Chapter 17.
advertisement
From Gene to Protein How Genes Work AP Biology 2007-2008 Making proteins Organelles nucleus ribosomes endoplasmic reticulum (ER) Golgi apparatus vesicles nuclear pore small ribosomal subunit mRNA large ribosomal subunit AP Biology cytoplasm Nucleus & Nucleolus AP Biology Nucleolus Function ribosome production build ribosome subunits from rRNA & proteins exit through nuclear pores to cytoplasm & combine to form functional ribosomes large subunit small subunit AP Biology rRNA & proteins ribosome nucleolus large subunit Ribosomes Function small subunit protein production Structure rRNA & protein 2 subunits combine 0.08mm Ribosomes Rough ER Smooth ER AP Biology Types of Ribosomes Free ribosomes suspended in cytosol synthesize proteins that function in cytosol Bound ribosomes AP Biology attached to endoplasmic reticulum synthesize proteins for export or for membranes membrane proteins TO: endoplasmic reticulum nucleus protein on its way! DNA RNA TO: vesicle TO: TO: vesicle TO: ribosomes finished protein protein Golgi apparatus Making Proteins AP Biology TACGCACATTTACGTACGCGGATGCCGCGA CTATGATCACATAGACATGCTGTCAGCTCT What happens in the cell AGTAGACTAGCTGACTCGACTAGCATGATC when a gene is read? GATCAGCTACATGCTAGCACACYCGTACAT Where are the genes? CGATCCTGACATCGACCTGCTCGTACATGC Where does a gene start? TACTAGCTACTGACTCATGATCCAGATCAC Where does the gene end? How do cells make proteins TGAAACCCTAGATCGGGTACCTATTACAGT from DNA? ACGATCATCCGATCAGATCATGCTAGTACA How is one gene read and another one not? TCGATCGATACTGCTACTGATCTAGCTCAA How do proteins TCAAACTCTTTTTGCATCATGATACTAGAC create phenotype? AP Biology TAGCTGACTGATCATGACTCTGATCCCGTA Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism metabolic pathway A AP Biology enzyme 1 Am I just the sum of my proteins? disease disease disease disease B C D E enzyme 2 enzyme 3 enzyme 4 ingested protein digestion phenylalanine phenylalanine hydroxylase tyrosine transaminase PKU phenylketonuria melanin thyroxine cretinism hydroxyphenylpyruvic acid hydroxyphenylpyruvic acid oxidase tyrosinosis homogentisic acid homogentisic acid oxidase maleylacetoacetic acid AP Biology CO2 & H2O albinism alkaptonuria 1 gene – 1 enzyme hypothesis Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA damage a gene wild type grows on minimal media sugars + required nutrients allows fungus to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed AP Biology to produce a certain amino acid non-functional enzyme from damaged gene Beadle & Tatum X rays or ultraviolet light Wild-type Neurospora create mutations asexual spores Minimal medium spores Growth on complete medium positive control Select one of the spores Test on minimal medium to confirm presence of mutation negative control Grow on complete medium Minimal media supplemented only with… experimentals Choline Pyridoxine Riboflavin Minimal Nucleic Arginine control amino acid p-Amino Niacin Inositol acid Folic supplements acid Thiamine benzoic acid AP Biology One gene / one enzyme hypothesis Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E encoded enzyme enzyme E glutamate arg-G arg-H arg-F enzyme F ornithine substrate in AP biochemical Biology pathway enzyme G citruline enzyme H arginosuccinate arginine gene that was damaged 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum AP Biology "for their discovery that genes act by regulating definite chemical events" The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA replication AP Biology RNA protein DNA gets all the glory, but proteins do all the work! trait RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology 2007-2008 Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand synthesis of complementary RNA strand same sequence as RNA transcription bubble enzyme RNA polymerase 5 C DNA G 3 A G T A T C T A 53 G A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA AP Biology build RNA coding strand 5 RNA polymerase template strand Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall AP Biology 2007-2008 Transcription in Prokaryotes Initiation RNA polymerase binds to promoter sequence on DNA Role of promoter Starting point where to start reading start of gene Template strand which strand to read Direction on DNA always read DNA 35 APBiology build RNA 53 Transcription in Prokaryotes Promoter sequences enzyme subunit RNA polymerase read DNA 35 bacterial DNA Promoter TTGACA TATAAT –35 sequence –10 sequence RNA polymerase molecules bound to bacterial DNA RNA polymerase AP Biology strong vs. weak promoters Transcription in Prokaryotes Elongation RNA polymerase copies DNA as it unwinds ~20 base pairs at a time 300-500 bases in gene builds RNA 53 Simple proofreading 1 error/105 bases make many mRNAs mRNA has short life not worth editing! AP Biology reads DNA 35 Transcription in Prokaryotes Termination RNA polymerase stops at termination sequence RNA GC hairpin turn AP Biology Transcription in Eukaryotes Transcription Psssst… DNA can’t leave nucleus! RNA Processing Translation Protein AP Biology 2007-2008 Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm circular chromosome naked DNA no introns DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology Transcription in Eukaryotes 3 RNA polymerase enzymes RNA polymerase 1 RNA polymerase 2 AP Biology transcribes genes into mRNA RNA polymerase 3 only transcribes rRNA genes makes ribosomes only transcribes tRNA genes each has a specific promoter sequence it recognizes Transcription in Eukaryotes Initiation complex transcription factors bind to promoter region upstream of gene suite of proteins which bind to DNA turn on or off transcription TATA box binding site recognition site for transcription factors transcription factors trigger the binding of RNA polymerase to DNA AP Biology Post-transcriptional processing Primary transcript (pre-mRNA) eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA) mRNA splicing = edit out introns protect mRNA from enzymes in cytoplasm add 5 cap mRNA P add polyA tail 5' G PP 3' A intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript AP Biology mature mRNA transcript ~1,000 bases spliced mRNA Splicing must be accurate No room for mistakes! splicing must be exactly accurate a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AP Biology AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| Whoa! I think we just broke a biological “rule”! Splicing enzymes snRNPs small nuclear RNA exon proteins Spliceosome exon 3' spliceosome 5' 3' cut & paste No, not smurfs! “snurps” AP Biology intron 5' several snRNPs recognize splice site sequence snRNPs snRNA mature mRNA lariat 5' exon 5' 3' exon 3' excised intron Ribozyme 1982 | 1989 RNA as ribozyme some mRNA can even splice itself RNA as enzyme Sidney Altman AP Biology Yale Thomas Cech U of Colorado Translation from nucleic acid language to amino acid language AP Biology 2007-2008 Translation Codons AP Biology blocks of 3 nucleotides decoded into the sequence of amino acids Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall AP Biology 2007-2008 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed AP Biology Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes AP Biology takes eukaryote ~1 hour from DNA to protein RNA processing Translation in Eukaryotes AP Biology 2007-2008 From gene to protein transcription DNA mRNA mRNA leaves nucleus through nuclear pores AP Biology translation nucleus a a a a a a a a a a protein a ribosomea a a a a proteins synthesized by ribosomes using instructions on mRNA cytoplasm How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG mRNA 4 AUCG protein AUGCGUGUAAAUGCAUGCGCC ? Met Arg Val Asn Ala Cys Ala 20 AP Biology How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein AP Biology Met Arg Val Asn Ala Cys Ala Cracking the code 1960 | 1968 Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids AP Biology created artificial UUUUU… mRNA found that UUU coded for phenylalanine (phe) The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AP Biology AUG methionine Stop codons UGA, UAA, UAG How are the codons matched to amino acids? DNA mRNA 3 5 5 3 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC codon 3 tRNA UAC amino acid Met AP Biology 5 GCA Arg CAU Val anti-codon From gene to protein transcription DNA translation mRNA a ribosomea a a a a a a a a a a protein a a a a aa AP Biology nucleus cytoplasm Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end AP Biology Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome easily Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon AP Biology tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits AP Biology large small E P A Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain holds tRNA carrying growing polypeptide chain Met E site (exit site) AP Biology empty tRNA leaves ribosome from exit site U A C A U G 5' E P A 3' Building a polypeptide Initiation Elongation brings together mRNA, ribosome subunits, initiator tRNA adding amino acids based on codon sequence Termination 3 2 1 end codon Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' C UGAA U mRNA A U G 3' E P A AP Biology 5' UAC GAC A U G C U GAA U 5' 3' U A C GA C A U G C U G AAU 5' 3' U AC G A C AA U AU G C U G 3' A CC U GG U A A 3' Destinations: Protein targeting Signal peptide address label start of a secretory pathway AP Biology secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail large ribosomal subunit polypeptide 5' small ribosomal subunit AP Biology tRNA E P A ribosome 3' Got Questions? Can I translate that for you? AP Biology 2007-2008
