Biology Journal 10/14/2013 What do the letters in the acronym DNA stand for? Deoxyribonucleic Acid What are the 4 most commonly occurring elements in living things? Carbon, Hydrogen, Oxygen, Nitrogen What 5 elements are found in DNA? Carbon, Hydrogen, Oxygen, Nitrogen, Phosphorous Mr. Gatewood is accepting IB test registration and payment through this Friday. • Come see him if you need any guidance on which tests to take. • Come see him if you would like to test, but are having trouble coming up with the fees. 3.3 DNA Structure Assessment statement 3.3.1 Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and phosphate. 3.3.2 State the names of the four bases in DNA. 3.3.3 Outline how DNA nucleotides are linked together by covalent bonds into a single strand. 3.3.4 Explain how a DNA double helix is formed using complementary base pairing and hydrogen bonds. 3.3.5 Draw and label a simple diagram of the molecular structure of DNA. An extension of the diagram in 3.3.3 is sufficient to show the complementary base pairs of A–T and G–C, held together by hydrogen bonds and the sugar–phosphate backbones. DNAyeeeeeee What do you call these types of carbohydrates? A Disaccharide B Monosaccharide C Disaccharide D Polysaccharide What is the name of these carbohydrates? A Lactose B Ribose C Sucrose D Starch + → + H2O What are the reactants of this reaction? 2 glucose molecules. What are the products of this reaction? Lactose and water. What kind of reaction is this? It is a condensation synthesis (it’s called condensation because water is made from the OH and H groups of the reactants) The Parts of DNA Deoxyribose: a monosaccharide, or “sugar.” C5H10O4. What is the difference between ribose and deoxyribose? Ribose C5H10O5 Deoxyribose C5H10O4 The Parts of DNA Phosphate: PO4 The Parts of DNA Deoxyribose and phosphate alternate to make up the “sugar-phosophate backbone.” The Parts of DNA The bases (aka nitrogenous bases, aka nucleic acids, aka nucleotides) • Adenine, cytosine, thymine, guanine What is a hydrogen bond? Hydrogen bonds are attractions between positive and negative sides of molecules. A always pairs with T C always pairs with G A and G are larger, 2-ringed bases. T and C are smaller, 1-ringed bases. Thus, every base pair consists of a 1ringed base and a 2-ringed base. How might this help find and correct errors (mutations) in DNA? A and T are joined by 2 hydrogen bonds. G and C are joined by 3 hydrogen bonds. How might this help find and correct errors (mutations) in DNA? DNA Can be represented in many ways… Which of the following are not found in pairs? Adenine and Thymine Dookies Twins Aces Thymine and Cytosine Deoxyribose Phosphate A T G C Hydrogen bonds Where’s the base pairs? Where’s the backbone? The double helix is a twisted ladder shape that helps the DNA take up less space. Histones are a protein that the DNA wraps around to take up less space The way that DNA wraps around histones is called the “pearl necklace” shape. Histones are like little stones that the DNA wraps around. How long would this ball of yarn be if it wasn’t wrapped around something? Histones are a protein. What is another word for a protein? What are proteins made out of? 3.3 DNA Structure Assessment statement 3.3.1 Outline DNA nucleotide structure in terms of sugar (deoxyribose), base and phosphate. 3.3.2 State the names of the four bases in DNA. 3.3.3 Outline how DNA nucleotides are linked together by covalent bonds into a single strand. 3.3.4 Explain how a DNA double helix is formed using complementary base pairing and hydrogen bonds. 3.3.5 Draw and label a simple diagram of the molecular structure of DNA. An extension of the diagram in 3.3.3 is sufficient to show the complementary base pairs of A–T and G–C, held together by hydrogen bonds and the sugar–phosphate backbones. Biology Journal 10/15/2013 DNA is a huge molecule! There are 2 ways in which DNA compacts itself to take up less space. What are they? Biology Journal 10/15/2013 Standard 3.3.5 is “Draw and label a simple diagram of the molecular structure of DNA.” Can you do it? 3.3 DNA Replication Assessment statement 3.4.1 Explain DNA replication in terms of unwinding the double helix and separation of the strands by helicase, followed by formation of the new complementary strands by DNA polymerase. 3.4.2 Explain the significance of complementary base pairing in the conservation of the base sequence of DNA. 3.4.3 State that DNA replication is semi-conservative. The two strands of DNA can be separated, called unzipping. • Remember, the 2 strands are connected by hydrogen bonds, which are much weaker than covalent bonds. DNA Helicase is the enzyme that does the unzipping. DNA Helicase un-does the double helix. In college, all the cool kids wear ironic, pun-driven science t-shirts DNA Helicase Simplified model DNA Helicase Space-filling model DNA Helicase Model showing -helixes and -sheets. DNA unzips during replication (when DNA copies itself) When do you think your cells would replicate their DNA? Your cells replicate their DNA before they divide to make new cells. They do this… For routine replacement of cells (such as skin cells, blood cells, stomach cells, etc) When you grow or gain weight When you are injured and need to replace dead cells If one strand of DNA has these base pairs, then what are the base pairs on the complementary strand? CTAATCGTATATAGTCC GATTAGCATATATCAGG In replication… DNA helicase unzips DNA. DNA polymerase adds in the complementary (matching) bases to each single strand, creating 2 identical strands. When DNA replicates, the new DNA molecules both consist of one new strand and one original strand. This is called semiconservative replication. It took scientists a while to figure out that DNA replication was semi-conservative, as opposed to some other pattern. Your assignment: • • • • Show DNA replication using the pieces provided. Show at least 3 base pairs in the “starting DNA” Show at least 2 base pairs in each “new strand of DNA” Label: – – – – – Parent strand of DNA and New strands DNA helicase DNA polymerase Hydrogen bonds Each of the molecules in DNA (deoxyribose, phosphate, cytosine, adenine, guanine, thymine) • Define the job of: – DNA helicase – DNA polymerase Biology Journal 10/15/2013 What are the names of the two most important enzymes in DNA replication? What does each one do? DNA helicase: unzips DNA, making 2 single-strands. DNA Polymerase: adds in new complementary bases (and backbone) to each single strand, making 2 complete copies of DNA. Biology Journal 10/17/2013 In DNA replication, what do you start with? DNA What do you end with? 2 sets of the original DNA (through semiconservative replication) What is the purpose of replication? When cells divide, each new cells needs a full set of DNA. DNA Replication • DNA helicase unzips the DNA • DNA polymerase connects together matching bases to make 2 new strands. Making a copy 3.3 Transcription and Translation Assessment statement Compare the structure of RNA and DNA. names of sugars bases the number of strands Compare the structure of RNA and DNA. names of sugars bases the number of strands Outline DNA transcription in terms of the Outline DNA transcription in terms of the formation of an RNA strand formation of an RNA strand complementary complementary to the DNA strand by RNA polymerase. to the DNA strand by RNA polymerase. Describe the genetic code in terms of codons composed of triplets of bases. Describe the genetic code in terms of codons composed of triplets of bases. Explain the process of translation, leading to polypeptide formation. roles of messenger RNA (mRNA) and transfer RNA (tRNA) codons and anticodons ribosomes and amino acids Explain the process of translation, leading to polypeptide formation. roles of messenger RNA (mRNA) and transfer RNA (tRNA) codons and anticodons ribosomes and amino acids Discuss the relationship between 1 gene Discuss the relationship between 1 gene and 1 polypeptide. Originally, it and 1 polypeptide. Originally, it was was assumed that 1 gene would invariably code for one polypeptide, assumed that 1 gene would invariably code many exceptions have been discovered. for one polypeptide, many exceptions have been discovered. Transcription and Translation DNA has the “recipe” to make proteins. A gene is a segment of DNA that has the instructions to make a particular protein. “Hmmm… how many teaspoons of cytosine was I supposed to add?” The base pairs on DNA determine the amino acids, and thus the specific shape, that the protein will have. For example… we all have genes for hair color. The base pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like. Of course, you can always change it later… What does it mean to be a translator? What does it mean to transcribe something? What’s the difference between DNA and RNA? DNA Structure •Deoxyribonucleic acid •Double stranded •Uses thymine (T) •Sugar used is deoxyribose (C5H10O4) RNA Structure •Ribonucleic acid •Single stranded •Uses uracil (U) •Sugar used is ribose (C5H10O5) DNA and RNA comparison When does your body need to make different kinds of proteins? Transcription and translation is done every time a cell makes a protein. Above: the structural protein collagen. This guy will be making lots of it soon to repair his body. Ancient Egypt was well known for its scribes that made copies of documents. Nowadays we don’t really need them, we have copy machines… Transcription is making a copy of the DNA onto mRNA (messenger RNA). The enzyme that makes it is called RNA polymerase. Some people transcribe their homework all the time. mRNA is a temporary, disposable copy of DNA. It’s sent from the nucleus to the ribosome. DNA is permanent. You don’t want to change or mess with it. RNA is a disposable copy. If this was a chain of DNA, what would the mRNA strand be? CTGACTTAGATA GACUGAAUCUAU What does DNA have the “recipe” to make? DNA is the recipe to make protein! What do ribosomes do? Ribosomes make proteins! What are proteins made out of? Why do they have the shape that they have? Proteins are made out of amino acids. The different chemical properties of the amino acids cause the chain to fold up in specific ways. Translation: mRNA goes to the ribosome, and it is translated into an amino acid sequence. tRNA (transfer RNA) brings the correct amino acid for every 3 base pairs. The 3 bases on tRNA is called an anti-codon. The 3 bases on mRNA is called a codon. How many different kinds of amino acids are used in the human body? Every 3 base pairs corresponds to a different amino acid. What amino acids does this mRNA code for? AUG UUA GAC CUC UGA A translator puts information from one language into another. Translation puts the genetic code (AGTC’s) into the code of amino acids. What amino acids does this mRNA code for? GUA AAA CUU CUA UAG The translator (ribosome and tRNA) The scribe (RNA polymerase) Protein DNA mRNA What do we call this step? What do we call this step? Transcription Translation Convert the DNA to mRNA Then, Convert the mRNA to amino acids. GCC TAT TCA CTA CTG CGG AUA AGU GAU GAC Argenine Isoleucine Serine Aspartic Acid What do we call this step? Transcription What do we call this step? Translation Aspartic Acid Making a Protein Making a Protein This is called the central dogma of biology. (That just means that it is a really important idea) Biology Journal 10/18/2013 Transcription DNA helicase RNA polymerase Replication DNA helicase DNA polymerase mRNA Translation Ribosome tRNA Protein DNA Happens in the nucleus Happens in the cytoplasm / at the ribosomes Label each molecule (the pictures). Label the process that makes each molecule (the purple arrows). List the name of the enzymes / molecules that carry out each process. Identify the location where each of these molecules / processes are. This is called the central dogma of biology. (That just means that it is a really important idea) Convert the DNA to mRNA Then, Convert the mRNA to amino acids. GTG TGA CTA GTT ATC CAC ACU GAU CAA UAG Histidine Threonine Aspartic Acid Proline What do we call this step? Transcription What do we call this step? Translation Stop Biology Journal 10/21/13 Compare and contrast DNA and RNA in a Venn diagram. DNA Both RNA Biology Journal 10/21/13 Compare and contrast DNA and RNA in a Venn diagram. DNA Both RNA Has deoxyribose as its sugar Has a sugar phosphate backbone Has ribose as its sugar Has the nitrogenous base T Has the nitrogenous bases A, C, and G. Has the nitrogenous base U Double stranded Contains the genetic code for proteins Single stranded Stays in the nucleus Can leave the nucleus Comes in 1 kind Has several kinds: mRNA, tRNA, and rRNA Cell membrane Nucleus Anti-codon Cytoplasm Codon DNA Transcription mRNA Translation Protein or Polypeptide (this is the end product!) Amino Acid Or Ribosome tRNA Monopeptide Transcription DNA helicase RNA polymerase Replication DNA helicase DNA polymerase mRNA Translation Ribosome tRNA Protein DNA Happens in the nucleus Happens in the cytoplasm / at the ribosomes Label each molecule (the pictures). Label the process that makes each molecule (the purple arrows). List the name of the enzymes / molecules that carry out each process. Identify the location where each of these molecules / processes are. Transcription and translation videos: Real-time molecules moving with narration (4 min) https://www.youtube.com/watch?v=41_Ne5mS2ls Description, live narrator and pictures (12 min) https://www.youtube.com/watch?v=h3b9ArupXZg We are going to make a model of all of these pieces and steps! •Ribosomes have 2 “subunits” or pieces. Large Subunit Small Subunit •At the start of every gene is a TATA box. It tells the mRNA polymerase where to start copying. TATA box Actual gene being transcribed DNA strand: TCCACGACTATACCGACTACTCTACGGGAATATG mRNA strand: GGCUGAUGAGAUGCCCUUAUAC •mRNA gets a 5’GTP and a poly-A tail to mark the beginning and end. This helps identify it and “protect” it. 5’ GTP Poly-A tail PPPG AAAAAAAAA Just like words, the base pairs have to be in a specific order to make sense. Don’t screw up the recipe “incredible” = some letters that have meaning. “iberalideie” = some letters with no meaning. “ATTAGCCGCATGATGCTGATGCTAGTCGATGCATGCTAGCTTACGATGCTAGCTAGC TAGCTGACAAACACACCCCACTGACTGATCGATCGATGCATCGCTTTACGATCGATC GATCGATCGATCGATCGATGCATCGAAAGATGAGAAAGGGTCGATCGATCGATCGTT TTATCGATCGATCGATCGATCGATCGATGATCGATCGTTATGCATGCACACACACTAG CTAGCTAGCTAGTGCTGTTTTGATCATCACAACCACCCAGCATGACTATGTGTGTGT GAAAAGTGCTACATAAACGTGATGTGTGGGCCCGGCGCGAAAGCGCTGTGTAGCTT ACGATTTACGATGCTAGCTAGCTAGCTGACAAACTGCTGATGCTAGTCGATAGCTTAC GATTTACGATGCTAGCTAGCTAGCTGACAAACTGCTGATGCTAGTCGATGCATGCTA GCTTACGATGCTAGCTAGCTAGCTGACAAACGCTAGTCGATGCATGCTAGCTTACGA TGCTAGCTAGCTAGCTGACAAACTGCTGATGCTAGTCGATGCATGCTAGCTTACGAT GCTAGCTAGCTAGCTGACAAACCTAGCTTTGCTGATGCTAGTCGATGCATGCTAGCT TACGATGCTAGCTAGCTAGCTGACAAACACGATGCTAGCTAGCTAGCTGACAAACAC ACCCCACTGACTGATCGATCGATGCATCGCTTTACGATCGATCGATCGATCGATCGA TCGATGCATCGAAAGATGAGAAAGGGTCGATCGATCGATCGTTTTATCGATCGATCG ATCGATCGATCGATGATCGATCGTTATGCATGCACACACACTAGCTAGCTAGCTAGTG CTGTTTTGATCATCACAACCACCCAGCATGACTATGTGTGTGTGAAAAGTGCTACATA AACGTGATGTGTGGGCCCGGCGCGAAAGCGCTGTGTACGTGATGCTGTGATCGAT GCCTAGCTAGCTAGCTAGCTAGCTAGAATATAATGGGAA” = hemoglobin. If it were “spelled” a little differently, hemoglobin would be made with the wrong amino acids and wouldn’t work! If a protein is “spelled” a little differently (called a mutation), then it would be made with the wrong amino acids and it wouldn’t work! Hemoglobin With a change to the DNA, hemoglobin is shaped differently, clumps together and causes sickle cell anemia. Your skin color is a pigment that is the result of many proteins. But, if the DNA is mutated, you could have no pigment at all! Evolution you can see: skin color correlates to intensity of UV-radiation throughout the year. Wrestling First Meeting: Today Afterschool in room 128