Cell, Vol. 52, 831-841. March 25, 1988. CopyrIght 0 1988 by Cell Press In Transgenic Mice the Introduced Functional T Cell Receptor p Gene Prevents Expression of Endogenous Yasushi Uematsu; Stefan Ryser,*t Peter Borgulya,’ Paul Krimpenfort,* Harald von Boehmer,*§ and Michael * Easel Institute for Immunology CH-4005 Basel, Switzerland r Central Research Units F. Hoffmann-La Roche & Co. Ltd. CH-4002 Basel, Switzerland *Division of Molecular Genetics, The Netherlands Cancer Institute and Department of Biochemistry, University of Amsterdam Plesmanlaan 121 1066 CX Amsterdam, The Netherlands Zlatko Dembid,‘t Anton Berns,l Steinmetz’t Summary Transgenic mice were constructed with a functional T cell receptor B gene. Transcription of the introduced gene is largely confined to T cells, but low levels of transcripts are also seen in B cells and in other tissues. Serological analyses show that most, if not all, of the T lymphocytes express the transgenic p chain on the cell surface and lack p chains encoded by endogenous p genes. Molecular genetic analyses of uncloned and cloned T lymphocytes demonstrate that rearrangement of endogenous p genes is incomplete. Partial D~l.l~l rearrangements are found preferentially, while complete VDJ rearrangements are not seen. These findings show that expression of the transgene regulates the rearrangement of endogenous b genes. Although the af3 T cell receptors of the transgenic mice are homogeneous with respect to the b chain, they are fully functional, at least in a variety of allogeneic responses. Introduction The T cell receptor expressed on the cell surface of the majority of T lymphocytes is composed of a and 8 glycoproteins, The disulfide-linked a8 heterodimer is noncovalently associated with at least four different additional proteins forming the CD3 complex (for review, see Allison and Lanier, 1987a). With gene transfer experiments it has been shown (Dembic et al., 1986; Gabert et al., 1987; Saito et al., 1987) that the a and 8 chains of a given T cell receptor are necessary and sufficient for the recognition of its ligand, usually a peptide associated on the surface of the antigen-presenting cell with a class I or class II molecule of the major histocompatibility complex. The CD3 components require the a8 heterodimer for cell-surface expres§On sabbatical leave at the Massachusetts lnstltute of Technology, Center of Cancer Research, Cambridge, Massachusetts. p Genes sion and may be involved in signal transduction (for review, see Weiss et al., 1986). The a8 heterodimer forms the receptor on helper and cytotoxic T lymphocytes. It has recently been shown that less than 5% of peripheral T lymphocytes in mice and humans do not express the a(3 heterodimer, but contain a distinct y6 heterodimer. The antigen specificity of these cells is not known (for review, see Allison and Lanier, 1987b). T cell receptor a and 8 chains are members of the immunoglobulin superfamily and are encoded by genes that are formed by DNA rearrangements during T cell differentiation (for review, see Kronenberg et al., 1986). Modes of DNA rearrangement, gene segment organization, and signal sequences important for rearrangement are similar for T cell receptor and immunoglobulin genes. It is believed that both gene families share a common ancestry. In the mouse, the T cell receptor a gene family is composed of about 100 variable (Va), about 50 joining (Ja), and a single constant (Ca) gene segment. The murine 8 gene family contains at least 21 Vg, 2 diversity (08), 12 functional Jo, and two C8 gene segments spread out over at least 450 kb of DNA (Lai et al., 1987; Chou et al., 1987). The D8, Jf3, and Co gene segments are organized into two clusters containing the D81; 6 functional J81, C81, and D82; 6 functional J82; and the C82 gene segment, in this order. During T cell differentiation in the thymus, 8 chain gene segments appear to be rearranged before a (for review, see Born et al., 1987). Assembly of a functional 8 chain gene involves 08 to J8 joining followed by V8 gene segment rearrangement and deletion of intramolecular DNA sequences (Okazaki et al., 1987). Partially (DJ) and fully (VDJ) rearranged 8 genes are transcribed to yield 1.0 and 1.3 kb RNA molecules, respectively. Because the formation of an open reading frame by rearrangement is a stochastic event, T lymphocytes will often contain nonfunctionally rearranged T cell receptor a and 8 chain genes. T cells containing two functional a or 8 alleles have not been found, and it is therefore assumed that like immunoglobulin genes, T cell receptor genes are subject to allelic exclusion. Transgenic mice, obtained by experimental integration of foreign genetic material into germ-line DNA, provide an excellent system for studying gene regulation and function (for review, see Palmiter and Brinster, 1986). More specifically, transgenic mice produced with immunoglobulin light and heavy chain genes have been used to study mechanisms of gene segment rearrangement and allelic exclusion, tissue specificity of expression, somatic hypermutation, and repertoire development (for review, see Storb, 1987). It has been found that immunoglobulin transgenes are specifically expressed in B cells, with the exception of w heavy chain transgenes, which are also expressed in T lymphocytes. The introduction of functional immunoglobulin genes into transgenic mice clearly affects the formation of functional endogenous immunoglobulin genes, although a complete inhibition of the syn- Cell 832 0A Figure 1 Structure of the T Cell Receptor D APIGAGGACTTTCCCACACCcAGcccTATTTAcTc~TAcAGccATcTccccTTcTATTGA Transgene (A) Nucleotlde sequence of the variable region G~GG-GGGCTGAGACTAAGGTCCAGTACTACAGAGAGCCTAGTGGGAGT~CAGTA of the transgene as determmed by sequencing TCAACAGATCAC,GACcTcAG~TcTGAcATcAcAGGc~TGATGATAGGAGGAG~GG 5’“T - I ~ LS.1 AGGAGCTGACTCCTGCTcTcTcAcc~GAGAccATATccTAGAGG~GcATGTcT~cA CTGCCTTcCCTGACCCCGCCTGG~cAccAcccTGcTATcTTGGGTTGcTcTcTTTcTcc - I _ “LIB.2 TGGG~CAAAACACATGG*GGCTGCAGTCACCCAA ATCGGCAGGACAcGGGGCATGGGcTGAGGcTGATccATTATTcATATGGTGcTGGcAGcA CCCTCATTCTGGAGTTGGCTACCCCCTCTCAGACATCAGTGTACTTCTGTGCCAGCGGTG - I 082 a full-length cDNA clone. The 5’ untranslated region (5’UT). VI)5 1 leader sequence (L5 1). VP8 2 gene segment, D112 sequence with assoclated N regions, and the first nucleotldes of the J[12 3 gene segment are shown The complementary strand of the VDJ ollgonucleotlde used as a specific hybridization probe IS underlined (B) Organuabon of cosmld clone cos HY119-1 14-5 containing the transgene. The wsmld clone was constructed by using DNA fragments dewed from the 862 16 clone i.9 and the BALB/c liver clone cos H-2dll-1 14T as descrtbed in Expertmental Procedures T cell receptor Ii gene segments that are known to be located on the cosmld clone are Indicated IJb2.3 ATAACAGTGCAGMACGCTGT 0B thesis of endogenous immunoglobulin molecules has not been found. Levels of immunoglobulin polypeptides encoded by the transgenes appear to influence the extent of allelic exclusion. Whether immunoglobulin molecules block rearrangement directly or indirectly via intracellular or intercellular interaction 1s not clear. In our experiments, we address the question of whether transgenic mice with homogeneous expression of defined T cell receptor polypeptides can be produced. Using a functionally rearranged fi gene, we demonstrate that this is the case, and we analyze the transgenic mice for tissue specificity of transgene expression, endogenous 11 gene rearrangements, and T cell receptor function. Results A Functionally Rearranged [J Gene from a Male Antigen-Specific, H-2Db-Restricted Cytotoxic T Cell Clone The source of the functionally rearranged T cell receptor [1 gene used In this study is a cytotoxic T cell clone, called B6.2.16. Clone B6.2.16 lyses male but not female C57BL/6 cells and IS restricted by the H-2Db molecule. This clone was chosen because its T cell receptor fl chain can be identified by the monoclonal antibody F23.1 (Staerz et al., 1985) which binds to antigenic determinants on all three members of the Vii8 family (Behlke et al., 1987). Screening of cDNA and genomic lrbraries with a V() probe yielded a full-length 6 chain cDNA clone and genomic clones containing two different fi alleles. DNA sequence determination of the cDNA clone (Figure 1A) showed that it was derived from a functionally rearranged I) gene composed of the V(15.1 leader, V(18.2; a short portion of the 0112 segment, J(i2.3; and the Cl12 gene segment. One of the two 1) alleles, isolated In clones 1,8 and h9, corresponds to the cDNA clone. Characterizatron of clone h8 by restriction mapping and DNA sequencing showed that it contains the rearranged Vh8.2 gene about 100 bp downstream of an apparently inactive Vf18.2 leader exon, while the V[E.l leader sequence is located about 2.5 kb farther upstream (Figure 1B). Splicing of the Vfj5.1 leader exon to the Vfj8.2 exon in T cells derived from C57BL16 mice has been described by Chou et al. (1987). The second 11 allele in B6.2.16 contains an Incomplete Df%l-Ji12.5 rearrangement (not shown). For the production of transgenic mice, we wanted to In- Transgenlc 833 Mice with a T Cell Receptor (I Gene Table 1 Transgemc Mica Founder OffsprIng SEX” COPY Numb& Transgene TranscriptIon T Cell Surface ExpresslonC 93.1 93.2 93.4 93.9 m f f f m m m f m f m m 1 20 10 5 0 20 2 20 3 2 2 2 ND ND + ND + + + + + + ND 1ova-20% l OV-20% ND >98% ND >98% >98% >98% ND >98% ND ND 90 91 92 93 94 95 95.39 95 40 a Sex is indicated by m (male) and f (female). b Copy number of the transgene was estimated from signal lntensltles on Southern blots with Pvull-dlgested tall DNA hybridized c Surface expression of F23.1.positive p chains on lymph node T cells was quantitated by FACS analysis. ND, not determined. ject the functionally rearranged j3 gene with long 5’ and 3’ flanking sequences, because initial experiments (not shown) with clone 18 containing only 1.2 kb of 5’ and 3 kb of 3’ flanking sequence failed to give expression in nine independently obtained transgenic mice. We speculated that lack of expression could be due to a missing regulatory element. Therefore, clone h9 containing the functionally rearranged Vj3 gene together with 9 kb of 5’ flanking sequence was fused at the unique Sacll site in the J(32 gene cluster to a cosmid clone derived from BALBlc liver DNA containing the C8 locus together with 18 kb of 3’ flanking sequence. Thus a new cosmid clone (cos HY891.145) for the functionally rearranged 8 gene was constructed, as shown in Figure 1B. Transgenic Mice Express the Introduced T Cell Receptor p Gene The insertion of this cosmid clone was excised and injected into pronuclei or fertilized eggs obtained after mating of (CBAIBrA x C57BL/LiA)F, mice. Thirteen pups were born that contained from 1 to about 50 copies of the transgene, according to Southern blot analysis of tail DNA. Of these mice, seven were analyzed after splenectomy for transcription with an oligonucleotide probe that covered the VDJ joining region and that was therefore specific for the transgene. Six of the seven mice showed a 1.3 kb full-length transcript. As observed before for other transgenes, no simple correlation between copy number and transcriptional activity was seen. T lymphocytes obtained from lymph nodes of four transgenic mice were subsequently analyzed for cell-surface expression of the transgenic 6 chain on a fluorescence-activated cell sorter (FACS) by using F23.1 antibodies (Table 1). While about lo%-20% of T cells were F23.1-positive in mice 90 and 91, practically all of the T cells from mice 93 and 95 were stained with the F23.1 antibody. This indicates that most, if not all, of the T cells in mice 93 and 95 express the transgenie 6 chain on the cell surface. Since a background of about lo%-20% F23.1-positive T lymphocytes is ex- with the Jp2 probe. kb JP2 Figure 2. Southern Blot Analysis of Offspring Mice Dewed Cross of the Female Transgenic Mouse 93 wth C57L Males from a From 18 pups born, this blot shows the analysis of 9 mice It demonstrates the inheritance of the transgene (indicated by the 7.7 kb band) m either 2 (mice 93.3, 93.4, 93.7) or 20 (mice 93.2, 93.9) copies. Mice 93.5, 93.6, 93.8, and 93.10 did not inherit the transgene. Addittonal offspring mice 93.1, 93.12, 93 13, 93.16, 93 18 did not; 93.14 and 93.15 inherited 2; and 93.11 inherlted 20 copies (not shown). The 5.5 kb band represents the endogenous b locus. Southern blot analysis of Pvulldigested tall DNA was carried out as described In Experimental Procedures, with a Ja2 probe. petted for these mouse strains (Staerz et al., 1985) it is unlikely that the transgenic 6 chain is expressed in mice 90 and 91. In agreement with the FACS analysis and our interpretation, Northern blot analysis did not show any transgene transcription in T lymphocytes of mouse 90 (Table 1). The male founder mouse 93 was subsequently crossed with female C57L mice (a F23.1-negative mouse strain; Behlke et al., 1986). Eighteen offspring mice from the first generation were analyzed for the inheritance of the transgene by Southern blot hybridization. Three (1 male, 2 females) contained about 20 copies of the transgene, 5 (4 males, 1 female) contained about 2 copies, and 10 lacked the transgene (Figure 2). The segregation of the transgene into 2 and 20 copies could be due to integration of injected DNA into two unlinked chromosomal loci, or could reflect a deletion or amplification event after integration at Cd 634 F23 1 am-CD3 c57eL’6 c9 kb VDJ dig0 934 Figure 3. Surface Expression from Transgemc and Normal of F23.1.Posltlve Mice 1) Chains on T Cells Lymph node T cells shmulated in vitro by lrradlated allogenelc DEAR spleen cells were Incubated with VP&specific F231 antibodtes followed by FITC-labeled sheep antl-mouse lmmunoglobulin antibodles, and were analyzed on FACS. In parallel, the expression of CD3 molecules was momtored by using the 145 Xl1 monoclonal antibody (Leo et al., 1987) followed by FITC-labeled goat anti-hamster ImmunoglobuIin antlbody. kb 1.51.3- VDJ oligo a single site. Analysis of second generation offspring mice shows that the two different forms of the transgene are stably inherited. The transgene is therefore present in germ-line DNA and transmitted in a Mendelian fashion to both males and females. We analyzed mice with 2 or 20 copies of the transgene for cell-surface expression with F23.1 antibodies. As shown in Figure 3, most, if not all, of the peripheral T lymphocytes analyzed in mice 93.2 (20 copies) and 93.4 (2 copies) stain with the Vu8specific monoclonal antibody. The staining intensity is similar in both T lymphocyte populations, indicating that despite the difference in copy number, these mice express the transgene to the same extent. Lymph node cells from mice with 2 copies of the transgene were analyzed for the ratio of CD4- and CD8-positive T cells. Lymph node cells from a transgenic male mouse were 45% CD4+ and 18% CD8+, and from a transgenic female mouse, 35% CD4’ and 29% CD8*; control cells from a C57BL/6 mouse were 45% CD4+ and 32% CD8’. These numbers do not deviate significantly from those normally seen. Thus, although the transgenic p chain, derived from a class l-restricted cytotoxic T cell clone, is expressed in most, if not all, of the T lymphocytes, tt does not affect the normal ratio of CD4- and CD8-positive T cells. Transcription of the Transgene Is Largely T Cell-Specific We analyzed mouse 93.2, containing 20 copies, for tissuespecific expression of the transgene. Northern blot analysis using the VDJ oligonucleotide as a probe reveals strong transcription in the thymus, while little or no tran- Figure 4. Tissue Speclfuty Cg of Transgene Ca Transcription (A) Northern blot analysts of transgenlc mouse 93.2. Total RNA was derived from the tissues Indicated. and hybrldlzed with the VDJ ollgonucleotlde speck for the transgene RNA derived from the 86.2.16 cytotoxlc T cell clone was run as a control. (B) A blot with T and B cell RNA from transgemc mouse 93.2 and 86.2.16 RNA as a control was hybrldtzed sequentially with the VDJ oligonucleotide. a CD probe. and a Ca probe. Between hybrldtzatlons. radIoactIve probes were stripped from the falter by lncubatlon in 0 lx SSC, 0.1% SDS, at 95% Sizes of hybrldlzlng T cell receptor a and P RNA molecules were determined by comparison with 16 and 28 S rlbosomal RNA. B lymphocytes from mouse 93 2 were obtalned by treatment of spleen cells with antI-Thy-l antIbodIes and complement, followed by stimulation with Ilpopolysaccharade for 5 days. T lymphocytes were obtalned from lymph nodes and stimulated in vitro with DBAIZ cells scription is seen In the other tissues analyzed (Figure 4A). Similar results were obtained for transgenic mice 93.4 and 95.39, containing 2 copies of the transgene (not shown). The small amounts of transcripts we see in some nonlymphoid tissues could be due to infrltrating T lymphocytes or incomplete inactivation of the transgene. Several findings show that some aberrant transcription of the transgene does indeed occur. First, a longer exposure of Figure 4A reveals aberrantly sized transcripts In muscle cells that are not found in T cells. Second, chimeric mice obtained by transferring bone marrow cells from transgenic 93.2 offspring mice into irradiated C57L recrpients were analyzed for T cell infiltratron (not shown). While transcripts of the transgene are detected in bone marrow, kidney, lung, and liver, no such transcripts are seen in brain and muscle. Thus, at least in muscle and brain. the transgene is aberrantly transcribed in transgenic mice. Third, B lym- Transgenlc 835 Mice with a T Cell Receptor Ii Gene antWCD3 F23 1 L 0 Figure 5 Gel Electrophoretic Analysis Chains from Transgemc T Lymphocytes with F23 1 Monoclonal AntIbodIes .. loo 200 irl 0 100 200 of lmmunopreclpltated 13 before and after Preclearlng Lymph node T cells from transgene mouse 93 2 were surface labeled with ‘751, and T cell receptor [i chams were precipitated with or without precleatlng with F23.1 anttbodles as Indicated II- the figure and as described II- Experimental Procedures. Lymph node T cells from C57BL/6 mice and clone B6 2.16 were analyzed as controls phocytes also show a low level of transgene transcription. Both the VDJ oligonucleotide and the Cf3 probe identrfy 8 chain transcripts in B lymphocytes, while ct chain transcripts, even after a longer exposure, are not seen (Figure 4B). The observed transcripts of the transgene are therefore not due to residual T cell contamination of the B-cell preparation, but reflect an about 20.fold lower level of transgene transcription in B as compared to T lymphocytes. Transgenic T Lymphocytes Express Only F23.GPositive fl Chains, Which Participate in the Formation of Functional Receptors The F23.1 staining experiments indicate that the transgene is expressed in the vast majority of T lymphocytes. It is possible that additional 8 chains are encoded by endogenous genes. Several independent approaches were used to check this possibility. In a first kind of experiment, membrane extracts from T cells of transgenic mice were “precleared” of V88 proteins by using F23.1 antibodies coupled to Sepharose beads. As shown in Figure 5, after preclearing, no further I$ chains were precipitated by a panspecific antiserum (Traunecker et al., 1986) for mouse (3 chains. When the original male-specific clone B6.2.16 and T cells from C57BL/6 mice were analyzed for controls, the panspecific antiserum precipitated I), chains from the latter but not from the former cells after preclearing with F23.1 antibodies. In a second kind of experiment, T cell receptors were modulated (by capping and endocytosis) by F23.1 antibodies and rabbit anti-mouse immunoglobulin at 37°C. Modulated and nonmodulated cells were then stained with anti-CD3 antibodies (Leo et al., 1987). As shown in Figure 6, modulation with F23.1 antibodies re- Figure 6 Modulation of Surface Expression of CD3 Molecules IOUS T Cells by V[W-Spectfic F23.1 Monoclonal AntIbodIes on Var- Lymph node T cells from transgenic mouse 93.2 and from normal C57BL/6 mice as well as cells from the donor clone 86.2.16 were I”cubated with an excess of F23.1 antlbody and with rabbit anti-mouse lmmunoglobulm antlbody for 24 hr at 37°C. Then the viable cells were separated and statned with antIbodIes as indicated in the figure. moved all T cell receptor-associated CD3 molecules from cell surfaces of the transgenic mice and from the 86.2.16 clone but not from other T cells. A third kind of experiment showed that the activity of cytolytic T cells from transgenic mice on allogeneic DBA/2 and C3H/HeJ target cells was completely blocked by F23.1 antibodies, whereas those from normal C57BL/6 mice were not inhibited significantly when used on the same targets (Figure 7). Lysis of allogeneic target cells after in vitro stimulation was specific. Cytolytic T cells from transgenic mice stimulated with DBA12 cells lysed DBA/2 but not C3H/HeJ target cells, Killer to target ratto Figure 7. lnhibltlon of Cytolytlc Activity Specific F23.1 Monoclonal AntIbodies of Transgenic T Cells by V1$8- Lymph node T cells from transgemc mouse 93.2 or from normal C57BL/6 mice were stimulated in vitro with Irradiated DBA/P or C3H/HeJ spleen cells, and after 4 days were tested for cytolytic actlvlty on mdlcated targets II- the presence or absence of F23.1 antIbodIes. Cell 836 Figure kb kb 9.4- 9.4- 6. Endogenous B Genes in Transgemc Mouse kb 93.2 Show Predominantly Partial Dal-J6 Rearrangements (A) Hrndlll-drgested DNA from the cells Indicated were analyzed with a Cg probe by Southern blot hybrrdrzatron The 3 kb band represents the CfQ gene, which gives a strong signal rn cells from mouse 93.2 because of the presence of the transgene. The 9.4 kb band is derrved from the Cpl locus This fragment disappears (at least partially) in T cells because of rearrangements to J61 gene segments. T cell DNA from mouse 93.1 (not containing the transgene; see Table I), C57L liver DNA, and T and B cell DNA from mouse 93 2 were used as controls. (8) The filter shown rn (A) was stripped of the CD probe and subsequently hybridized with a D61 probe. Note that the 9.4 kb germ-line DNA fragment containing the C51 locus is picked up rn C57L liver and transgenrc mouse 93.2 B cell DNA. It shows evidence for heterogeneous rearrangements in C57L and mouse 93 1 T cell DNA, as expected A limited set of rearranged fragments is rdentrfied, however, rn thymus and T cell DNA from transgenic mouse 932 (C) Wrth a De2 probe, a 5.3 kb Hindlll fragment containing the Jb2 and 052 gene segments in germ-line confrguration is identrfied as expected in mouse 93.2 brain and B cell DNA, while rearrangements are evrdent from Its drsappearance rn mouse 93.1 T cell DNA Surpnsrngly, the 5.3 kb band remains mostly rn germ-line confrguratron also in 93.2 thymus and T cell DNA and stimulation with C3H/HeJ cells gave rise to C3H/HeJdirected, but not DBA/2directed, killer cells (not shown). Taken together, these experiments indicate that only 8 chains encoded by the transgene are expressed on T lymphocytes of the transgenic mice and that they are used to form functional T cell receptors. Endogenous 0 Genes Are Incompletely Rearranged Next we wanted to find out whether the lack of endogenous 8 chains on the cell surfaces of transgenic T lymphocytes was due to incomplete rearrangements of endogenous genes. Rearrangement of endogenous 6 genes can be distinguished from the rearranged transgene by using specific hybridization probes. With a C6 probe, rearrangements at the Cf31 locus can be separated from those at the C62 locus (which is present in the transgene) if Hindllldigested T cell DNA is analyzed. This analysis clearly shows that the 9.4 kb germ-line Hindlll fragment containing the C61 locus is rearranged in transgenic T lymphocytes from mouse 93.2 (Figure 8A). The rearrangements, however, appear to be qualitatively different from those seen in normal C57L T lymphocytes used as a control. While no discrete rearranged fragments appear in C57L T cell DNA, a series of fragments (not seen in a 6 cell control) is evident in T cell and thymus DNA from transgenic mouse 93.2. Also, mouse 93.1, which did not inherit the transgene, looks like the C57L control. With a probe derived from the 5’ flanking region of the Df31 gene segment, a series of discrete rearranged fragments is again seen in transgenic but not in control T cell, nor in transgenic B cell, DNA (Figure 8B). This result shows that partial D(11 rearrangements, presumably to J/31 and J82 gene segments, are present in unusually high frequencies in the transgenic mouse. Indeed, the sizes of the observed rearranged fragments are in agreement with this assumption. Since these fragments are identified with a 5’ flanking probe of D81, they represent partial rearrangements that do not involve V8 gene segments. Inversion of the V814 gene segment, located downstream of Cg, would not delete the 5’ flanking sequence of 06 gene segments (Malissen et al., 1986). Analysis of T cell clones from transgenic mice (see below) with a Vf314 probe, however, shows that endogenous V614 genes have not been rearranged to Df3 gene segments. In agreement with the Southern blot analysis, a Northern blot analysis of thymus and peripheral T cell RNA with a mixture of 3zP-labeled V67, Vf39, V811, V612, V814, Vf315, and V816 gene segments did not reveal V8 gene transcripts in transgenic mouse 93.2, while a clear signal was obtained with a C57BL16 control (not shown). In contrast to the D61 gene segment, the D62 gene segment does not undergo frequent rearrangements in transgenie mouse 93.2. As shown in Figure 8C, it rather seems that most of the D82 gene segments remain in germ-line configuration in 93.2 thymocytes and T cells. Mouse 93.4, containing only 2 rather than 20 copies of the transgene, shows a similar high frequency of partial D61 rearrangements (not shown). Furthermore, mouse 95.39, independently generated, and a transgenic mouse obtained by coinjection of the same 8 gene together with a T cell Transgenrc 837 Mrce wrth a T Cell Receptor Table 2. T Cell Clones fi Gene Analyzed Mouse Clone” DO1 to J(11 93.2 2 8 14 16 17 18 19 2oe 2 1 1 1 2" 2 1 2 1 2 93.4 Dfil to Jfi2 Df12 to Jf12 Dfil to Dff2C 1 1 1 1 1 2 a Rearrangements of the two homologous (3 IOCI rn each T cell clone were analyzed wrth CfI. Df11. and Dfi2 probes b T cell clones were obtarned as described rn Expertmental Procedures. c The sizes of these rearranged fragments do not correspond to those expected for DJ rearrangements * Indicates that DJ rearrangements have occurred on both homologous chromosomes. c Clone 20 contarns one 1) locus rn germ-tine confrguratton. receptor a gene show a predominance of partial Djil rearrangements (not shown). Thus neither the high copy number of the transgene in mouse 93.2 nor tts peculiar chromosomal location causes this unusual pattern of rearrangement. The results presented so far do not exclude a low but still significant number of complete endogenous VDJ rearrangements. To obtain a more quantitative estimate, we analyzed nine T cell clones obtained from mice 93.2 and 93.4 with the same CD, D81, and Df52 probes. Of the 18 endogenous 6 loci screened, 13 rearranged Dpl to Jhi, 2 fused D[il with J62, 3 joined D62 with J62, and 2 show unusual rearrangements of both Dpl and Dj12 gene segments that were not further characterized (Table 2). No complete VDJ rearrangements were found, Indicating that they occur very rarely If at all. The partially rearranged endogenous jI genes are transcribed into a series of RNA molecules of different lengths. A Cjjl-specific probe, which does not crosshybridize wrth C1)2 and therefore does not prck up RNA transcripts from the transgene, identifies a number of RNA molecules that range in size from 1.0 to 1.5 kb in length (Figure 9A). RNA molecules derived from completely rearranged [1 genes are 1.3 kb in length (see C57BL/6 control), and It IS evident from Figure 9A that 1.3 kb CjIl transcripts are practically mrssing in T cells from transgenic mouse 93.2. As shown in Figure 9B, a similar set of aberrantly sized RNA molecules is identified when the D81 probe is used, as expected from the preponderance of partial D(31-JjI rearrangements. The exact structural basrs of these heterogeneous transcripts is not known. Discussion The j1 gene injected with 9 kb of 5’ and 18 kb of 3’flankrng sequence is expressed in transgenic mice at high levels and, to a large extent, in a tissue-specific fashion. Low levels of 8 chain transcripts, derived from the transgene, were found in nonlymphoid tissues as well as in B cells. While the observed transgene transcripts in some nonlymphoid tissues could be due to T cell infiltration, it is clear that B cells, muscle cells, and brain cells do show a low level of aberrant transcriptron of the transgene. kb 1.5IO- Figure 93.2 9 Transcriptron of Endogenous fi Genes rn Transgenic Mouse (A) A C()l-spectftc probe was used to analyze T cells for Cftl transcripts by Northern blot hybndizatron RNA from the cytotoxrc T cell clone 86.2.16 does not hybrrdtze, rn agreement with the organrratron of Its (I alleles (see text). Cfll transcnpts present rn mouse 93.2 T cells are clearly different rn we from those seen rn T cells from a C57BL/6 control mouse (B) Northern blot hybndrzatron with a D(11 probe rdentrfres aberrantly wed transcripts rn the 862.16 cytotoxrc T cell clone (presumably dewed from the nonfunctronal allele) and also rn mouse 93.2 T cells. Expression of the Transgene Regulates Rearrangement of Endogenous [I Genes The majority of endogenous ji genes in the transgenic mice show rearrangements of D(31 to Jpl gene segments. No endogenous VDJ rearrangements are seen. The preponderance of incomplete D(11 to Jgl rearrangements is highly unusual, and is independent of the copy number of the transgene and Its chromosomal location. It can be deduced from the analysrs of T cells and T cell clones that approximately half of the nonproductive [I rearrangements Cdl 838 in normal T cells represent VDJ rearrangements (Kronenberg et al., 1985). Of eight nonfunctional alleles that have been characterized in T cell clones, five show partial DJ rearrangements (at least three of which are Dpl-Jfl2) and three show aberrant VDJ rearrangements (Goverman et al., 1985; Chou et al., 1986; Dembih et al., 1986; Fink et al., 1986; Malissen et al., 1986; this paper). Expression of the introduced p gene in transgenic mice therefore blocks endogenous f3 gene rearrangement between D-J and V-DJ joining. The molecular mechanism that regulates rearrangement of endogenous p genes needs to be investigated. For immunoglobulin heavy chain genes it has been shown that rearrangements are coupled to transcription of unrearranged VH genes, presumably due to an accessible chromatin structure (Yancopoulos and Alt, 1985, 1986). Trans-acting factors might play a role, and could be subject to regulation by heavy chain proteins. A similar mechanism could regulate rearrangement of [), chain genes. In this case, transgene expression during thymocyte development could block a transacting factor that would otherwise activate rearrangement of VP genes. On the other hand, a less direct mechanism cannot be excluded. Early expression of the p transgene could lead to a more rapid differentiation of thymocytes, allowing less time for p rearrangements to occur. Whatever the mechanism, our findings provide clear evidence that DJ and VDJ rearrangements of p genes are separately regulated. The preponderance of partial Dbl-JBl over DPl-JP2 and DP2-J(12 rearrangements in transgenic T cells could result from a tracking mechanism of the recombinase preferentially joining upstream gene segments. Analysis of fetal thymocytes and thymocytes from early stages of adult T cell differentiation has also revealed a predominance of partial Dbl over D[32 rearrangements (Born et al., 1985; Haars et al., 1986; Lindsten et al., 1987). It remains to be seen whether the inhibition of endogenous D chain production is dependent on the amount of transgenic b chain synthesized, as seems to be the case for immunoglobulin K chains (Rusconi and Kiihler, 1985; Storb, 1987); on the presence of its transmembrane region, as for immunoglobulin )1 chains (Storb et al., 1986; Nussenzweig et al., 1987); and/or on its association with other proteins, as suggested for immunoglobulin p and K chains (for review, see Storb et al., 1986). Molecular genetic analysis of the transgenic mice indicates that rearrangements of T cell receptor y genes (Hayday et al., 1985) are found in total T lymphocytes with little difference from those seen in normal mice (not shown). Rearrangement of 6 genes (Chien et al., 1987) in transgenie thymocytes has not been studied. Functionality of the Transgenic up T Cell Receptor Serologic and molecular genetic analyses indicate that only one 0 chain, encoded by the transgene, participates in the formation of the T cell receptor repertoire in the transgenic mice. Preliminary analyses indicate that these mice are heterogeneous for the a chain, since distinct a gene rearrangements were observed in T cell clones (not shown). Despite the fact that most, if not all, of the afi T cell receptors are homogeneous with respect to the [$ chain, the ratio of CD4- and CD8-positive T lymphocytes is normal in the transgenic mice and they show normal allogeneic responses. It has been calculated that variability of the b chain enlarges the T cell receptor repertoire by a factor of about 2000 (Kronenberg et al., 1986). Further experiments will show whether the T cell receptor repertoire in these transgenic mice, with variability only in the a chain, IS still capable of recognizing a large number of different antigens in association with class I or class II molecules of the major histocompatibility complex. Experimental Procedures Establishment of the Male-Specific 86.2.16 Clone C57BL16 female mice were lmmumzed with lo7 male spleen cells injected lntraperltoneally After 14 days, 2 x 10’ female spleen cells were cultured with 2 x 10’ x-lrradtated male cells in 8 ml of culture media. After 12 days, lo6 viable female responder cells were restlmulated with 10’ x-irradiated male cells in 1 ml of medium containing Interleukln-2 (IL-2) Cells were cloned by culturing 0.3 cells with stlmulators as described below Clones were tested for cytolytlc activity as described below, and clone 86 2 16 was selected after surface stalnlng of various clones with the F23.1 antlbody (“on Boehmer and Haas, 1986). Isolation and CharacterizaOon of fl Chain cDNA and Genomic Clones Total RNA and high molecular weight DNA were Isolated from cytotoxic T cell clone 86.2 16 and used to construct cDNA and genomic DNA llbranes In hgtll and EMBLS, respectively, followlng published procedures (Young and Davis, 1983; Fnschauf et al 1983). Both libraries were screened with a Cl, probe. Posltlve clones were characterized by mapplng with restrictlon endonucleases and hybndlzation with probes specific for Dpl and Jb gene segments. A full-length cDNA and genomlc clones 18 for the functlonal and i,3 for the nonfunctlonal allele were subcloned into M13mp18 for DNA sequence determination Sequencing primers were the 17.mer universal Ml3 primer (Amersham) and 15. to 1Fmer ollgonucleotldes synthesized to extend DNA sequence mformatlon beyond what was determined with Ml3 primers. Transgene Reconstitution From the genomlc clone h9, a 13 kb Sall-Sacll fragment, contalnmg the productively rearranged V gene with 9 kb of 5’flanklng sequence. was mixed with a 23 kb Sacll-Sal1 fragment contalnmg Jp2 and C[%2 gene segments together with 18 kb of 3’flanking sequence The latter fragment was Isolated from cosmld clone cos H-2”ll-1.14T derived from a EALB/c liver library, previously described (Stemmetr et al 1986). Both fragments were ligated m the presence of Sall-digested pTCF cosmld vector DNA arms. Llgatlon was checked by agarose gel electrophoresls. In vitro packaging and transformahon of E. co11 stram 490A was carried out as previously described (Steinmetr et al., 1985). Several clones were picked and clone cos HY1)9-1.14-5, containing the reconstituted transgene as shown In Figure 16, was ldentlfled by restrIctIon endonuclease mapping. Transgenic Mice The 36 kb Insert of cos HY[IS-1.14-5 was released by Sal1 digestion and Isolated by preparative agarose gel electrophoresls and electroelutlon The DNA was extracted twice with phenol-chloroform and preclpltated with ethanol. The DNA pellet was dissolved m ultrapure water and dlalyzed against 10 mM Tris-HCI, 0 1 mM EDTA (pH 7.4). The DNA was adjusted to a fmal concentration of 4 wglml Fertilized mouse eggs were recovered m cumulus from the oviducts of superovulated (CBA/BrA x C57BL:LiA)F, females that had mated with F, males several hours earlier. Approximately 100 copies of the 1)gene were InJected in the most accessible pronucleus of each fertilized egg, as described by Hogan et al. (1986). Microinjected eggs were Implanted into the oviducts of one-day pseudopregnant (CBA/BrA x C57EL/LiA)F, foster mothers and carned to term Several weeks after birth, total genomlc DNAwas Isolated from tail blopsles of the pups. Mice that had Transgentc 839 mcorporated breeding. Mice with a T Cell Receptor the Injected 1) Gene DNA in thetr genome were used for further Southern and Northern Blot Analyses Tall DNA was purified from the terminal quarter of tails of 4-week-old mice. The skin was separated from the bone and homogenized in 1 ml of 1% NaCI, 10 mM EDTA (pH 8.0), on ice by using a Polytron with a PTA7 blade. DNA was isolated by phenol-chloroform extraction and dialyzed against 10 mM Trls, 1 mM EDTA (pH 8.0) (TE). One milliliter of 6% p-aminosalicylate was added to the first phenol extraction. Mouse organs were chopped in Ice-cold PBS and homogenized in 4 M guanidlnium isothlocyanate, 0.5 mM sodium citrate (pH 7.0). 0.1 M p-mercaptoethanol, 0.5% Sarkosyl, using a Polytron as above. From the homogenate, RNA and DNA were isolated by differenbal centrtfugatlon as described previously (Maniatis et al., 1982). DNA-containing fractions were dialyzed against TE buffer for 6 hr, extracted with phenol-chloroform three times, and dialyzed against TE overnight Total cellular RNA (5 to 10 wg) was separated on 1.5% formaldehydeagarose gels according to Rave et al. (1979) and transferred to Zeta probe membranes (BloRad) or BA85 nltrocellulose filters (Schlelcher & Schiill). Genomlc DNAs (10 pg) were digested to completion with restriction endonuclease, separated on 0.6% agarose gels, and transferred to Zeta probe membranes according to Reed and Mann (1985). Northern blot hybrtdizatlon v&h labeled restriction fragments was performed by usmg the same conditions as for Southern blot hybrldlzation described by Steinmetz et al. (1986). Hybridization with the 30. mer ollgonucleotide containing the VDJ folning region of the transgene was done in 900 mM NaCI, 90 mM Tris-HCI (pH 7.2), 6 mM EDTA. 10x Denhardt’s solution, 1% SDS, and 500 ug/ml E. coli DNA at 42% overnight. After hybridization the filter was washed twice in 6x SSC, 0.1% SDS, at room temperature and twice in 3x SSC, 0 1% SDS, at 60% for 10 mln each. Southern blot hybridization was carried out as described by Uematsu et al. (1988). Falters were exposed with Kodak X-Omat S or X-Omat AR films at -70% for 2 hr to 1 month using Intensifying screens. For hybridization we used previously described Cn and Co probes (DemblC et al., 1985; Snodgrass et al.. 1985) The J1)2 probe IS a 1.2 kb Clal-EcoRI fragment located Immediately downstream of the J(j2 gene segments (Chlen et al., 1984). The Dgl probe IS a 1.4 kb Pstl fragment extending 1 25 kb upstream of the Opt gene segment, and the D()2 probe IS a 2.5 kb Htndlll-EcoRI fragment extending 2 kb upstream of the DP2 gene segment (Siu et al., 1984). The Cpl -specific probe was derived from the 3’ untranslated region as described by Gascolgne et al. (1984). The transgene-speclflc VDJ probe IS an oligonucleotlde of 30 residues in length ldentlcal to the complementary strand of the cDNA sequence shown in Figure 1A from position 581 to 610. V1)7, VB9, V[$ll, Vp12. VB14. Vb15, and VP16 probes have been described by La1 et al (1987) Surface Staining of Lymphocytes Smgle-cell suspensions were prepared from lymph node or spleen. Cells werre Incubated with various monoclonal antibodies purlfled from supernatants of antibody-producing hybridoma cells Cells (106) were Incubated with a saturating dose of antlbody at O°C for 20 min. washed. and Incubated agam with fluorescein lsothlocyanate (FITC) coupled goat antl-mouse immunoglobulln anttbodles In some expenmerits, antIbodIes coupled with blotin were used it- the first step followed by Incubation with FITC-avidine (Klsielow et al.. 1984). Modulation and lmmunoprecipitation of Surface Antigens For modulation, cells were Incubated with an excess of F23.1 antlbodles (50 pglml) and rabbit antl-mouse immunoglobulln antIbodIes for 24 hr at 37°C. Viable cells were obtalned by splnnlng the suspension through F~coll. For Immunoprecipltatlon, 10’ 86.2.16 cloned T cells. C57BL16 T cells, and 93.2 T cells were labeled with 0.5 mCI of Nal (Amersham) by the lactoperoxldaseiglucoseoxldase method (Godmg. 1980) for 20 mln at room temperature in PBS. The cells were washed five times with ice-cold PBS contalmng 0 1% NaN3 and 17 mg/ml KCI. and were then lysed for 30 mln on Ice with a buffer contalmng 2% Tnton X-100, 20 mM Trls (pH a), 150 mM NaCI, 3 mM MgCI. 0.1 mM PMSF, and 5 mM lodoacetamlde. The lysate was centrifuged for 5 mln I” an Eppendorf centrifuge. Half of each sample was precleared four ttmes wtth 100 ~1 of F23.1 anttbodies coupled to Sepharose beads Pre- cleared and untreated lysates were then Incubated with 5 wg of an ant,. fi panspeclfic antibody (Traunecker et at., 1986) for 2 hr on Ice, and subsequently incubated with 35 ~11of 50% protein A beads. All samples were washed with high salt (lysis buffer containing 1 mg/ml ovalbum,” and 0.65 M NaCI) and low salt (lysls buffer contalning 0.15 M NaCt) buffers. Samples were reduced with 2-mercaptoethanol and analyzed on a 12.5% polyacrylamlde gel. Autoradiography was accomplished with Kodak X-Omat AR film and Intensifying screens Generation of Cytolytic T Cells and Cytolytic Assay Spleen (107) or lymph node (IO’) cells were cultured with lo7 x-lrradiated (2000 rads) allogeneic stimulator cells for 5 days in 4 ml of culture medium SICr-labeled target cells were prepared by stimulating spleen cells from various mouse strains with concanavalin A (Con A) (2.5 rlglml) for 48 hr at lo6 cells per ml. Con A blasts were purified by centrifugatlon over Ficoll, and viable cells were “Cr-labeled by Incuba. tion in 5’Cr for 1 hr at 37°C. In the cytotytic assay. lo4 “Cr-labeled targets were incubated with various numbers of cytolytic T cells for 3.5 hr at 37% in serial bottom wells in 200 )II of medium The plates were centrifuged and 100 ml of supernatant removed to determine released 51Cr (Pohllt et al., 1979). For blocking of activity. cytotytic T cells were Incubated for 30 min at 37% with F23.1 antlbodies (50 pglml) Then S’Cr-labeled targets were added and the cytolytic assay was performed as described above. Establishment of Cell Lines and T Cell Clones from Transgenic Mice Cell lines were made by stimulation of spleen cells with either Con A or allogeneic x-Irradiated stimulator cells in medium containing IL-~. After 10 to 14 days, the cells were washed and restimulated (IO6 responder cells, 10’ x-irradiated stimulator cells) in IL-2.containing medium. Viable cells were obtained by CentrifugatlOn over Ficoll. t-10”. rng was carried out by seeding 0.3 cells per well ln 96-well mlcrotiter plates contalntng lo6 x-irradiated feeder spleen cells per well and 200 ~11of IL-2-contaming medium. After 1 to2 weeks. growing colonies were transferred together with 10’ x-irradiated feeder Cells into 2 ml of IL.2. contaimng medium in 24.well Costar plates. From them on, restlmuta. tions were camed out at 7.day intervals with lo6 cloned cells and 107 x-irradiated stimulators per 1 ml of IL-2-COntalnlng culture medium. Acknowledgments We thank WIIII Bannwarth. Hansruedl Klefer. and Relnhard Schulze for oligonucleotides, Klaus Karjalamen for the pansPecIfic B antlserum: Dennis Loh for V(, probes: Uwe Staerz for F23 1 antIbodIes, Anrleloes Beenders. Gholam Reza DastoorNikoo. Kathrln Hafen. Esther Koorn. neef. Ollvla Nlkkanen. and Vreni Stauffer for technical help, Horst Bluthmann. Pawel Klsle!ow. and UWe Staerz for comments; and Anne Iff for typing the manuscript. P Krlmpenfort was Supported by the Netherlands Organlzatlon for the Advancement of Pure Research (ZWO) through the Foundation for Medical Research (MEDIGoN). The Base1 lnstltute for Immunology was founded and 1s Supported by F. Hoffmann-La Roche & Co. LImited, Basel. Swltrerland. The costs of publlcatlon of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertfsement" in accordance with 18 USC. Sectton 1734 solely to Indicate this fact Received November 9. 1987, revised January 4. 1988 References Allison. J P, and Lamer. L L (1987a) Structure. function and serology of the T-cell antigen receptor COmplaX. Annu. Rev lmmunol 5, 503-540. Allison. J. P. and Lanler. L. L (1987b) The T-cell antigen gamma gene: rearrangement and cell llneages. lmmunol 293-296 receptor Today 8. Behlke, M. A.. Chou. H S, Huppl. K.. and Lob. D Y (1986) Murlne T-cell receptor mutants with deletions of II-chain variable region genes Proc. Nat1 Acad SCI USA 83. 767-771 Behlke. M A, Henkel. T J Anderson. S J Lan. N C, Hood, L Braclale, V L Braclale. T J and Loh. D Y (1987) ExpressIon of a murine polyclonal T-cell receptor marker correlates with the use of spa. Cell 840 crftc members of the VtI8 gene segment subfamtly. J Exp Med. 765, 257-262 Born. W Yagiie. J.. Palmer, E Kappler, J., and Marrack, P (1985) Rearrangement of T-cell receptor p-chain genes during T-cell development. Proc. Natl Acad SCI USA 82, 2925-2929 Born. W.. Hams. E tor gene expressron and Hannum, C. (1987). Ontogeny Trends Genet. 3, 132-136 of T-cell recep- Leo, 0, Foo, M , Sachs, D H Samelson, L E and Bluestone. J A (1987). ldenttftcatton of a monoclonal antibody spectftc for a murtne T3 pepttde. Proc Nat1 Acad SCI USA 84, 1374-1377. Ltndsten, T., Fowlkes, B J , Samelson, L E., Davis, M M , and Chten. Y -H. (1987). Transient rearrangements of the T cell anttgen receptor u locus tn early thymocytes J Exp. Med. 766, 761-765. N. R. J Kavaler. J Lee, N E and Davis, recombrnatton rn a murrne T cell receptor gene Maltssen. M., McCoy, C.. Blanc, D , Trucy, J., Devaux, C. SchmtttVerhulst. A.-M Fetch, F. Hood, L and Maltssen, B. (1986). Dtrect evtdence for chromosomal tnversion during T-cell receptor b-gene rearrangements Nature 379, 28-33 Chten, Y.-H., Iwashtma. M., Kaplan, K 6.. Elliott, J. F., and Davis, M. M. (1987). A new T-cell receptor gene located wtthtn the alpha locus and expressed early tn T-ceil dtfferenttatton. Nature 327, 677-682. Manratrs, T., Frttsch, E. F, and Sambrook, J (1982). Molecular Clomng: A Laboratory Manual (Cold Spring Harbor, New York: Cold Sprtng Harbor Laboratory Press). Chou. H. S Behlke, M A , Godambe, S. A., Russell, J. H., Brooks, C G.. and Loh, D. Y (1986). T-cell receptor genes rn an alloreactrve CTL clone rmplrcattons for rearrangement and germltne dtverstty of vartable gene segments EMBO J 5, 2149-2155 Nussenrwerg, M. C , Shaw, A. C., Stnn. E , Danner, D. B., Holmes, K. L , Morse III, H. C., and Leder, P (1987). Allelic excluston tn transgemc mace that express the membrane form of tmmunoglobultn ft Saence 236, 816-819 Chou, H. S.. Anderson, S J., Loute, M. C., Godambe, S A, Porrr, M R , Behlke, M. A., Huppt, K., and Loh, D Y (1987). Tandem linkage and unusual RNA spltcing of the T-cell receptor b-chart? varrable-region genes Proc Nab Acad SCI. USA 84, 1992-1996 Okarakt, K., Davis, D D , and Sakano, H (1987) T cell receptor (3 gene sequences in the ctrcular DNA of thymocyte nuclet: direct evidence for tntramolecular DNA deletion tn V-D-J jotmng. Cell 49, 477-485. Chten. Y.. Gascotgne. M. M (1984). Somatrc Nature 309. 3222326. DembtE, Z, Bannwarth, W.. Taylor, B. A.. and Sternmetz, M (1985). Mapprng of the gene encodtng the rr chatn of the T-cell receptor close to the Np-2locus on mouse chromosome 14. Nature 314, 271-273 Dembtc’, Z., Haas. W., Weiss, S, McCubtey, J, Ktefer, H., von Boehmer, H., and Stetnmetz, M. (1986). Transfer of spectfictty by murtne n and j\ T-cell receptor gene. Nature 320, 232-238 Ftnk. P. J.. Matis, L. A, McElltgott. D. L , Bookman, S M. (1986). Correlattons between T-cell specrftcrty of the antigen receptors Nature 327, 219-226. M., and Hedrick, and the structure Palmtter, R. D., and Brrnster, R. L. (1986). mice. Annu. Rev Genet 20, 465-499. Pohltt, H , Haas, W., and von Boehmer, sponses to haptenated cells. I. Primary, tures Eur J. Immunol. 9, 681-690. Germltne H. (1979) secondary transformatton of Cytotoxic T cell reand long-term cul- Rave, N., Crkvenjakov. R., and Boedtker, H. (1979). ldenttftcatron of procollagen mRNAs transferred to dtazobenzyloxymethyl paper from formaldehyde agarose gel Nucl. Acids Res. 6, 3559-3567. Reed, K. C., and Mann, D. A. (1985) agarose gel to nylon membrane. Nucl. Rapid transfer of DNA from Acids Res. 73, 7201-7221 Frtschauf. A-M , Lehrach, H Poustka, A, and Murray, N. (1983). Lambda replacement vectors carrying polyltnker sequences. J Mol. Btol 770. 827-842 Rusconi. S., and Kohler, G (1985). Transmtssion and expressron of a specific patr of rearranged immunoglobulin p and K genes tn a transgemc mouse ltne Nature 374, 330-334. Gabert. J., Langlet, C , Zamoyska, R Parries, J R , Schmttt-Verhulst, A.-M., and Malissen, B. (1987). Reconstttutton of MHC class I specific ity by transfer of the T cell receptor and Lyt-2 genes. Cell 50, 545-554 Saito, T., Weiss, A., Mtller, J., Norcross, M. A.. and Germain, R. N. (1987). Spectftc antigen-la acttvation of transfected human T-cells expressing murtne TI r&human T3 receptor complexes. Nature 325, 125-130. Gascotgne, N. R. J.. Chten, Y -H , Becker, D. M., Kavaler, J.. and Davis, M. M. (1984). Genomtc orgamzatton and sequence of T-cell receptor ii-chain constant- and jotntng-region genes. Nature 370, 387-391 Godrng, J W (1980) Structural studtes IgD J Immunol. 724, 2082-2088. of murtne lymphocyte Goverman, J , Mtnard. K., Shastrt. N.. Hunkapiller, Sercarr, E.. and Hood, L E. (1985) Rearranged genes tn a helper T cell clone specific for lysozyme: tween V,, and MHC restrictton. Cell 40, 859-867. surface T., Hansburg. D., [% T cell receptor no correlation be- Haars. R.. Kronenberg, M , Gallattn. W. M.. Wetssman, I. L., Owen, F. L , and Hood, L. (1986). Rearrangements and expresston of T cell antigen receptor and y genes durtng thymtc development. J Exp. Med. SIU, G., Kronenberg, M., Strauss, E., Haars, R., Mak, T W., and Hood, L. E. (1984). The structure, rearrangement and expression of Db gene segment of the murtne T-cell antigen receptor. Nature 377, 344-350. Snodgrass. H. R., Kisielow, P., Kiefer, M., Steinmetz, M., and von Boehmer, H (1985). Ontogeny of the T-cell anttgen receptor within the thymus. Nature 373, 592-595. Staerz, U. D.. Rammensee, H -G., Benedetto, J. D., and Bevan, M J. (1985). Charactertzatton of a murine monoclonal antibody specific for an allotyptc determinant on T-ceil anttgen receptor. J Immunol. 734, 3994-4000. Hayday, A C.. Sarto, H Gtlltes, S. D., Kranz, D M., Tantgawa, G., Eisen. H N.. and Tonegawa, S. (1985). Structure, orgamzatton, and somatte rearrangement of T cell gamma genes. Cell 40. 259-269 Stetnmetz, M., Stephan, D., Dastoormkoo, G R.. Gtbb, E., and Romaniuk. R. (1985). Methods tn molecular immunologychromosomal walktng rn the major htstocompattbtlrty complex In lmmunologtcal Methods, Vol. Ill I. Lefkovits and B. Pernts. eds. (Orlando, Florida, Academtc Press) Hogan. B.. Costanttni. Embryo (Cold Spring tory Press) Stetnmetz, M , Stephan, D., and Fischer Lrndahl. K. (1986). Gene organization and recombinatronal hotspots in the murtne major histocompattbrlrty complex. Cell 44, 895-904. 164, l-24 F., and Lacy, E (1986) Mampulattng the Mouse Harbor, New York, Cold Sprtng Harbor Labora- Krstelow. P, Leiserson. W , and van Boehmer, H. (1984). Drfferenttatton of thymocytes rn fetal organ culture. J lmmunol 733. 1117-1123. Storb, U (1987). Transgenic Rev. lmmunol 5, 151-174 Kronenberg, M., Goverman, J., Haars, R.. Maltssen, M., Kratg, E., Phtllips, L., Delovttch. T., Suctu-Foca. N , and Hood, L. E. (1985). Rearrangement and transcnphon of the D-chain genes of the T-cell antigen receptor in drfferent types of murtne lymphocytes. Nature 373. Storb, U., Pinkert, C., Arp, 8.. Engler, P, Gollahon, K., Manz, J., Brady, W, and Brinster, R. (1986). Transgenic mice wtth 11and c antiphosphorylcholme anttbodtes. J. Exp. Med. 764, 627-641. 647-653 Kronenberg. M , SIU, G Hood, L E.. and Shastrt. N (1986). The molecular genetrcs of the T-cell anttgen receptor and T-cell antigen recognttron Annu Rev. Immunol. 4, 529-591 Lar, E., Barth, R. K., and Hood, L. E. (1987). Genomrc the mouse T-cell receptor D chain gene family Proc USA 84, 3846.~3850 organrzabon of Nat1 Acad. SCI mice with immunoglobulin genes. Annu. Traunecker, A., Dolder, B., and Karfalamen. K (1986). A novel approach for prepaitng antt T cell receptor constant region antibodies. Eur. J. Immunol. 76. 851-854. Uematsu. Y.. Ftscher-Lindahl, K., and Stetnmetz, M. (1988) The same MHC recombrnatronal hotspots are active tn crossmg-over between wild/wtld and wild/Inbred mouse. lmmunogenettcs 27, 96-101 von Boehmer, H.. and Haas. W (1986) Cytolyttc brrdomas. Meth. Enzvmol. 732, 467-477 T cell clones and hy- Transgenlc 641 Mice with a T Cell Receptor /i Gene Weiss, A. W., Imboden, J., Hardy, K Manger, 6, Terhorst. Stobo. J. (1986). The role of the T3/antlgen receptor complex actlvatlon Annu. Rev. Immunol. 4, 593-619. Yancopoulos, G. D, and Alt. F W. (1965). Developmentally and tissue-speclflc expresslo” of unrearranged VH gene Cell 40, 271-261. C and in T-cell controlled segments. Yancopoulos, G. D , and Alt, F W (1986) Regulation of the assembly and expression of variable-region genes Annu Rev. Immunol. 4, 339-368 Young, R. A, and Davis, R. W. (1983). Efficient lsolatlon of genes by using antlbody probes Proc. Nat1 Acad. SCI. USA 80, 1194-1198.
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )