Aquatic Toxicology 144–145 (2013) 155–161
Contents lists available at ScienceDirect
Aquatic Toxicology
journal homepage: www.elsevier.com/locate/aquatox
Effects of triphenyltin on growth and development of the wood frog
(Lithobates sylvaticus)
Eric Higley a , Amber R. Tompsett a , John P. Giesy a,b,c,d,e , Markus Hecker a,f ,
Steve Wiseman a,∗
a
Toxicology Centre, University of Saskatchewan, Saskatoon, SK, Canada S7N 5B3
Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, SK, Canada
c
Zoology Department, and Center for Integrative Toxicology, Michigan State University, East Lansing, MI, USA
d
Department of Biology & Chemistry, and State Key Laboratory for Marine Pollution, City University of Hong Kong, Kowloon, Hong Kong Special
Administrative Region
e
State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, People’s Republic of China
f
School of the Environment and Sustainability, University of Saskatchewan, Saskatoon, SK, Canada
b
a r t i c l e
i n f o
Article history:
Received 21 August 2013
Received in revised form
24 September 2013
Accepted 28 September 2013
Keywords:
PPAR
RXR
Amphibian
Metamorphosis
Organotin
Lipid metabolism
a b s t r a c t
Exposure to contaminants in the environment has been suggested as a contributing cause of ongoing
declines in populations of amphibians reported in certain locations around the world. In the current study,
responses of the wood frog (Lithobates sylvaticus) to exposure to triphenyltin (TPT), a commonly used
fungicide, during the larval period were characterized. Exposure of L. sylvaticus to 0.1, 1.0, or 5.0 ␮g TPT/L
significantly affected survival, growth, days to metamorphosis (DTM), and abundances of transcripts of
genes of interest. After seven days of exposure there were no significant effects on survival, but masses
and snout-ventral length (SVL) of larvae exposed to 5.0 ␮g TPT/L were significantly lesser than controls.
Mortality of larvae after exposure to 5.0 ␮g TPT/L was 100% nine days after initiation of the experiment.
Larvae exposed to 0.1 or 1.0 ␮g TPT/L were allowed to grow for 100 days or until they reached metamorphic climax, whichever occurred earlier. Mortality of wood frogs exposed to 1.0 ␮g TPT/L was 80%.
The LC20 or LC50 after 100 days of exposure was 0.12 or 0.34 ␮g TPT/L, respectively. However, DTM of
larvae that survived exposure to 1.0 ␮g TPT/L was significantly less than that of controls. Abundances
of transcripts of retinoid-X-receptor (rxr) and perixosomal proliferation receptor gamma (ppar) were
significantly lesser in larvae exposed to either concentration of TPT for seven days. Also, abundances
of transcripts of stearoyl-CoA desaturase-1 (scd1), fatty acid synthase (fas), lipoprotein lipase (lpl), and
␤-hydroxybutyrate dehydrogenase (ˇ-hb-m) were lesser in larvae exposed to 5.0 ␮g TPT/L, which suggested that disruption of lipid metabolism might have affected survival in this exposure group. However,
in larvae that survived to metamorphic climax during exposure to TPT for as long as 100 days, abundances of transcripts of perixosomal proliferation receptor alpha (ppar˛), ppar, cytochrome p4504B1
(cyp4b1), fas, and lpl were greater than in controls, suggesting that an up-regulation of processes related
to metabolism of lipids might have been important for survival and development of these animals. Overall, concentrations of TPT that are found in the environment had a significant effect on the survival and
development of L. sylvaticus, and this might have been due, in part, to effects on metabolism of lipids.
© 2013 Elsevier B.V. All rights reserved.
1. Introduction
Greater than 1.1 billion pounds of pesticide active ingredients
were used in the USA in 2007, with greater than 70 million pounds
being some type of fungicide (Grube et al., 2011). The fungicide
triphenyltin (TPT) is used worldwide, and within the USA it is
approved for use in agriculture for pecans, potatoes, and sugar beets
(Yi et al., 2012). Approximately 380,000 pounds of TPT is applied
∗ Corresponding author. Tel.: +1 306 966 4912; fax: +1 306 966 4796.
E-mail address: steve.wiseman@usask.ca (S. Wiseman).
0166-445X/$ – see front matter © 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.aquatox.2013.09.029
each year in the USA and application of TPT for agriculture has led
to concentrations in water bodies proximal to agriculture activity as great as 6 ␮g TPT/L and concentrations in fish as great as
389 ng TPT/g tissue (Jones-Lepp et al., 2004). Concentrations of TPT
in this range have caused significant effects in aquatic organisms.
For example, the 72 h lethal concentration of 50% (LC50 ) of embryos
of Xenopus tropicalis was found to be 5.25 ␮g TPT/L (Yu et al., 2011).
Concentrations as little as 0.008 ␮g TPT/L caused lesser frequency of
spawning and fecundity of Japanese medaka (Oryzia lapites; Zhang
et al., 2008).
The mechanism of toxicity of TPT is not fully known. A variety
of effects on mammals have been reported, including inhibition
156
E. Higley et al. / Aquatic Toxicology 144–145 (2013) 155–161
of oxidative phosphorylation, disruption of synthesis and degradation of sex steroids, and immunotoxicity (Kotake, 2012). TPT
is an agonist of the retinoid-X receptor (RXR) and the perixosome proliferation associated receptor gamma (PPAR␥) (Kanayama
et al., 2005). Binding of TPT to RXR or PPAR␥ caused formation
of homodimers of RXR (RXR:RXR), or heterodimers of RXR and
PPAR␥ (RXR:PPAR␥), retinoic acid receptor (RAR) (RAR:RXR), or
liver X receptor (LXR) (LXR:RXR) (Nakanishi, 2008; Grün et al.,
2006; Kotake, 2012). Although not experimentally demonstrated
for TPT, its analog tributyltin (TBT) has been shown to stimulate formation of heterodimers of RXR-PPAR␣, RXR-PPAR␦, or PPAR␥-LXR
(Grün et al., 2006; le Maire et al., 2009). These dimers are transcription factors that regulate numerous biological processes. For
example, heterodimers of PPAR and RXR regulate many aspects of
the metabolism of lipids, including ␤-oxidation and ketogenesis, in
response to fasting, metabolism of cholesterol, and differentiation
of adipocytes (Boergesen et al., 2012; Grün and Blumberg, 2006;
Hiromori et al., 2009).
Only a few studies have described effects of TPT on frogs. One
study found that the LC50 of TPT towards X. tropicalis was less than
the LC50 of TPT towards Zebrafish (Danio rerio) (Shi et al., 2012). A
study of the pool frog (Rana lessonae) and its hybrid, the green frog
(Rana esculenta) observed 62% mortality at concentrations of TPT as
little as 1.87 ␮g TPT/L (Fioramonti et al., 1997). The goal of the current study was to determine effects of short-term and long-term
exposure to TPT on the Ranid, Lithobates sylvaticus (formerly Rana
sylvatica; Frost et al., 2006) by quantifying survival, growth and
development, and changes in gene expression. L. sylvaticus is a small
frog that is freeze tolerant, lives in aquatic environments as a tadpole for the first three months of life, and then moves to the lowland
forest for the remainder of its life, only returning to small bodies of
water to breed. Continued use of TPT within the home range of L.
sylvaticus increases the likelihood of exposure (agricultural application) during sensitive early developmental life stages (tadpole
and metamorphosis). However, studies to date have not described
effects of TPT on this species. Because TPT affects metabolism of
lipids and cholesterol, and differentiation of adipocytes, it was
hypothesized that TPT would elicit effects on growth and development of L. sylvaticus.
2. Materials and methods
2.1. L. sylvaticus
Experimental procedures were approved by the University
Committee on Animal Care and Supply (UCACS) at the University
of Saskatchewan (Protocol no. 20100036). Collection of masses of
eggs of L. sylvaticus for scientific research was approved by the
Saskatchewan Ministry of Environment (Permit no. 10FW059). On
April 8, 2010, six masses of eggs of L. sylvaticus were collected
from a communal deposition site in a pond in a relatively pristine non-agricultural area near Saskatoon, SK, Canada. Eggs were
immediately transferred to the Aquatic Toxicology Research Facility at the University of Saskatchewan. Eggs were acclimated to a
light cycle of 16 h light: 8 h dark, and City of Saskatoon municipal water that was filtered, dechlorinated, and had a temperature
of 19 ◦ C, conductivity of 0.39 mS/cm, 7.3 mg of dissolved oxygen
(DO)/L, and pH of 7.9. Eggs began hatching on April 12, 2010, and
most larvae were free-swimming on April 15, 2010, at which time
exposure to TPT was initiated.
Larvae that were considered healthy (30 per tank) were placed
into 6 L of dechlorinated laboratory water with the appropriate
nominal concentration of TPT (0, 0.1, 1.0, or 5.0 ␮g TPT/L; Sigma,
Oakville, ON, Canada) dissolved in an ethanol carrier. The final concentration of ethanol in treatment tanks, including solvent controls,
was 0.0025%. All exposures were performed in triplicate. Tadpoles
were fed ad libitum daily with a slurry of Nutrafin Flake Food
and Nutrafin Max Spirulina Flakes (Rolf C. Hagen, Montreal, QC,
Canada).
Each day, a 50% static renewal of water was performed on each
tank. Measurements of water quality (temperature, DO, pH) were
recorded daily by use of an YSI Quatro Multi-Parameter probe
(Yellow Springs, OH, USA). The temperature ranged from 18.8 to
19.9 ◦ C; pH ranged from 7.9 to 8.1; and the concentration of DO in
water ranged from 7.1 to 8.7 mg of DO/L. Concentrations of ammonia nitrogen, nitrate nitrogen, and nitrite nitrogen were monitored
weekly by use of Lamotte colorimetric kits (Chestertown, MD, USA).
Concentrations of ammonia did not exceed 0.02 mg of ammonia/L;
concentrations of nitrate did not exceed 1 mg of nitrate/L; and
concentrations of nitrite did not exceed 0.02 mg of nitrite/L. Any
individuals that had died were recorded and removed from the
tanks.
2.2. Quantification of survival, growth, and development
A subset of seven tadpoles per tank was sampled after seven
days of exposure (Grosner stage 26) in order to determine effects
of short-term exposure to TPT on growth. After euthanization in an
overdose of buffered MS222 (Sigma), mass and length (measured
as snout-ventral length; SVL),were recorded for each individual.
Whole bodies were frozen at −80 ◦ C until abundances of transcripts
of genes of interest were quantified.
When an individual reached metamorphic climax, which was
determined by the emergence of forelimbs, it was euthanized in
an overdose of MS-222 (Sigma). Individuals that failed to reach
metamorphic climax by 100 days of exposure were euthanized at
that time but were not used for determination body mass, SVL, or
quantification of abundances of transcripts. For individuals that
metamorphosed, the number of days taken to reach metamorphic climax (DTM), body mass, and SVL were recorded. Livers were
excised, flash frozen in liquid nitrogen, and stored at −80 ◦ C until
abundances of transcripts of genes of interest were quantified.
2.3. Quantification of gene expression
Little information exists on the sequence of the genome or
transcriptome of L. sylvaticus. Therefore, a de novo approach to
sequencing the transcriptome of L. sylvaticus was used to generate sequences for the design of primers for quantitative polymerase
chain reaction (qPCR). Details of the sequencing approach are given
in Tompsett et al. (2013). Sequences of transcripts of interest were
used to design primers for qPCRby use of Primer3 software (Rozen
and Skaletsky, 2000). Primers were designed to amplify PCR products between 100 and 150 base pairs (Table 1).
Total RNA was isolated from livers or whole body of L. sylvaticus by use of an RNeasy Lipid Tissue Mini Kit (Qiagen, Toronto, ON,
Canada) according to the protocol provided by the manufacturer.
Immediately after extraction the concentration of RNA was determined by use of a Nanodrop ND-1000 spectrometer (Nanodrop
Technologies, Wilmington, DE) and first-strand cDNA was synthesized from 0.5 ␮g of RNA by use of a Quantitect cDNA Synthesis
Kit (Qiagen) according to the protocol provided by the manufacturer. To perform qPCR, samples of cDNA were diluted 1:5 in water
that was free of nucleases, and reactions were performed by use
of Quantitect SYBR Green Reagent (Qiagen) according to the protocol provided by the manufacturer. Briefly, a separate 50 ␮L PCR
reaction consisting of 2x SYBR Green master mix, an optimized concentration of gene-specific primers, nuclease free water, and an
optimal volume of cDNA was prepared for each sample and gene of
interest. Then, 20 ␮L of reaction mix were transferred to two wells
of a 96-well PCR plate. The qPCR was performed in an ABI 7300
E. Higley et al. / Aquatic Toxicology 144–145 (2013) 155–161
157
Table 1
Sequences of primers for quantification of abundances of transcripts in Lithobates sylvaticus.
Target transcript
Function
Sequence (5 -3 )
Retinoid X receptor alpha (rxr ˛)
Peroxisome proliferator-activated receptor alpha (ppar ˛)
Peroxisome proliferator-activated receptor delta (ppar ı)
Peroxisome proliferator-activated receptor gamma (ppar )
Cytochrome P450 4B1 (cyp4b1)
Steroyl Coenzyme A desaturase (scd)
Fatty acid synthase (fas)
d-B-hydroxybutyrate dehydrogenase mitochondrial-like (b-hb-m)
Lipoprotein Lipase (lpl)
Ribosomal protein L8
Receptor/Transcription factor
Receptor/Transcription factor
Receptor/Transcription factor
Receptor/Transcription factor
Fatty acid metabolism
Fatty acid metabolism
Fatty acid synthesis
Ketone body synthesis
Fatty acid metabolism
Reference gene
F:AGCTGCTGTTGCGTCTACCT R:GAGCTTCCAGCATCTCCATT
F:CAGCCCCGGCTCCAATGGGT R:GCCACTCTGTGCTGCTGGGAA
F:GCCCTCCCCAAGTGGAGAACA R:GCTCAGCGTGCTCTGTCACCA
F:GAGTGCGCCGATCAACGGGT R:TGTCCGTTGCCCTTCCTGTCA
F:AGGTGCTGGGAGATCGGGACA R:CCTTGCAACCCCGGGAACAGG
F:TGTGCTACTTGGGCCTTGCCA R:TCAGCCACTCCTAAGGCTTCCA
F:ACTATGGACCCACGTTCCAA R:ATCTGCAGCATTGTGTCCAG
F:CATTGCAGCCACAAGTCTGT R:GTGTCCATTCTGGCGATTTT
F:GCTGGGCCAAGTTTTGAATA R:ATGCCTATGCTACGGTCTGG
F:GGCTACATCAAGGGCATTGT R:GATACCCTCAGCCGCAATAA
Real-Time PCR System (Applied Biosystems, Burlington, ON,
Canada). The PCR reaction mixture was denatured at 95 ◦ C for
10 min before the first PCR cycle. The thermal cycle profile was as
follows: denature for 15 s at 95 ◦ C and extension for 1 min at 60 ◦ C
for a total of 40 PCR cycles. The qPCR cycle was followed by a dissociation step to validate that all only a single product was amplified in
each reaction. For each target gene, abundance of transcripts was
quantified according to the Mean Normalized Expression (MNE)
method of Simon (2003) using ribosomal protein L8 (rpl8) as a
reference gene. Efficiency of each set of primers curves was determined by use of a standard curve of serial dilutions of cDNA. For
those standard curves with a coefficient of determination (R2 ) of at
least 0.99 and efficiencies of 1.9–2.1, where efficiency = 10(-1/slope
of standard curve) , quantification of abundances of transcripts by real
time qPCR was performed with liver cDNA samples from individuals exposed to TPT. In total, qPCR was performed on16 samples
of whole body that were sampled after seven days of exposure
(four samples per treatment) and on samples of livers from 24 frogs
sampled at metamorphic climax (eight samples per treatment).
days of exposure to 5 ␮g TPT/L compared to the mass or SVL of larvae exposed to the solvent control (p < 0.001 for both weight and
SVL) (Fig. 1). Exposure to 0.1 or 1.0 ␮g TPT/L for seven days did not
affect mass or SVL (Fig. 1).
Exposure to TPT affected expression of several genes of interest. Compared to the solvent control, abundances of transcripts of
six of the 11 genes analyzed were significantly lesser in individuals exposed to TPT (Table 2). Greatest effects on abundances of
transcripts were in larvae exposed to 5 ␮g TPT/L, as fold-changes
ranged from −1.4 to −12.5. The greatest effect of TPT was on the
2.4. Statistical analysis
Statistical analyses were performed by use of IBM SPSS 19 software (IBM, Armonk, NY). Survival analysis was used to determine
average DTM. Use of survival analysis allowed for inclusion of individuals that failed to reach metamorphic climax. Normality of each
data set was assessed using the Kolomogrov–Smirnov one-sample
test and homogeneity of variance was determined using Levene’s
test. Where data met the assumptions of normality and homogeneity of variance statistical differences were evaluated by use of
ANOVA or t-test. When data did not meet these assumption statistical differences were determined by non-parametric Kruskal–Wallis
test. Mass, SVL, and DTM were analyzed by use of 1-Way ANOVA
with Dunnett’s post-hoc test. Mortality data were analyzed by
use of a Student’s t-Test. Abundances of transcripts were analyzed
using the nonparametric Kruskal–Wallis test with Mann–Whitney
U as the post-hoc test. For all analyses a p < 0.05 was considered
significant. Values for LC20 and LC50 , and their lower limits of a
one-sided 95% confidence interval, were determined as Benchmark
Dose (BMD) and Benchmark Dose Lower limit (BMDL), respectively,
by use of the Probit method (Benchmark Dose Software version 2.4
(BMDS), United States Environmental Protection Agency).
3. Results
3.1. Short-term toxicity of TPT (Gosner stage 26; 7–9 days of
exposure)
Exposure to TPT affected survival and growth of larvae of L. sylvaticus. All larvae in each exposure survived to day seven, but on day
9 the mortality of groups exposed to 5 ␮g TPT/L was 100% (data not
shown). Mass or SVL of larvae was significantly lesser after seven
Fig. 1. Mass (A) and snout-ventral-length (SVL; B) of embryos of Lithobates sylvaticus
after exposure to TPT for 7 days. Data are presented as mean ± SD of 28 individuals sampled from each exposure (7 per tank). An asterisk indicates a significant
difference from the solvent control (SC; p < 0.05).
158
E. Higley et al. / Aquatic Toxicology 144–145 (2013) 155–161
Table 2
Fold-change in abundances of transcripts in liver from Lithobates sylvaticus exposed to TPT for 7 days and until metamorphosis.
Transcript
rxr˛
ppar˛
pparı
ppar
cyp4b1
scd1
cpt1a
Fas
ˇ-hb-m
Lpl
Day 7
Day 100
[TPT] (␮g/L)
[TPT] (␮g/L)
0.1
1
5
0.1
1
−2.1 (0.3)
−2.0 (0.3)
ND
ND
ND
ND
ND
ND
−3.0 (0.3)
−1.8 (0.3)
−1.5 (0.2)
−1.4 (0.1)
ND
ND
ND
ND
ND
ND
−1.8 (0.4)
ND
−4.4 (0.8)
−2.8 (0.3)
ND
ND
ND
−7.7 (0.1)
ND
−12.5 (3.2)
−5.3 (0.7)
−1.7 (0.3)
ND
5.8(3.0)
ND
ND
1.8 (0.4)
ND
ND
ND
ND
ND
ND
13.5 (7.8)
ND
3.5 (1.2)
2.0 (0.3)
ND
ND
8.2 (3.1)
ND
5.3 (1.5)
Abundances of transcripts are expressed as fold-change relative to ethanol solvent control. Data in parenthesis are standard error. For the 7 day exposure, n = 4 per treatment.
For the 100 day exposure, n = 8 per treatment. Only statistically significant data is presented. ND indicate a non-statistically significant difference from control (p > 0.05).
abundance of transcripts of fas which was significantly lesser by
−12.5-fold, compared to the abundance in individuals exposed to
the solvent control. Abundances of transcripts of rxr˛, ppar˛, and
d-bhb-ml were significantly lesser in individuals exposed to either
concentration of TPT. Abundances of transcripts of scd1 and fas were
significantly lesser only in individuals exposed to 5 ␮g TPT/L. Abundances of transcripts of pparı, ppar␥, cyp4b1, cpt1a, and app4 were
not significantly different in individuals exposed to TPT.
different from that of individuals exposed to the solvent control (Fig. 3). Days to metamorphosis (mean ± SD) of individuals
exposed to the solvent control, 0.1, or 1.0 ␮g TPT/L was 90.9
(±3.3), 83.2(±5.0), or 70.5(±2.7) days, respectively, but only
the DTM of individuals exposed to 1 ␮g TPT/L was significantly
3.2. Long-term toxicity of TPT (metamorphic climax; 100 days of
exposure)
Exposure to TPT for as long as100 days had a significant effect
on mortality of L. sylvaticus. Mortalities of groups exposed to the
solvent control, 0.1, 1.0, or 5.0 ␮g TPT/L was 9.7%, 26.2%, 80.0%, or
100%, respectively (Fig. 2). Mortalities of groups exposed to 1.0 or
5.0 ␮g TPT/L were significantly greater than mortalities of groups
exposed only to carrier solvent. The LC20 or LC50 after 100 days of
exposure was 0.12 (lower 95% CI = 0.07) or 0.34 (lower 95% CI = 0.24)
␮g TPT/L, respectively.
Development, but not growth, of L. sylvaticus was significantly
affected after as long as 100 days of exposure to TPT. Average mass
and SVL of individuals that reached metamorphic climax during
exposure to either concentration of TPT was not significantly
Fig. 2. Mortality of L. sylvaticus after exposure to TPT for 100 days. Data are presented
as mean ± SD of 4 tanks, and there were 30 individuals per tank at the initiation of
the exposure. An asterisk indicates a significant difference from the solvent control
(SC; p < 0.05). Mortality of all individuals exposed to 5 ␮g TPT/L occurred on Day 9
of the exposure.
Fig. 3. Mass (A) and snout-ventral-length (SVL; B) of L. sylvaticus that reached metamorphic climax by 100 days of exposure to TPT. Data are presented as mean ± SD
of 40, 32, or 13 individuals exposed to control water, 0.1 ␮g TPT/L, or 1.0 ␮g TPT/L.
There were no significant effects on either endpoint (p < 0.05).
E. Higley et al. / Aquatic Toxicology 144–145 (2013) 155–161
Fig. 4. Average number of days to metamorphosis of L. sylvaticus exposed to TPT for
100 days. Data are presented as mean ± SD of 44, 39, or 13 individuals that reached
metamorphic climax during exposure to control water, 0.1 ␮g TPT/L, or 1.0 ␮g TPT/L.
An asterisk indicates a significant difference from the solvent control (SC; p < 0.05).
lesser than that of individuals exposed to the solvent control
(Fig. 4).
Abundances of 5 of the 11 transcripts were significantly greater
in livers from individuals of L. sylvaticus that reached metamorphic
climax during exposure to TPT (Table 2). Abundances of transcripts
of ppar˛ and cyp4b1 were greater in individuals exposed to 0.1
or 1.0 ␮g TPT/L. Abundances of transcripts of ppar, fas, and lpl
were significantly greater in individuals exposed to 1.0 ␮g TPT/L.
The greatest change in abundance of transcripts was for ppar˛,
which was greater by 13.5-fold. Abundances of transcripts of rxr˛,
pparı, cpt1a, d-bhb-ml, and scd were not different between individuals exposed to TPT or individuals exposed to the solvent
control.
4. Discussion
4.1. Effects on TPT on survival, growth, and time to
metamorphosis
Sensitivity of L. sylvaticus to TPT was similar to that previously
reported for other species of Ranids. The LC20 and LC50 of TPT were
within the range of concentrations of TPT in aquatic environments
(Fent et al., 1991; Jones-Lepp et al., 2004). Effects of TPT on development through to metamorphosis has been investigated in the pool
frog (R. lessonae) and the green frog (R. esculenta) (Fioramonti et al.,
1997). In that study, approximately 62% of tadpoles failed to survive
exposure to 1.87 ␮g TPT/L for 30 days, which is similar to the 80%
mortality of tadpoles exposed to 1 ␮g TPT/L in the current study.
The trend towards greater body mass and SVL at metamorphosis
of individuals exposed to 1 ␮g TPT/L compared to controls is similar to the greater body mass of R. lessonae or R. esculenta exposed
to 1.87 ␮g TPT/L (Fioramonti et al., 1997). However, lesser time to
metamorphosis of L. sylvaticus that survived exposure to 1 ␮g TPT/L
compared to controls is a contrast to the greater time to metamorphosis of R. lessonae or R. esculenta exposed to 0.81 or 1.87 ␮g TPT/L
(Fioramonti et al., 1997).
There are a limited number of studies that investigated effects
of TPT on species of amphibians that are not ranids. However,
comparing effects of TPT on survival, growth, or development of
L. sylvaticus to these species is difficult because of differences in
the design of studies, including the stage of development at initiation of the exposure, duration of the exposure (acute vs. chronic),
159
time at which measurements were made, and endpoints assessed.
For example, sensitivity of X. tropicalis to TPT as assessed by mortality was greater than sensitivity of L. sylvaticus. The 72 h LC50 of
TPT was 5.25 ␮g/L for embryos of X. tropicalis (Yu et al., 2011) but
a 72 h LC50 could not be determined in the current study as no
mortalities occurred at this time point. In contrast, when comparing effects on growth, exposure to TPT had a greater effect on L.
sylvaticus (70% lesser mass of tadpoles exposed to 5 ␮g TPT/L compared to controls for seven days) than X. tropicalis (30% lesser mass
of larvae exposed to 5 ␮g TPT/L for three days; Yu et al., 2011).
However, differences in the duration of exposure make it difficult
to interpret these results. When compared to a study of effects of
TPT on the streamside salamander (Ambystoma barbouri), L. sylvaticus were more sensitive. While approximately 93% of larvae of A.
barbouri exposed to 5 ␮g TPT/L failed to survive the larval period
of 85 days with no effect on survival at 1 ␮g/L, exposure of wood
frogs to 1 or 5 ␮g/L resulted in 80 and 100% mortality between
days nine and 100, respectively. Furthermore, in contrast to the
current study (100% mortality after nine days of exposure in the
5 ␮g/L group), greatest mortality of A. barbouri was not observed
until days 16–19, and the percentage of mortality until 10 days of
exposure was less than 10%, suggesting that L. sylvaticus is more
sensitive to TPT than is A. barbouri (Rehage et al., 2002). Time to
metamorphosis of A. barbouri exposed to 1 ␮g TPT/L was greater
than controls (Rehage et al., 2002), which is a contrast to lesser
time to metamorphosis of L. sylvaticus that survived exposure to
1 ␮g TPT/L.
4.2. Mechanisms of effects of TPT
Lesser survival and DTM of L. sylvaticus exposed to TPT might
have been caused, in part, by effects on physiological processes
that are regulated byRXR or PPAR. TPT is an agonist of both RXR
and PPAR␥, and dimers formed by activation of these receptors
are ligand-activated transcription factors that regulate a variety of physiological processes (Kanayama et al., 2005; Nakanishi,
2008; Grün et al., 2006; Kotake, 2012). Lesser abundances of transcripts of ppar˛ or rxr˛ after seven days of exposure to either
concentration of TPT are evidence that processes that are regulated by these receptors might have been disrupted. The greatest
effects on these receptors were in larvae exposed to 5 ␮g TPT/L,
all of which died on day 9 of the exposure. This result is consistent with another study where the abundance of transcripts
of rxr˛ was lesser in X. tropicalis exposed to 5 ␮g TPT/L for 48 h
(Yu et al., 2011). In contrast, in livers from animals sampled at
metamorphosis, abundances of transcripts of rxr˛ were not different but abundances of transcripts of ppar˛ or ppar were
significantly greater compared to controls. Greater expression of
PPAR˛ or PPAR genes in L. sylvaticus exposed to TPT for extended
periods might be an adaptive response that is important for
growth.
Dimers formed by binding of TPT to RXR or PPAR␥ are important for regulating metabolism of lipids (Lala et al., 1996; Kanayama
et al., 2005; Ziouzenkova and Plutzky, 2008; Kotake, 2012). Accumulation of body mass is dependent on the accretion of fat mass
by greater synthesis and storage of fatty acids, lesser lipolysis
in adipocytes, and differentiation of adipocytes, (Auwerx, 1999;
Zhang and Mangelsdorf, 2002; Ferré, 2004). Activation of RXRPPAR␥ or RXR-LXR heterodimers increases expression of genes that
promote storage of fatty acids and differentiation of adipocytes
(Grün and Blumberg, 2006; Wagner and Wagner, 2010). Lesser
abundances of transcripts of scd1, fas, or lpl in embryos exposed to
5 ng TPT/␮l for seven days supports the hypothesis that impaired
synthesis of lipids might have contributed to the lesser weight
and SVL at day seven, and the 100% mortality on day nine.
SCD1 is a delta-9 fatty acid desaturase that catalyzes synthesis of
160
E. Higley et al. / Aquatic Toxicology 144–145 (2013) 155–161
monounsaturated fatty acids required for synthesis of phospholipids, triglycerides, cholesterol esters, and wax esters (reviewed in
Ntambi and Miyazaki, 2003). FAS catalyzes synthesis of saturated
fatty acids, myristate, palmitate, and stearate that are important
substrates for formation of very long chain fatty acids that are
important constituents of sphingolipids, ceramides, and glycolipids
that are components of cell membranes and are needed for cell division, brain structures, and neurological functions (Spector, 1999;
Jensen-Urstad and Semenkovich, 2012). LPL, which is a target of
PPAR␣ or PPAR␥, catalyses the hydrolysis of triglycerides in plasma
lipoproteins, generating fatty acids and monoglycerides that are
taken up by tissues and can be used for the generation of structural components of cells (Schoonjans et al., 1996; Wang and Eckel,
2009). Impaired synthesis of lipids is consistent with a mechanism
of toxicity of organotin compounds caused by interference with
membrane structure and function (Ortiz et al., 2005). In contrast,
abundances of transcripts of scd1, fas, or lpl were not lesser in livers
from animals exposed to TPT through to metamorphosis. Greater
abundances of transcripts of fas or lpl in livers from animals exposed
to 1 ␮g TPT/L suggest that if there is greater synthesis of lipids in
these animals it might be an adaptive response to chronic exposure
to TPT that is important for growth and survival.
Lesser survival might also have been the result of impaired ability to derive energy from lipids. In addition to being required for the
deposition of fat and as structural components of membranes, lipids
are an important source of energy during development. For example, embryos of Xenopus laevis hatch with great quantities of yolk
and abstain from feeding for several days post-hatch while reserves
of lipid are being depleted (Territo and Smits, 1998). During early
stages of development there is rapid decline in amounts of triglycerides and fatty acid as lipids fuel greater than 75% of the total body
energy for respiration (Territo and Smits, 1998). PPAR␣ and PPAR␦
play opposing roles to PPAR␥ by inducing fatty acid catabolism that
lessens concentrations of triglycerides in blood and reduces storage
of lipids in liver, muscle, and adipose tissue (Grün and Blumberg,
2006; Wagner and Wagner, 2010). TPT might have affected survival
of embryos exposed to 5 ␮g TPT/L by impairing the oxidation of
fatty acids that is important for supplying energy needed for growth
and survival. Before very long chain fatty acids can enter the mitochondrion for ␤-oxidation they must be shortened by enzymes of
␤-oxidation in perixosomes (Reddy and Hashimoto, 2001). Lesser
abundances of transcripts of PPARs might have inhibited proliferation of perixosomes, thereby impairing the capacity for generation
of ATP required to fuel processes required survival and growth of
L. sylvaticus.
Adaptive responses that allow for greater catabolism of lipids
might have been important for survival of organisms exposed long
term to TPT, and for the lesser time to metamorphosis. Greater
abundance of transcripts of ppar˛ and ppar in livers from animals
that reached metamorphic climax during exposure to 1 ␮g TPT/L
for up to 100 days might be indicative of greater ability to derive
energy from lipids resulting from proliferation of perixosomes
and ␤-oxidation. This position is supported by the greater abundances of transcripts of cyp4b1. Expression of the CYP4B gene is
up-regulated by activation of PPAR␣. The CYP4B enzyme metabolizes short chain fatty acids (C7 –C9 ) to dicarboxylic acids that are
directed to the mitochondria for complete ␤-oxidation (reviewed
in Hardwick, 2008). In addition, ketogenesis, which is regulated
by PPAR␣, might have been impaired in embryos exposed to
TPT for seven days. Impairment of ketogenesis is suggested by
the lesser abundance of transcripts of r ˇ-hb-m, the enzyme
product of which converts acetoacetate to ␤-hydroxybutyrate.
When carbohydrates are not available for use in energy deriving
metabolic reactions, energy can be derived from the metabolism
of ketone bodies generated from acetyl-CoA that results from ␤oxidation.
5. Conclusions
Concentrations of TPT that are found in the environment are
toxic to the Ranid, L. sylvaticus. There is little information regarding
the toxicity of TPT to species of amphibians, but results suggest
that L. sylvaticus is as sensitive as other species of Ranids that have
been studied to date other species studied to date. Effects of TPT on
survival and development of L. sylvaticus might be due to effects on
metabolism of lipids because abundances of transcripts of several
genes that encode receptor proteins and enzymes important for
the metabolism of lipids were significantly altered in organisms
exposed to TPT.
Acknowledgements
This research was supported by a Discovery Grant from the Natural Science and Engineering Research Council of Canada to J.P.
Giesy (Project no. 326415-07) and M. Hecker (Project no. 37185412) and grants from Western Economic Diversification Canada
(Project no. 6578 and 6807). The authors wish to acknowledge
the support of an instrumentation grant from the Canada Foundation for Innovation. J.P. Giesy and M. Hecker were supported
by the Canada Research Chair program. J.P. Giesy was supported
by Distinguished Visiting Professorship at the Department of Biology and Chemistry and State Key Laboratory in Marine Pollution,
City University of Hong Kong and the Einstein Professor Program
of the Chinese Academy of Sciences. The authors acknowledge the
support of the Aquatic Toxicology Research Facility (ARTF) at the
Toxicology Centre, University of Saskatchewan, in providing space
and equipment for the exposure study. The authors would like to
thank Sara Pryce for her diligent work in the laboratory.
References
Auwerx, J., 1999. PPARgamma, the ultimate thrifty gene. Diabetologia 42,
1033–1049.
Boergesen, M., Pedersen, T.Å., Gross, B., van Heeringen, S.J., Hagenbeek, D.,
Bindesbøll, C., Caron, S., Lalloyer, F., Steffensen, K.R., Nebb, H.I., Gustafsson, J.Å.,
Stunnenberg, H.G., Staels, B., Mandrup, S., 2012. Genome-wide profiling of liver
X receptor, retinoid X receptor, and peroxisome proliferator-activated receptor ␣ in mouse liver reveals extensive sharing of binding sites. Molecular and
Cellular Biology 32, 852–867.
Fent, K., Hunn, J., 1991. Phenyltins in water, sediment, and biota of freshwater marinas. Environmental Science & Technology 25, 956–963.
Ferré, P., 2004. The biology of peroxisome proliferator-activated receptors: relationship with lipid metabolism and insulin sensitivity. Diabetes 53, S43–S50.
Fioramonti, E., Semlitsch, R.D., Reyer, H.-U., Fent, K., 1997. Effects of triphenyltin
and pH on the growth and development of Rana lessonae and Rana esculenta
tadpoles. Environmental Toxicology and Chemistry 16, 1940–1947.
Frost, D.R., Grant, T., Faivovich, J., Bain, R.H., Haas, A., Haddad, C.F.B., de Sa, R.O., Channing, A., Wilkinson, M., Donnellan, S.C., Raxworthy, C.J., Campbell, J.A., Blotto,
B.L., Moler, P., Drewes, R.C., Nussbaum, R.A., Lynch, J.D., Green, D.M., Wheeler,
W.C., 2006. The amphibian tree of life. Bulletin of the American Museum of
Natural History 297, 1–37.
Grube, A., Donaldson, D., Kiely, T., Wu, L., 2011. Pesticides Industry Sales and Usage:
2006 and 2007 Market Estimates. Biological and Economic Analysis Division,
Office of Pesticide Programs, Office of Chemical Safety and Pollution Prevention,
U.S. Environmental Protection Agency, Washington, DC.
Grün, F., Watanabe, H., Zamanian, Z., Maeda, L., Arima, K., Cubacha, R., Gardiner,
D.M., Kanno, J., Iguchi, T., Blumberg, B., 2006. Endocrine-disrupting organotin compounds are potent inducers of adipogenesis in vertebrates. Molecular
Endocrinology 20, 2141–2155.
Grün, F., Blumberg, B., 2006. Environmental obesogens: organotins and endocrine
disruption via nuclear receptor signaling. Endocrinology 147, S50–S55.
Hardwick, J.P., 2008. Cytochrome P450 omega hydroxylase (CYP4) function in
fatty acid metabolism and metabolic diseases. Biochemical Pharmacology 75,
2263–2275.
Hiromori, Y., Nishikawa, J., Yoshida, I., Nagase, H., Nakanishi, T., 2009. Structure dependent activation of peroxisome proliferator-activated receptor (PPAR)
gamma by organotin compounds. Chemical Biological Interactions 180,
238–244.
Jensen-Urstad, A.P.L., Semenkovich, C.F., 2012. Fatty acid synthase and liver triglyceride metabolism: housekeeper or messenger? Biochimica et Biophysica Acta,
Molecular and Cell Biology of Lipids 1821, 747–753.
E. Higley et al. / Aquatic Toxicology 144–145 (2013) 155–161
Jones-Lepp, T.L., Varner, K.E., Heggem, D., 2004. Monitoring dibutyltin and triphenyltin in fresh waters and fish in the United States using micro-liquid
chromatography–electrospray/ion trap mass spectrometry. Archives of Environmental Contamination and Toxicology 46, 90–95.
Kanayama, T., Kobayashi, N., Mamiya, S., Nakanishi, T., Nishikawa, J., 2005. Organotin
compounds promote adipocyte differentiation as agonists of the peroxisome
proliferator-activated receptor gamma/retinoid X receptor pathway. Molecular
Pharmacology 67, 766–774.
Kotake, Y., 2012. Molecular mechanisms of environmental organotin toxicity in
mammals. Biological and Pharmaceutical Bulletin 35, 1876–1880.
Lala, D.S., Mukherjee, R., Schulman, I.G., Koch, S.S., Dardashti, L.J., Nadzan, A.M.,
Croston, G.E., Evans, R.M., Heyman, R.A., 1996. Activation of specific RXR heterodimers by an antagonist of RXR homodimers. Nature 383, 450–453.
le Maire, A., Grimaldi, M., Roecklin, D., Dagnino, S., Vivat-Hannah, V., Balaguer, P.,
Bourguet, W., 2009. Activation of RXR-PPAR heterodimers by organotin environmental endocrine disruptors. EMBO Reports 10, 367–373.
Nakanishi, T., 2008. Endocrine disruption induced by organotin compounds; organotins function as a powerful agonist for nuclear receptors rather than an
aromatase inhibitor. The Journal Toxicological Sciences 33, 269–276.
Ntambi, J.M., Miyazaki, M., 2003. Recent insights into stearoyl-CoA desaturase-1.
Current Opinion in Lipidology 14, 255–261.
Ortiz, A., Teruel, J.A., Aranda, F.J., 2005. Effect of triorganotin compounds on membrane permeability. Biochimica et Biophysica Acta 1720, 137–142.
Reddy, J.K., Hashimoto, T., 2001. Peroxisomal beta-oxidation and peroxisome
proliferator-activated receptor alpha: an adaptive metabolic system. Annual
Review of Nutrition 21, 193–230.
Rehage, J.S., Lynn, S.G., Hammond, J.I., Palmer, B.D., Sih, A., 2002. Effects of larval
exposure to triphenyltin on the survival, growth, and behavior of larval and juvenile Ambystoma barbouri salamanders. Environmental Toxicology and Chemistry
21, 807–815.
Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods
and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp.
365–386.
Schoonjans, K., Peinado-Onsurbe, J., Lefebvre, A.M., Heyman, R.A., Briggs, M., Deeb,
S., Staels, B., Auwerx, J., 1996. PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoproteinlipase
gene. EMBO Journal 15, 5336–5348.
161
Shi, H., Zhang, X., Yu, L., Yuan, J., Sun, Z., 2012. Interaction of triphenyltin and an
agonist of retinoid X receptor (LGD1069) in embryos of Xenopus tropicalis. Environmental Toxicology and Pharmacology 34, 714–720.
Simon, P., 2003. Q-gene: processing quantitative real-time RT-PCR data. Bioinformatics 19, 1439–1440.
Spector, A.A., 1999. Essentiality of fatty acids. Lipids 34, S1–S3.
Territo, P.R., Smits, A.W., 1998. Whole-body composition of Xenopus laevis larvae:
implications for lean body mass during development. Journal of Experimental
Biology 201, 1013–1022.
Tompsett, A., Wiseman, S., HigleyH. Higley, E., Giesy, J.P., Hecker, M., 2013. Effects
of exposure to 17␣-ethynylestradiol during development on growth, sexual differentiation, and hepatic gene expression in larval wood frogs (Rana sylvatica).
Aquatic Toxicology 126, 42–52.
Wagner, K.D., Wagner, N., 2010. Peroxisome proliferator-activated receptor beta/delta (PPARbeta/delta) acts as regulator of metabolism linked
to multiple cellular functions. Pharmacology and Theraputics 125,
423–435.
Wang, H., Eckel, R.H., 2009. Lipoprotein lipase: from gene to obesity. American
Journal of Physiology: Endocrinology and Metabolism 297, E271–E288.
Yi, X.L., Leung, K.M.Y., Lam, M.H.W., Lee, J.S., Giesy, J.P., 2012. Review of measured concentrations of triphenyltin compounds in marine ecosystems and
meta-analysis of risks to humans and the environment. Chemosphere 89,
1015–1025.
Yu, L., Zhang, X., Yuan, J., Cao, Q., Liu, J., Zhu, P., Shi, H., 2011. Teratogenic effects
of triphenyltin on embryos of amphibian (Xenopus tropicalis): a phenotypic
comparison with the retinoid X and retinoic acid receptor ligands. Journal of
Hazardous Materials 192, 1860–1868.
Zhang, Y., Mangelsdorf, D.J., 2002. LuXuRies of lipid homeostasis: the unity of nuclear
hormone receptors, transcription regulation, and cholesterol sensing. Molecular
Interventions 2, 78–87.
Zhang, Z., Hu, J., Zhen, H., Wu, X., Huang, C., 2008. Reproductive inhibition
and transgenerational toxicity of triphenyltin on medaka (Oiyzias latipes) at
environmentally relevant levels. Environmental Science and Technology 42,
8133–8139.
Ziouzenkova, O., Plutzky, J., 2008. Retinoid metabolism and nuclear receptor
responses: new insights into coordinated regulation of the PPAR-RXR complex.
FEBS Letters 582, 32–38.