Topic 4-6 Review - Biodiversity
Be able to define the following:
a. Allele: One of two or more alternative forms of a gene that are found at the same place on a
chromosome. One allele is from the Mother, one allele is from the Father.
b. Gene: A hereditary unit consisting of a sequence of DNA that occupies a specific location on
a chromosome and determines a particular characteristic in an organism. (ex: blue eyes)
c. Genetics: The study of heredity and the variation of inherited characteristics.
DNA is the shortened form of this:__Deoxyribonucleic Acid_________
What is this structure called?
_____Chromosome_______

Chromosomes are made of what? _____DNA___________

In 1953, James Watson and Francis Crick established the structure of DNA. The structure is a
____double helix____, which is like a twisted ladder.

The sides of the DNA ladder (backbone) are made of alternating __sugars___ and
___phosphates____ molecules.

The bases in DNA are known by these letters: Check your notes


These bases always bond in a certain way. Adenine will only bond to Check your notes
Guanine will only bond with Check your notes

Write the complimentary DNA sequence:
ATGCACATAGTCAATCGGCTAA
TACGTGTATCAGTTAGCCGATT
CELL DIVISION
Asexual:
Word Bank: CHROMOSOMES, MITOSIS,
Reproduction involves only __ONE__ parent. All of the offspring are genetically __IDENTICAL____ to
the parent. In single cell organisms, ___BINARY FISSION_______ enables the parent cell to split its
contents __EQUALLY_____ between the two new cells. Prior to division, parent cells must
___DUPLICATE____ their DNA and when the split takes place each new cell receives a complete and
exact copy of the DNA from the parent. In multi-cellular organisms the process that produces two
new cells with the same number of ___CHROMOSOMES______ is called _________MITOSIS_______.
STAGES OF MITOSIS
Please draw in and label each of the following stages of Mitosis (2 chromosomes)
Interphase
Sexual:
Word Bank:
Sexual reproduction usually involves ___TWO___ individual organisms. The offspring that are
produced from this union have genetically ___DIFFERENT____ characteristics, half from one
__PARENT____ and the other half from the other parent - making a ___UNIQUE____ offspring. During
sexual reproduction, the specialized sex cells (_GAMETES___) unite to form a ___ZYGOTE____, which
develops into the new organism. Male gametes are called ___SPERM_____ and female gametes are
called ____EGG_____ . ___MEIOSIS___is a type of cell division that produces cells with only
___HALF__ the DNA of a normal cell. This process involves two ____CELL DIVISION_____, not one.
Please draw in and label each of the following stages of Meiosis (2 chromosomes)
Interphase I
Interphase II
Word Bank:
All human cells contain __46___ chromosomes. In order to have a complete human organism, all of the
chromosomes must be present. Not all organisms have the same number of chromosomes (Dogs have 78, cats
have 38). Every cell of a human contains __23___ pairs of chromosomes (dogs 39, cats 19). Not all of the
chromosomes from species to species are the same, which accounts for the different characteristics between the
species. Genes are located in the ____CHROMOSOMES_____ and come in pairs. Each chromosome has
numerous ___GENE_____ locations. Both genes in a pair carry DNA instructions for the same thing. Specific
characteristic genes occupy matching locations on the two chromosomes. These variations in forms are called
___ALLELES_____. The ultimate combination of the chromosome pair is what makes the variation possible combining the different variations of different characteristics to create a ____UNIQUE______ variation.
INHERITED/NON-INHERITED & CONTINUOUS/ DISCRETE VARIATIONS
List 3 examples of inherited (heritable) characteristics
1 Eye colour
2 Skin colour
3 Check your notes
Not all characteristics are inherited. Some depend entirely on the environment. Non-inherited
characteristics are acquired and not necessarily passed on from generation to generation.
List 4 examples of non-inherited characteristics
1 Tattoos
2 Scars
3 Check your notes
List 3 examples of Continuous variations
1 Weigh
2 Height
3 Check your notes
List 3 examples of Discrete variations
1 Attached/unattached earlobes
2 Blood Type
3 Check your notes
Changing Our Genetic Information
Factors in the environment, or random events can change genetic information contained in DNA.
These changes are called mutations, and can cause changes in the structure of organisms, including
people.
What is the word we used to describe these
MUTATIONS
What are 3 examples of Mutagens?
1 UV LIGHT
2 CHEMICALS
3 CHECK YOUR NOTES
Some mutations can cause a very serious disease called ___CANCER_____, which promote rapid cell
division and impair full normal cell development. The cancerous cells can interfere with other cells
and prevent certain processes from occurring as they should.
If mutations occur in the DNA of reproductive cells, the changes can be passed on from the
___PARENT____ to the ______OFFSPRING______
Explain the drawbacks of the process of Artificial Selection. ** Please refer to your notes and/or
textbook for this answer
Explain what occurs during the process of each type of artificial selection technique below.
Cloning To make an identical copy of the organism
artificial insemination The injection of semen into the uterus other than by sexual intercourse
in vitro fertilization
A process by which egg cells are fertilized by sperm outside the womb
Genetic engineering (Genetically Modified Organisms)
the deliberate modification of the
characteristics of an organism by manipulating its genetic material.
Darwin explained his theory of natural selection, which could be summed up in four statements:
Variation. Organisms (within populations) exhibit individual variation in appearance and
behavior. These variations may involve body size, hair color, facial markings, voice
properties, or number of offspring. On the other hand, some traits show little to no variation
among individuals—for example, number of eyes in vertebrates.
Inheritance. Some traits are consistently passed on from parent to offspring. Such traits are
heritable, whereas other traits are strongly influenced by environmental conditions and
show weak heritability.
High rate of population growth. Most populations have more offspring each year than local
resources can support leading to a struggle for resources. Each generation experiences
substantial mortality.
Differential survival and reproduction. Individuals possessing traits well suited for the
struggle for local resources will contribute more offspring to the next generation.
Why do scientists use Punnett Squares to predict heredity?
They want to know the different combinations of genotypes that one of their offspring might
have. So, we draw a Punnett square
In hamsters, black coat color (B) is dominant to white coat color (b). A homozygous black hamster (BB) is
mated with a heterozygous black (Bb)hamster. What will be the genotype and phenotype percentages
be of their offspring?
B
b
B
BB
Bb
B
BB
Bb
GENOTYPE: 50% BB, 50% Bb
PHENOTYPE: 100% Black coat offspring
In humans, brown eyes (B) are dominant over blue (b)*. A brown-eyed man marries a blue-eyed woman
and they have three children, two of whom are brown-eyed and one of whom is blue-eyed. Draw the
Punnett square that illustrates this marriage. What is the man’s genotype? What are the genotypes of
the children?
** Please refer to your notes and/or textbook for this answer
1
2
3
4
5
6
7
8
9
10
11
12
13
14
Across
3. DNA is arranged in the cell in compact
packages, called _______________
7. This process ensures each cell ends up with a
complete set of chromosomes, identical to each
other and identical to the original cell.
8. Examples of these variations include: height,
shoe size, hand span, skin color, hair color
9. Examples of these variations include: tongue
rolling ability, blood groups, earlobe attachment
10. those characteristics which are passed on to
offspring directly from their parents. These traits
are passed on by way of the genetic material
13. The base found in DNA that begins with the
letter "G"
14. This is a type of cell division that produces cells
with only half the DNA of a normal cell. This
process involves two cell divisions, not one
Down
1. This molecule (full name) is the inherited
material responsible for variation (two words,
no space between)
2. The base found in DNA that begins with the
letter "T"
4. The base found in DNA that begins with the
letter "A"
5. The base found in DNA that begins with the
letter "C"
6. Examples of these includes: X-rays,
ultraviolet rays, cosmic rays and some
chemicals can cause mutations
11. This disease promotes rapid cell division and
can impair normal cell development.
12. These are located on the chromosomes and
come in pairs. Each chromosome has
numerous locations for these.