and the level of metabolic activity after photochemical inactivation using an MTS assay. 10. Anticipated travel None 11. Upcoming Contract Authorization (COA) for subcontractors None 17 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Milestone 43 Milestone description: Create uvrA or uvrB mutants in LVS Institution: UTSA 1. Date started: 5/01/2006 2. Date completed: In progress 3. Work performed and progress including data and preliminary conclusions 3.1 Kanamycin resistance marker gene was amplified with KanFNdeI and KanRBamHI primers, cut with NdeI and BamHI, ligated to pKEK888 plasmid backbone treated with NdeI and BamHI, and electroporated into E.coli. After colony identification with restriction enzyme digestion, one plasmid has been sequenced and is correct. The plasmid is designated as pKEK898. 3.2 The Francisella promoter plus kanamycin resistance marker gene(FpKan) was amplified with pET15bUniUp and pET15bUniDn primers, and gel purified, eluted with water. 3.3 UvrBLVSUpSeq was amplified with UvrBLVSUp and UvrBDn primers; UvrBLVSDnSeq was amplified with UvrBUp1 and UvrBLVSDn1 primers. Both up and down fragments were purified on the gel for overlapping PCR. 3.4 Overlapping PCR was attempted with UvrBLVSUp and UvrBLVSDn1 primers with UvrBLVSUpSeq, FpKan, UvrBLVSDnSeq at the following condition: 10X KOD XL Buffer dNTP 2mM UvrBLVSUp 2uM UvrBLVSDn1 2uM 3.5 5.0 ul 5.0 ul 5.0 ul We have been unable to obtain the correct construct by this overlapping PCR technique; in our experience the longer the flanking fragments, the more difficult it is to PCR-amplify. We are now cloning each fragment individually and sequentially into a plasmid, while simultaneously attempting variations on the overlap PCR technique. The NCBI accession number for UvrB gene of LVS is AM233362.1, coordinate number is 733522-738965. All the data were documented in page 50-54, TVD UTSA notebook #2. 3 Significant decisions made or pending 4 Problems or concerns and strategies to address None No major problems so far. Since the overlapping PCR technique hasn’t work so far, we plan to vary the overlapping PCR conditions and also to try sequential cloning of the fragments to complete the construct. 5 Deliverables completed 6 Quality of performance 7 Percentage completed None Good 18 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Approximate 15% of scientific work completed on the milestone 8 Work plan for upcoming month 8.1 Trying varying conditions to get overlapping PCR to amplify uvrB::Kan with the fragments amplified above. 8.2 Construct uvrB::Kan by sequential cloning of the fragments amplified above. 9 Anticipated travel None. 10 Upcoming Contract Authorization (COA) for subcontractors None. Milestone 46 Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale Francisella tularensis culture conditions, Establish 3L culture scale purification conditions, Optimize 3L scale photochemical inactivation process, Verify protective immunogenicity of vaccine candidates produced by optimized large-scale process Institution: Cerus 1. Date started: 3/2/2006 2. Date completed: pending 3. Work performed and progress including data and preliminary conclusions 1) The stability of –80o C stocks of LVS has been assessed in two freezing medias. LVS cultures were grown overnight in Chamberlain’s medium and formulated in either 10% glycerol or 10% DMSO. Cell viability was determined by CFU on CHAH plates before and 2.5 weeks after freezing at –80 degrees C. Viability of LVS After 2.5 Weeks at -80 Degrees C log 10 CFU 1.E+10 1.E+08 1.E+06 1.E+04 1.E+02 1.E+00 prefreeze 10% glycerol 10% DMSO Notebook: 937 p.39-42 After 2 ½ weeks in freezer, DMSO stock did not lose significant titer, however, glycerol stock had lost about 1 log. We will continue to evaluate viability on a monthly basis and will switch to DMSO as a preservation agent for frozen seed stocks of LVS and Ft novicida. . 19 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 2) Evaluation of cultivability of frozen stocks of LVS harvested at mid-log vs. stationary phase. LVS was grown in Chamberlain’s media to stationary phase overnight and frozen in DMSO. LVS was grown in Chamberlain’s media to mid-log phase (9h) to OD 0.474 and frozen in DMSO and glycerol. Each of the 3 frozen stocks was inoculated 1:50 into Chamberlain’s broth and growth was monitored by absorbance at 600nm. A: LVS mid-log glycerol B: LVS early-stationary DMSO C: LVS mid-log DMSO 5h OD 0.020 0.347 0.042 7h OD 0.027 0.596 0.061 ON OD 2.43 4.44 3.24 Notebook: 937 p. 43-48 The mid-log cultures started with about 1 log fewer organisms than the early stationary culture, so a direct comparison is difficult, however, the mid-log frozen cultures did not grow more rapidly than the stationary phase frozen cultures, so freezing at mid-log does not appear to provide any benefit. Stocks formulated with DMSO performed better than those with glycerol, supporting the use of DMSO as a cryopreservation agent. The titer of each stock will be evaluated after 2 weeks of at –80o C to determine whether they retain superior viability. During the June 13 conference call, Rick suggested prioritizing S-59 and UVA inactivation of LVS to compare with Ft novicida. The suggestion was that perhaps the pronounced capsule of Ft novicida was acting as a permeability barrier. A preliminary dose-finding kill curve with LVS was performed using Cerus_Ft_protocol_005 to determine the range of S-59 concentrations required for complete inactivation of LVS. The minimum concentration required to achieve complete inactivation was 20 uM. This concentration is the same as was required to inactivate Ft novicida U112 (see Milestone 46). This demonstrates that Ft novicida and LVS behave in a similar manner and that the data generated with Ft novicida may be useful in determining the optimal nucleotide excision repair mutation for LVS. LVS S-59 + UVA Kill Curve 1.E+10 cfu/mL 1.E+08 1.E+06 1.E+04 1.E+02 1.E+00 0 5 10 15 20 [S-59], uM Notebook 934 p. 46 4. Significant decisions made or pending We have selected Chamberlain’s Defined Medium (CDM) and Cystine Heart Agar with Hemoglobin (CHAH) as liquid and plate medias for cultivation and enumeration of LVS. We have switched from glycerol to DMSO for cryopreservation of stocks. 5. Problems or concerns and strategies to address The preliminary experiments performed to date with LVS have not been performed with the DVC LVS. We are still awaiting our permit from the USDA for import of F. tularensis before we request 20 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, vials from UNM. We have made follow-up calls with the USDA but do not have an estimated date for the permit. We do not know why the LVS did not grow in the fermentor, we assume at this point that this was operator error and will repeat the protocol. 6. Deliverables completed None 7. Quality of performance good progress 8. Percentage completed 8% of scientific work completed on the milestone 9. Work plan for upcoming month We will repeat our attempt to cultivate LVS using Chamberlain’s defined medium in the fermentor. During the cultivation we will monitor the pH, dissolved oxygen concentration, and optical density of the bacteria and determine the number of colony forming units at various time points. We will compare the growth characteristics of LVS in Chamberlain’s medium and the DVC medium. We will repeat photochemical inactivation of LVS using the Cerus_Ft_protocol_005 to determine the range of S-59 concentrations required for complete inactivation of LVS; we will focus on concentrations between 10 and 20 uM. 10. Anticipated travel None 11. Upcoming Contract Authorization (COA) for subcontractors None Milestone 49 Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4) (iglC, pdpD, iglD, iglA, iglB) 49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4) 49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis subsp. tularensis (SCHU S4) 49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis subsp. tularensis (SCHU S4) Institution: UTSA 1. Date started: April 1, 2006 2. Date completed: in progress 3. Work performed and progress including data and preliminary conclusions a. Cloned the 5´ end of iglC (1504 BP) into KEK900 (already contains 3’ end of iglC); the construct is named KEK906 (iglC) and was confirmed by PCR and sequencing. Oligo sets used were iglC schu4 up NotI (i); iglC schu4 down Sal I (ii) as the outside primer set should yield a product of ≈2900 base pair () size; and delta iglC schu4 up PstI (iii); and delta schu4 down PstI (iv) as the inner primer set should yield a product of ≈ 1300 bp size for the correct construct (see figure 1). i. 5´ -gcg gcg gcg cgg ccg cga aga atc tcc acc aga agc- 3´ ii. 5´ -gcg gcg gtc gac ggg gga tct aca gaa gtt gat ag- 3´ iii. 5´ -gcg ctg cag tat cat ctc act cat aat cat tc- 3´ iv. 5´ -gcg ctg cag tat att gca gct gca tag- 3´ 21 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Legend: 1. 2. 3. 4. 1 Kb ladder KEK906 product with outer primer set KEK906 product with inner primer set KEK900 non-specific products with outer primer set Note: This is a PCR profile generated from the KEK906 construct believed to be correct. In lane 4, these are non-specific products. Data in TVD UTSA Notebook 3, page 14. b. The entire IgLC deletion was obtained from KEK906 via PCR with oligos providing the cloning sites to be used to transfer into the desired mating plasmid KEK903. The designed oligos were named as follows: iglC schu4 deletion up SphI (i) and iglC schu4 deletion down XmaI (ii) i. 5´ -gcg gcg gca tgc gaa gaa tct cca cca gaa gc- 3´ ii. 5´ -gcg ccc ggg atc tac aga agt tga tag tgt ac- 3´ c. The pKEK903 was cut with SphI and EcoRV (blunt site) restriction endonucleases gel purified and used in a ligation reaction with the entire amplified IgLC deletion (3009 bp) from KEK906 which has been digested only with SphI and gel purified (see Figure 2). Legend: 5. 6. 7. 1 Kb ladder KEK906 product SphI KEK906 product SphI Note: This represents the band gel isolated IgLC gene deletion PCR products that were previously cut with SphI. This was used with one of four ligation reactions with the prepared KEK903 mating vector (C). Data in TVD UTSA Notebook 3, page 15. d. Attempted four different ligation reactions with independently generated iglC PCR product component and the vector KEK903 treated as described in c.; transformed DH5α cells with the resulting ligations and screened about 100 colonies by restriction digestion with EcoRI; none of which resulted in the correct construct (see figure 3). The most 22 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, common construct was sent for sequencing and was inconclusive. Data located in TVD USTA Notebook 3, pages 13-17. Legend: 8. 9. 10. 11. 1 Kb ladder KEK903 C7 KEK903 + AIgLC C20 KEK903 + AIgLC Note: This profile was recurring we sent these for sequencing to try and figure out what is going wrong. This represents EcoRI digestion of the cloning vector pKEK903 and the possible correct constructs clone 7 (C&) and clone 20 (C20). The correct profile should separate 3 bands on the vector KEK903 and the known ∆ IgLC sequenced deletion (they are ≈7000 bp, ≈2700 bp and ≈800 bp bands). Data in TVD UTSA Notebook 3, page 17. e. Ordered gloves, tyvex suits and enzymes for cloning. 4. Significant decisions made or pending none 5. Problems or concerns and strategies to address UTSA didn’t find the desired ligated plasmid in the DH5alpha cells. So the strategy is to create a new plasmid construct with Kan selection and try cryotransformation or electroporation to generate the IglC deletion. 6. Deliverables completed None 7. Quality of performance Good 8. Percentage completed 9% 9. Work plan for upcoming month a. Will design oligos to clone the IglC deletion from pKEK906 into a pUC118 vector (pKEK999) which contains a F. tularensis promoter in front of Kanamycin gene. b. The pKEK999 will be cut with appropriate endonuclease enzymes along with the 3009 bp PCR product generated from the pKEK906 construct. These will be gel purified and used in ligation reaction. c. Once this deletion is in the pKEK999 will try and transform by both Cryotransformation and electroporation, respectively, to generate the desired IgLC deletion in Schu4. d. Order more supplies as needed 10. Anticipated travel None 23 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, 11. Upcoming Contract Authorization (COA) for subcontractors None Milestone 50 Milestone description: Phenotyping and confirmation of single gene mutants; 50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains, 50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD, iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains, 50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA, iglB strains Institution: UTSA 1. Date started: 04/01/2006 2. Date completed: provide date when milestone is completed 3. Work performed and progress including data and preliminary conclusions a. Determine LD50 of Ft subsp. novicida uvrB mutant (Note book #4 page 13-15): LD50 of uvrB in the intranasal infection model (BALB/c mice) is calculated to be less than 15 CFU (Fig.1, File name: 0606 uvrB LD50.ppt). The LD50 of the parental strain of Ft novicida has previously determined to be less than 10 CFU in the same i.n. infection model. The virulence of uvrB is not significantly reduced. Fig.1. Survival of mice infected with Ft subsp. novicida uvrB mutant . Groups of BALB/c mice (female, 6-week old) were challenged intra-nasally with 4 doses (15, 60, 270, and 1250 CFU) of uvrB to determine LD50 of this strain. b. Monitor uvrB replication and dissemination in mice (Note book #4 page 19-20): Bacterial burden were determined in the lungs, liver and spleen from uvrB-infected BALB/c mice (200 CFU, intranasal challenge) 24h-, 48h-, and 72h- post-infection by dilution plating. The uvrB mutant replicated rapidly in the infection site (a 4 log increase in 24h in lungs) and quickly disseminated to liver and spleen (Fig.2, file name: 0606 uvrB Bacteremia.ppt). The replication and dissemination of uvrB in BALB/c mice is comparable to the parental novicida strain. 24 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, Fig.2. Replication and dissemination of uvrB mutant in mice. BALB/c mice were challenged with 200 CFU of uvrB intranasally. Bacterial burdens in lungs, liver, and spleen were measured at 24h-, 48hand 72h-postinfection. c. Measure intramacrophage (J774) survival of uvrB (Note book #4 page 16-18): Murine macrophage cell line (J774) were seeded in a 96-well plate (105/200 μl/well) overnight and infected with the uvrB mutant or its parental strain using an inoculum of 10 or 100 MOI (protocol is attached, File name:phagocytosis protocol.doc). Numbers of viable bacteria in macrophages were measured at 1 hr and 24 hr post-infection. Results indicated uvrB was able to survive and replicate in macrophages and the growth rate was comparable to its parental strain (Fig.3, file name: 0606 uvrB Phagocytosis.ppt). d. Base on the results described above (a-c), the uvrB mutant of Ft novicida is not attenuated in the murine infection model. Fig. 3. Intramacrophage survival of uvrB mutant. Murine macrophage cell line (J774) were infected with the uvrB mutant or its parental strain (F. novicida) using an inoculum of 10 or 100 MOI. Numbers of viable bacteria in macrophages were measured at 1hr and 24 hrs post infection. e. Humoral response of mice against LVS infection (Note book #4 page 23-24): Three C57BL/6 mice were infected intranasally with LVS (1000 CFU), boosted two week later 25 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, and sera were collected 2-week after boost to determine their humoral response to the bacteria (SOP: assessment of humoral response). Results of ELISA indicated that a high titer (1:10,000) of anti-LVS specific antibody (Ig) was generated by the boost (Fig.4, file name: 0606 LVS Ab Titer.ppt). Isotyping analyses of the sera suggested that host immunity against LVS infection is Th1 dominant (high IgG2a and low IgG1 antibody production). Fig. 4. Humoral response to LVS infection. C57BL/6 mice were intranasally challenged with 1000 CFU of LVS or PBS alone as mock infection (NMS) and re-challenged 2 weeks later. Sera were collected 2week after the re-challenge and used to determine titers of anti-LVS specific antibody. f. Respiratory cellular responses: We have performed one set of the flow cytometry analysis to determine the population of dendritic cells, macrophages, NK cells, B-cells, CD4+ T cells and CD8+ T cells in the lungs of LVS- or F. novicida- infected mice. We need to repeat this experiment to obtain a conclusive result. 4. Significant decisions made or pending Describe 5. Problems or concerns and strategies to address Describe 6. Deliverables completed Describe 7. Quality of performance Excellent 8. Percentage completed 9 % of scientific work completed on the milestone 9. Work plan for upcoming month a. Contrast and compare cellular infiltration in the respiratory compartment by flow cytometry after LVS and F. novicida intranasal challenges. 26 of 27 Tularemia Vaccine Development Contract: Technical Report Period: 6/01/2006 to 6/30/2006 Due Date: 7/15/2006 Prepared by: Barbara Griffith, C. Rick Lyons, Terry Wu, Karl Klose, Kathryn Sykes, Stephen Johnston, Mitch Magee, Bob Sherwood, Ed Barr, Julie Wilder, Justin Skoble, b. Analyze cytokine (TNF-α, IL-4, IL-12, IFN-γ) production in the lung by ELISA after LVS and F. novicida intranasal challenges. This would allow us to correlate the cellular infiltrate results and provide a better understanding of cytokine induction during the early stages of infection. 10. Anticipated travel Describe request 11. Upcoming Contract Authorization (COA) for subcontractors Describe request 27 of 27
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )