Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 1, 2, 3, 5, 12, 16, 25, 26, 32, 39, 40, 41, 46, 49, 50
Inactive milestones: 4, 6-11, 13-15, 17-24, 27-31, 33-38, 42-45, 47-48, 51-54
Milestone 1
Milestone description: Subcontracts finalized
Institution: UNM/All subcontractors
1. Date Started: 11/1/2005
2. Date Completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Subcontracts for Cerus, ASU, LBERI, and UTSA are final and fully executed.
b. Rick Lyons and Barbara Griffith completed site visits with Cerus, LBERI, UTSA and ASU
c. UNM Strategic Work Plan: final review is anticipated by approx 5/12/06 with edits from
Vicki.
d. UNM Semi-Annual report was provided electronically on 4/28; Vicki indicated that format and
content were appropriate; Barbara will send hardcopies to Ross and Vicki/Marlene with
5/12 submission of monthly reports.
e. UNM submitted subcontracting plan report hardcopy (4/30) and using eSRS system (5/4) to
SBA and to Ross Kelley. LBERI submitted to eSRS on 5/8. ASU submitted to eSRS on
5/5/06. UTSA’s submission is delayed due to UNM Purchasing Department not yet
assigning a subcontracting number to the UTSA PO. As of 5/9, Ross Kelley said he would
verify that eSRS had received the submissions by LBERI and ASU.
f. COA# 7 of 4/26 permitted purchase of Maxi-Miser caging system, vented cage change
system, vented bedding disposal system, Biosafety cabinet, fermentation system,
tangential flow filtration system and pump, HiGro Shaker, conference phone, and sparging
generator
4. Significant decisions made or pending
a. UNM needs to develop forms for subcontractors to provide timeline report changes.
5. Problems or concerns and strategies to address
a. Dr. Lyons has identified non-TVDC funds to support an MS Project consultant for
developing timeline reports. Barbara needs to establish the contract with the MS Project
consultant.
b. ASU has encountered difficulty with their older microarray slide printer and are attempting
to repair. If repair is not possible, UNM may need to develop a strategy to support ASU’s
microarray slide printing.
1
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
6. Deliverables completed
4 fully executed subcontracts have been finalized and returned to Ross Kelley (Cerus, ASU,
UTSA and LBERI)
7. Quality of performance
Excellent
8. Percentage completed
92%
9. Work plan for upcoming month
a.
b.
c.
d.
UNM to complete Strategic Work Plan after 5/12/06 final review by Vicki Pierson
UNM to finalize strategy for timeline changes to be reported by subcontractors to UNM
UNM to add the changes to the MS Project timeline file.
UNM to assign PO to UTSA subcontract so that UTSA can submit their subcontracting plan
report
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
a. Barbara submitted request for COA on the Biomek system on 4/13. Ross anticipates
response by approx 5/11.
b. Cerus may request a COA to shift some direct labor funds to a part-time management
consultant, to allow the Cerus scientists to focus on the scientific milestones. Cerus
anticipates no change in the subcontract expenses.
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/1005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
NIAID is working on the IAA with USAMRIID and discussions regarding funding transfers are in
progress. Kristin DeBoord indicated that a legal review may be pending.
4. Significant decisions made or pending
a. UNM and NIAID continue to wait for a change in the status of the IAA between NIAID
and USAMRIID.
b. UNM has notified NIAID that if vaccinations are not administered by February 2006, or no
later than June 2006, additional protective equipment will be necessary to prevent a
stoppage of work. LBERI is purchasing a biobubble as additional protective equipment.
c. The number of potential vaccinees has increased to 41 for LBERI, 6 for UTSA, 4 for
UNM. Total = 51, though LBERI originally had 20 our on TVDC and had ~21 on a project
associated with Judy Hewitt. UNM currently anticipates funding the travel for 32
scientists (22 from LBERI, 6 for UTSA and 4 for UNM) to USAMRIID and anticipates
funding the pre-health screenings for 26 (22 from LBERI and 4 for UNM) since UTSA is
paying for their own pre-health screenings. UNM EOHS has provided a quote for
$579/person for the pre-health screenings including chest X-ray, infectious disease
testing and EKG.
d. The “Occupational Health budget” is approximately $341,711. The costs for UNM
prehealth screenings are estimated to cost $579/person and include labs, chest x-ray,
EKG; same cost for UNM and LBERI employees. 26 x $579=$15,054
2
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
i. Travel & labor & prehealth & 0.5 F&A on all expenses has been revised to
$6,000/person.
ii. So prehealth/travel/labor/F&A= min of ~$6000/person. 32 x $6000= $192,000
iii. If travel /labor /prehealth/F&A is closer to $8,000/person 32 x $8000=
$256,000
iv Biobubble will add $24,000 to $48,000
v. LVS vaccinations + biobubble= $216,000 min to 304,000 max
e. UNM EOHS has obtained many of the laboratory documents and radiology documents
which USAMRIID will require. We have the Laboratory’s CLIA certificate, the Laboratory
Directors’ signed and dated CV and State Medical licenses. The Laboratory will provide
their new CAP certificate soon. UNM EOHS has requested the Radiology Facility
Accreditation Certificate, the Radiology Director’s sign/dated CV and the Radiology
Director’s Medical License.
5. Problems or concerns and strategies to address
When will the NIAID-USAMRIID IAA be completed and when can UNM begin the prehealth
screenings?
6. Deliverables completed
None
7. None Quality of performance
Good
8. Percentage completed
13%
9. Work plan for upcoming month
Ross Kelley will continue to monitor the progress of whether Martin Crumrine's IAA between
NIAID and USAMRIID will inform UNM when and whether the TVD Contractors can be
vaccinated under this IAA.
10. Anticipated travel
Travel could occur in June and August 2006, as soon as the IAA is reached and NIAID approves
the travel.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 3
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a.
b.
c.
d.
e.
Ordered micropump generator
Ordered liquid sparging generator
Submitted ES&H work review for Institutional Agent Committee (IAC) review
Received IAC approval for work with LVS
Received COA approving purchase of liquid sparging generator
4. Significant decisions made or pending
a. None
5. Problems or concerns and strategies to address
a. None
3
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
6. Deliverables completed
a. None
7. Quality of performance
a. Fair
8. Percentage completed
a. 1%
9. Work plan for upcoming month
a. Obtain DVC LVS from UNM
b. Initiate LVS bioaerosol studies with Collison generator
10. Anticipated travel
a. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
a. COA#7: Approved for liquid sparging generator
Milestone 5
Milestone description: Species tested for sensitivity to LVS & generation of immunity against a
pulmonary challenge of Schu4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc7
i. We are repeating the studies performed in Ftc6 to determine the LD 50 and the
clearance of LVS in BALB/c and NIH-Swiss mice.
ii. BALB/c and NIH-Swiss mice were inoculated:
1. i.n. with 2.8 x 103, 1.8 x 104 and 3.4 x 105 CFU
2. s.c. with 8 x 106 CFU
3. i.d. with 5 x 106 CFU
iii. The results from this experiment are nearly identical to those in Ftc6 (Fig 1).
1. Both strains of mice were resistant to s.c. and i.d. infection with
approximately 5 x 106 CFU LVS.
2. The calculated i.n. LD50 of LVS in NIH-Swiss is 1.1 x 104 CFU
3. The estimated i.n. LD50 of LVS in BALB/c mice appears to be slightly
higher than that in NIH-Swiss mice, although the exact number could not
be determined because more mice survived infection with 3.4 x 105 CFU
than with 1.8 x 104 CFU
iv. We wanted to measure the resistance of mice that had survived LVS inoculation
to a subsequent i.n. SCHU S4 challenge. To demonstrate that these mice had
cleared LVS vaccination, we plated homogenates of lungs, spleens and livers
from 2 mice from the indicated groups. Surprisingly, LVS was found in the lungs
and spleens from both strains of mice 5 weeks after i.n. inoculation. The spleen
of an s.c. vaccinated BALB/c mouse contained two colonies (Tables 1 and 2).
This was an unexpected result because the prior source LVS is usually cleared in
3 weeks in our hands and others. Thus, instead of challenging these mice with
SCHU S4, we will continue to measure the residual bacterial burden in these
mice until LVS has been completely cleared in two consecutive measurements.
4
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
Figure 1. BALB/c and NIH-Swiss (n = 9 or 10) mice were inoculated with the indicated
doses of LVS by intranasal (i.n.), subcutaneous (s.c.) or intradermal (i.d.) routes.
Survival was monitored for 30 days.
Table 1. Bacterial burden in NIH-Swiss mice 5 weeks after LVS inoculation
5
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
Table 2. Bacterial burden in BALB/c mice 5 weeks after LVS inoculation
4. Significant decisions made or pending
5. Problems or concerns and strategies to address
We have to standardize the procedure for culturing and freezing LVS as soon as possible
because 1) we have more vial-to-vial variability when working with lyophilized LVS than with
SCHU S4 suspended in freezing medium and 2) the low LVS concentration is forcing us to
deplete our stock faster than anticipated. UNM projected usage of 100 LVS vials in first year
at UNM and has used 45 vials in 4.5 months. UNM projects that 100 vials will be used within
the first 7.5 months at UNM, rather than in 12 months.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
6%
9. Work plan for upcoming month
a. Mice: Based on the result from Ftc6 and Ftc7, we will vaccinate BALB/c and NIH-Swiss
mice so that statistically significant numbers of vaccinated mice will be available to
determine the i.n. LD50 of SCHU 4 in vaccinated mice.
b. Rats: We are developing Standard Operating Procedures (SOPs) for working with rats.
These will include methods for infecting rats i.n., s.c. and i.d., monitoring their health
status, and processing the lungs, spleens, and livers to determine the bacterial load.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
6
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
Milestone 12
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
 The LRRI team (Wilder and Monier) met with the UNM team on 4/19/06 to discuss the
development of immunoassays. Research was conducted into available ELISpot, ELISA
and flow cytometry reagents for both non-human primate and various small animals in
anticipation of model development.
4. Significant decisions made or pending
5. Problems or concerns and strategies to address
b. None
6. Deliverables completed
c.
None
7. Quality of performance
d. Good
8. Percentage completed
e. 0.15% of scientific work has been completed
9. Work plan for upcoming month
 We are currently searching for various protocols for preparing cynomologous macaque
PBMCs
Ms. Monier will complete IACUC Animal Care training modules in order to be approved to
work with animals.
g. Ms. Monier will continue to train on relevant immunoassays in the laboratory.
f.
10. Anticipated travel
h. None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
i.
None for this milestone.
Milestone 16
Milestone description: Luciferase generating F. tularensis LVS delivered to UNM
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: 04/30/2006
3. Work performed and progress including data and preliminary conclusions
a. The firefly Luciferase gene was amplified from pGPL01 and cloned into pFNLTP8
downstream of the Francisella groEL promoter (plasmid construct was named
pKEK871, see figure J1)
b. The E. coli cloning strain DH5 was transformed with pKEK871 and luciferase
activity was measured using a Bertolt luminometer (attached figure LVSluc.jpg)
c. pKEK871 was then electroporated into LVS and luciferase activity was compared
to LVS w/o plasmid and LVS with empty plasmid (pFNLTP8)
7
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
d. Results demonstrate pKEK871 as an effective plasmid for expressing luciferase
in Francisella LVS (see figure J2) (documented in TVD UTSA notebook #1,
experiment JB1, page 7)
e. Sequencing and restriction digest confirmed the plasmid pKEK871 to be correct
(documented in TVD UTSA notebook #1, experiment JB1, page 4)
4. Significant decisions made or pending
none
5. Problems or concerns and strategies to address
none
6. Deliverables completed
The LVS strain containing pKEK871 (named KKF51) was sent to UNM
7. Quality of performance
excellent
8. Percentage completed
100 %
9. Work plan for upcoming month
Milestone Completed
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Figure J1
Figure J2
8
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
Milestone 25
Milestone description: Design protein-fragment library based on SCHU S4 sequence
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
The initial design of an overlapping 200 amino acid library of the complete SCHU S4 proteome
has been completed and we have designed primers for amplification but have yet not ordered
them.
Data files appended (ftu_proteins_segs.xls)
4. Significant decisions made or pending
We are considering a redesign of this milestone that would encompass an ORF assembling
technique that would significantly improve the quality of the ORFs without increasing costs. This
will not change the scope of the milestone.
5. Problems or concerns and strategies to address
See 4. No problems have been encounter at this time. Protocols and reagents are being tested.
6. Deliverables completed
Protein fragments are designed for straightforward PCR amplification from genomic DNA. Test
samples have been amplified.
7. Quality of performance
Good
8. Percentage completed
50%
9. Work plan for upcoming month
Perform testing of the new design for production of optimal DNA templates for IVT reactions.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 26
Milestone description: Confirmation of gene expression (Design HTP SOPs, Test HTP SOPs,
ORF library production, confirm gene expression)
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Initial designs have been made and we have constructed 5 genes for testing in multiple in vitro
transcription/translation production kits. Initial designs for the HTP constructs have been
designed and peptide selections are being made. We are testing kits from Invitrogen, Qiagen,
Roche, Promega, and Ambion. The current constructs being tested are cowpox gene fragments
from an ELI screen, termed CPV 100a, CPV110a, CPV030a, CPV 165a, and CPV172.
4. Significant decisions made or pending
9
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
We are considering some design changes to the HTP process. Meanwhile 500 peptides will be
selected and purchased commercially. These will be used to test all downstream methods in a
pilot study.
5. Problems or concerns and strategies to address
Describe
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
10%
9. Work plan for upcoming month
Complete testing of various kits for the in vitro transcription/translation. Finalize the design of the
next version of the HTP 3’ and 5’ constructs for creating the linear IVT constructs.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 32
Milestone description: Oligos selected for microarray production; Oligos list refined, 70mer
oligos procured, GDP oligos defined, Based on SCHU S4 sequence.
Institution: ASU-Johnston
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
The 70mer oligo set has been designed to cover the SCHU S4 genome
4. Significant decisions made or pending
Oligo design has been completed. Oligo production will be designated to either Operon
Technologies or Qiagen, Inc. Oligonucleotide QC will include an electronic ordering system to
eliminate data re-entry errors. All reagents will be lot tested and must pass purity tests prior to
use. All oligos are routinely analyzed by optical density (OD) measurement. Selected oligos
longer than 50 bases are to be analyzed by polyacrylamide gel electrophoresis (PAGE) and
statistical analyses are performed to monitor oligo quality. In addition, oligos should be randomly
analyzed by capillary gel electrophoresis. Any oligo that fails to meet specifications is
resynthesized. The final yield of each oligo is determined by measuring the absorbance at 260
nm using an automated spectrophotometer for conversion of readings to micrograms and
picomoles.
5. Problems or concerns and strategies to address
None.
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
10%
9. Work plan for upcoming month
Order the oligo set and re-array the master plates into master and working printing plates. Begin
Milestone 33.
10
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 39
Milestone description: Create uvrA or uvrB mutant F. tularensis subsp. novicida
Institution: UTSA
1. Date started: 4/03/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1 The basic process of making mutant in F. tularensis subsp. Novicida:
To make UvrA or UvrB deletion, we first have to amplify each fragment
upstream(UpSeq) and downstream(DnSeq) of UvrA or UvrB gene, and antibiotic
resistance gene, then through overlapping PCR, we ligate the UpSeq, Antibiotic
Resistance Marker,DnSeq together, and finally put the fragment into a plasmid like
pGEM-T. Then the plasmid will be used to transform F. tularensis subsp. Novicida to
make the mutant.
Up1
Up
500bp
UvrB
500bp
Dn1
Dn
pET15bUniUP
FnPErmC
pET15bUniDn
500bpUpSeq
FnPErmC
500bpDnSeq
3.2 Primers were designed for F. tularensis subsp. Novicida promoter(FnP) to drive the
expression of Erythromycin resistance gene(ErmC), which will be used for construction of
UvrA and UvrB mutant;
The sequence of FnP is:
tttgggttgtcactcatcgtatttggtttataattttaagctaataacctaattataactaattaatagttttgtatct
tgaaaaaatagctataaaacttatttaaataacgaagatttttgtgtataaaatatttataacaaaaaaaggagactaa
a
The Primers used to clone FnP into pET-15b are:
FnPBglII: tcgAGATCTtttgggttgtcactcatc
FnPNdeI: ctcgttCATATGtttagtctcctttttttg
11
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
3.3 F. tularensis promoter(FnP) was amplified and cloned into pET-15b plasmid through
restriction digestion enzymes BglII and NdeI;
3.4 Erythromycin resistance gene (ErmC) has been cloned into pET-15b plasmid made in
step 3 with NdeI and BamHI, so its expression is under the control of F. tularensis
promoter.
ErmC primers used are:
ErmCNdeI: actaaaCATATGaacgagaaaaatataaaacaca
ErmCBamHI: gccGGATCCcttacttattaaataatt
3.5 Primers were designed for UvrB of F.tularensis subsp. Novicida based on sequence
published in the web site of The Institute of Genomic Research.
The accession number for UvrB is NF06FT1368, the coordinate for the sequence is
1218070-1216064.
Upstream and Downstream fragments of UvrB(UvrBUpSeq, UvrBDnSeq) to make
mutant in F. tularensis subsp. Novicida were amplified.
The primers used are:
For UvrBUpSeq
UvrBUp 5’ggaGAATTCctgtgagtggtgtatttggctcga
UvrBDn 5’ actactgggctgcttcctaatgcattgtattgcttgaggctgatcgcc
For UvrBDnSeq:
UvrBUp1 5’gctgctaacaaagcccgaaaggaagctacgaaggttatcaaagctctcg
UvrBDn1 5’
ggaGAATTCttgcaccaatcccggcaagtaa
The primers for amplifying FnPErmC are:
pET15bUniUp: 5’tgcattaggaagcagcccagtagt
pET15bUniDn: 5’ttc ctt tcg ggc ttt gtt agc agc
All the data were documented on pages 1-6, TVD UTSA notebook #2.
4
Significant decisions made or pending
5
Problems or concerns and strategies to address
6
Deliverables completed
7
Quality of performance
8
Percentage completed
9
Work plan for upcoming month
None
No problems so far.
pET-15b plasmid with erythromycin resistance gene under the control of F. tularensis promoter.
Excellent progress.
Approximate 20% of scientific work completed on the milestone
12
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
9.1 Through overlapping PCR to make construction of pGEM-T plasmid with UvrBUpSeqFnP-ErmC-UvrBDnSeq, which will be used to make deletion of UvrB in F. tularensis
subsp. Novicida.
9.2 If plasmid from step 1 is correct( will be sequenced), the plasmid will be transformed into
F. tularensis subsp. Novicida to make UvrB mutant(deletion of the most part of UvrB
gene in the strain).
9.3 Making plasmid of UvrA through the same method listed in step 9.1
9.4 pET15b is used to clone the FnPErmC, which will be used as a template to get the
FnPErmC. pGEM-T is a vector used to clone UvrBUpSeq-FnPErmC-UvrBDnSeq
fragment.
10 Anticipated travel
None.
11 Upcoming Contract Authorization (COA) for subcontractors
None.
Milestone 40
Milestone description: Phenotyping of F. novicida mutants; Measure degree of attenuation of
uvr mutants in macrophages and in mice
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Received COA #7 for purchasing equipment required for animal experiments, and placed
purchase order.
Completion of this milestone requires robust cultivation methods for F. tularensis ssp. novicida.
 Plate culture
Experiments were initiated to optimize for growth of parental F. novicida strain U112 on agar
media. Evaluation criteria were: maximal cfu, growth rate, ease of colony enumeration, ease
of media formulation and cost. Commercially available cystine heart agar with 5% rabbit
blood (CHAB) plates (Remel) were found to support robust growth of F. novicida colonies,
and were chosen as a positive control. The protocol and data can be found attached:
Cerus_Ft_protocol_001 and the data summary are below.
13
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
Media
Colony size
at 24h
Colony
size at 48h
3 mm
Log
Titer at
24h
10.07
Log
Titer at
48h
Same
Cystine Heart w/rabbit blood
and antibiotics
(commercial)
Cystine Heart w/hemoglobin
(home-made)
Chamberlain’s agar
<1 to 1 mm
>1 mm
3 mm
10.10
Same
<0.5 mm
2 mm
TTTC*
10.09
Chamberlain’s agar w/
hemoglobin
<1 mm
2 mm
10.12
Same
VPP w/ cystine**
1 mm
2-3 mm
10.11
Same
VPP w/ cystine and hemoglobin >1 mm
3 mm
10.17
Same
Mueller Hinton w/ 5% sheep
blood
1.5 mm
NA
9.68
No growth
Notebook 937, p.5-10
ConclusionsCystine heart agar plates supplemented with hemoglobin (CHAH, prepared in house) perform
as well as CHAB and are significantly less expensive. CHAB was superior to Mueller Hinton
agar with 5% sheep blood (MHAB) with respect to CFU/ml and speed and size of colony
formation. Chamberlain’s agar with and without supplementation with hemoglobin supported
equal numbers of bacteria, however the colonies were smaller than on CHAB. A non-animalproduct containing media, veggie peptone phosphate (VPP) agar (Oxoid) supplemented with
cystine or hemoglobin performed as well as CHAB with respect to CFU. VPP supplemented
with cystine has the advantage of being a clear formulation on which colonies can be more
easily enumerated by a colony counter. A similar series of tests will be performed with LVS
before a final agar formulation is selected, as it would be preferable to use a single agar
formulation for all experiments
14
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
 Broth culture
In order to produce KBMA vaccines, we require a liquid media that supports dense growth of
Francisella strains; this media must also be transparent to UVA light in order to be suitable for
photochemical inactivation experiments. For regulatory purposes, another consideration is
that media suitable for vaccine propagation would ideally not contain animal products, and
would be chemically defined. For this reason, we chose to evaluate Chamberlain’s defined
medium. We contracted with a custom media company (Teknova) to prepare 1 Kg of a dry
premixed formulation of Chamberlain’s media to facilitate the ease of preparation and reduce
the batch-to-batch variability of weighing out the many components in this chemically defined
medium. Growth of U112 in modified Mueller Hinton Broth (MHB) and modified Trypticase
Soy Broth (TSB) and Chamberlain’s was compared by measuring OD 600 (media recipes are
attached: Cerus_Ft_protocol_002). Evaluation criteria were: Final OD600, maintenance of
viability at stationary phase, growth rate, UV transparency, absence of animal products, and
ease of formulation.
Growth of F. tularensis ssp novicida strain U112 in
Chamberlain's medium
10
OD600
1
0.1
0.01
0
1
2
3
Time, hrs
4
5
6
7
Notebook 934 p004
ConclusionsWe determined that Chamberlain’s media supports robust growth of Ft. novicida with a
doubling time of 1h. This rate of growth is equal to or greater than Modified TSB and
Modified MHB and final OD was approximately 3 fold higher than with complex medias.
Chamberlain’s media has numerous advantages: it is optically clear, chemically defined, and
animal product free.
4. Significant decisions made or pending
For formulation studies, Chamberlain’s media will be selected as the liquid media of choice for
propagation of F.t. novicida.
5. Problems or concerns and strategies to address
We have shared the ordering information for custom Chamberlain’s media with Bob Sherwood for
evaluation of F. tularensis ssp tularensis.
6. Deliverables completed
None
7. Quality of performance
Excellent progress
8. Percentage completed
3%
9. Work plan for upcoming month
15
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
VPP agar supplemented with cystine will be optimized to reduce crystal formation and the media
will be evaluated for supporting robust growth of F.t. novicida.
Formulation of medias for freezing F.t. novicida will be tested in order to create seed stocks for
inactivation experiments and injection stocks for animal virulence experiments.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 41
Milestone description: Optimization of psoralen treatment and characterization of KBMA F.
novicida; Determine the amount of S-59 and UVA required to inactivate uvr mutants, Determine
extent of metabolic activity of uvr mutants after S-59 and UVA inactivation, Determine the level
of virulence attenuation of KBMA uvr strains in mice
Institution: Cerus
1. Date started: 3/2/06
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Received COA #7 for purchasing equipment required for animal experiments, and placed
purchase orders.
Preliminary small-scale photochemical inactivation of the parental strain of F. novicida U112
were performed following attached protocol: Cerus_Ft_protocol_003. Inactivation
experiments were performed in modified Trypticase Soy Broth (TSB) with conditions
optimized for B. anthracis.
1.00E+09
1.00E+08
CFU / ml
1.00E+07
1.00E+06
1.00E+05
U112
1.00E+04
1.00E+03
1.00E+02
1.00E+01
1.00E+00
0
2000
4000
6000
8000
10000
[S-59] nM
Notebook 837 p12
Complete inactivation (9 log kill) achieved at dose of 10 µM S-59, however significant
inactivation (0.5 - 1.5 log kill) occurred at 10 nM. This represents a divergence from our
experience with B. anthracis and L monocytogenes in which the wild-type strains are entirely
resistant to 10 nM S-59 and are completely inactivated at concentrations of 1000 nM. The
high concentration of S-59 required for complete inactivation suggests that permeability of
F.t. novicida outer membrane could potentially be an issue.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
High concentration of S-59 required for complete inactivation suggests that permeability of F.
novicida outer membrane could potentially be a problem for this protocol. The protocol used for
inactivation experiments above designates a 1h incubation period with S-59. We have an
16
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
alternate protocol for photochemical inactivation that increases the S-59 incubation time by
exposing the bacteria to S-59 throughout the entire culturing process. We will evaluate the
sensitivity to F.t. novicida to photochemical treatment using this protocol
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
2% of scientific work completed on the milestone
9. Work plan for upcoming month
We will determine the concentration of S-59 required to inactivate U112 using alternate
inactivation protocol and Chamberlain’s media. The continuous incubation process usually
requires a 5-10 fold increase in the amount of S-59 because the bacteria can metabolize the
compound during growth, however this may be offset by increased diffusion across the outer
membrane. The initial concentration of S-59 to be tested will range from 10 nM to 10 µM.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 46
Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale
Francisella tularensis culture conditions, Establish 3 L culture scale purification conditions,
Optimize 3 L scale photochemical inactivation process, Verify protective immunogenicity of
vaccine candidates produced by optimized large-scale process
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Received COA #7 for purchasing equipment required for fermentation and concentration of LVS, and
placed purchase orders.
Media optimization experiments were initiated:
CHAB plates were found to support growth of LVS colonies, with visible colony
formation after 24h incubation at 37o C. CHAB was superior to modified tryptic soy agar
and Mueller Hinton agar with 5% sheep blood with respect to the number of CFU and the
speed of colony formation with colonies either failing to appear within 48 hours, or with
CFU reduced by greater than10 fold on these other medias.
Media
mTSB
mMHB
Chamberlain
U112 t2 U112 OD600
1h
0.77
1h
0.72
1h
3.6
LVS t2
1.75h
1.5h
2.0h
LVS OD600
0.44
0.64
1.6
Notebook 837, pp2-12
17
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
3 liquid media formulations were tested for supporting growth of LVS in shaker flasks. While
Chamberlain’s media did not support the highest rate of growth, this medium supported the
highest density of growth. Chamberlain’s media has other advantages: it is optically clear,
chemically defined, and animal product free.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
good progress
8. Percentage completed
2 % of scientific work completed on the milestone
9. Work plan for upcoming month
Agar plate formulations described for F. novicida will be tested for robust growth of LVS. Viability
of liquid cultures of LVS at stationary phase will be determined for various media formulations by
plating for CFU.
Formulations for cryopreservation of LVS will be tested. Log phase and stationary phase bacteria
will be suspended in Chamberlain’s media containing 15% glycerol or 8% DMSO and frozen at 80 degrees C. CFU will be evaluated before and immediately after freezing, and then weekly
after freezing.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. Used existing plasmid construct KEK931 (Δbla2-contains 500bp homology at 5‫ ׳‬and 3‫׳‬
ends, respectively) to optimize mating/conjugation into Schu4.
i. Tested LB agar and Tryptic Soy agar (TSA) plates with supplements for efficacy of
mating into SCHU S4.
ii. Utilized an E.coli DAPA strain to conjugate test plasmid (containing bla 2 deletion
construct).
18
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
iii. Various conjugation/mating ratios used to optimize conjugation into SCHU S4 (e.g.
1:10, etc.). Various temperatures for optimal conjugation tested. Various
erythromycin concentrations tested for transconjugant selection tested.
iv. Optimal conditions thus far found to be TSA, 10:1 ratio SCHU S4: E.coli DAPA, 37 °
C for 18 h with 100 ug/ml erythromycin selection based on the total number of
conjugates generated versus the background obtained from spontaneous
erythromycin mutant in a given experiment.
v. Data is located in TVD UTSA Notebook 3 pages 1- 8.
vi. Ordered supplies for this month.
Study 1: Used 50 ug/ml Erythromycin selection on filter paper 18 hours using KEK931 (Δbla2) mating strain.
TSA at 37° C
TSA at 25°C (RT)
Ratio
conjugate
cells only
conjugate
cells only
1:1
24
1232
0
780
1:10
2182
0
1:100
563*
0
LB at 37° C
1:1
1:10
1:100
3
24
0
568
LB at 25° C (RT)
0
0
0
0
Study 2: Used 100ug/ml Erythromycin selection on filter paper 18 hours using KEK931 (Δbla2) mating strain
TSA at 37° C
Ratio
conjugate
1:10
>3000
cells only
0
LB at 37° C
conjugate
cells only
>3000*
>3000
* Contamination problem
Note: Not all mating conditions have been tested—still pending for optimal conditions
4. Significant decisions made or pending
none
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
1%
9. Work plan for upcoming month
a. Design oligonucleotide primers to construct SCHU S4 iglC deletion. Begin construction
of mating plasmid.
b. Continue optimizing the conjugation/mating protocol to use in the construction of the
desired deletion.
19
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS
uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD,
iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA,
iglB strains
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. LVS strain (Lot#16 from DVC originally) received from University of New Mexico was
expanded and culture stocks were made and stored in a -80 freezer. Bacteria were
allowed to grow in 200 ml of Tryptic Soy Broth (TSB) supplemented with 0.1% cysteine
(37oC with shaking) to reach late log phase (OD600= 0.8-1.0). Bacteria were collected by
centrifugation, resuspended in 20 ml of stock solution (30% glycerol in TSB/cysteine),
aliquoted into 40 tubes of 1.2ml-cryovials, and stored in a -80 freezer. ( Note book #4
page 2-3) .
b. Groups of C57BL/6 mice (female, 6-week old) were challenged intra-nasally (SOP is
attached) with 3 doses (1000, 2000, 4000 CFU) of LVS to determine LD50 of this strain
(Note book #4 page 4). The weight loss of each mouse will be monitored and survival
rate will be calculated to determine the LD50. The results will be used as a reference point
for all LVS-based challenges. This experiment is in progress and results will be submitted
in next report. The end point for LD50 studies is death. (SOP attached)
c. The LD50 of F. novicida U112 has been established to be approximately 10 CFU
intranasally.
d. Progress documented in TVD UTSA notebook #4
4. Significant decisions made or pending
N.A.
5. Problems or concerns and strategies to address
N.A.
6. Deliverables completed
N.A.
7. Quality of performance
Good
8. Percentage completed
2.86 %
9. Work plan for upcoming month
a. Establish and verify a basal level of immunity (humoral and cell mediated responsesSOPs included) in mice infected with the LVS strain using a sub-lethal dose. Humoral
20
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2006 to 4/30/2006
Due Date: 5/15/2006 and Prepared by: Barbara Griffith
Terry Wu, Bob Sherwood, Julie Wilder, Karl Klose, Stephen Johnston,
Kathryn Sykes, and Justin Skoble
responses will be reported as serum titers (50% maximal binding on a titration curve).
Cell mediated responses will be analyzed using cytokine recall assays. IFN-, IL-12 and
IL-4 will be the primary cytokines analyzed.
b. Contrast and compare cellular infiltration in the respiratory compartment by flow
cytometry (SOP included) after LVS and F. novicida intranasal challenges. The
intranasal route of vaccination has become a preferred choice to induce optimal
respiratory immunity. However, careful analyses of the cellular infiltration of cells into the
respiratory compartment has not been performed during the acute phase of the infection.
By using flow cytometry, we will assess the cellular recruitment and trafficking into this
compartment. Experiments with F. novicida and LVS will provide a comparative basis to
evaluate the other defined mutants to be generated by Dr. Klose.
10. Anticipated travel
N.A.
11. Upcoming Contract Authorization (COA) for subcontractors
N.A.
21