Translation from nucleic acid language to amino acid language Draw 7 boxes on your paper Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall 2007-2008 Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomes read mRNA as it is being transcribed Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • RNA processing Box 1: What’s the difference between translation in prokaryotes and eukaryotes? Box 2: what’s the same between translation in prokaryotes and eukaryotes? Translation in Eukaryotes 2007-2008 From gene to protein transcription DNA translation mRNA mRNA leaves nucleus through nuclear pores nucleus a a a a a a a a a a protein a a ribosome a a a a proteins synthesized by ribosomes using instructions on mRNA cytoplasm Box 3 •What are 3 differences between transcription and translation? How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG mRNA 4 AUCG protein AUGCGUGUAAAUGCAUGCGCC ? Met Arg Val Asn Ala Cys Ala 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cys Ala Cracking the code • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Translation • Codons • blocks of 3 nucleotides coded into the sequence of amino acids Genetic information is encoded as a sequence of nonoverlapping base triplets, or codons. In box 4, draw a codon and its relationship to an amino acid The code • Code for ALL life! • The genetic code is nearly universal, shared by organisms from the simplest bacteria to the most complex animals • strongest support for a common origin for all life Why is the wobble good? • Code is redundant Start codon • several codons for each amino acid AUG • 3rd base “wobble” methionine Stop codons UGA, UAA, UAG Many amino acids have more than one codon (redundancy). Box 5 •What does it mean that the code is “redundant”? Codons must be read in the correct reading frame for the specified polypeptide to be produced. How are the codons matched to amino acids? DNA mRNA 3 5 5 3 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC codon 3 5 tRNA UAC amino acid Met GCA Arg CAU Val anti-codon Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain Met • E site (exit site) • empty tRNA leaves ribosome from exit site U A C A U G 5' E P A 3' Box 6 •Describe the structure and 3 sites of the ribosome. Initiation: Initiation involves the small subunit of the ribosome binding to the 5' end of mRNA. The first tRNA enters the ribosome at the P site to initiate translation at the start codon. Another tRNA brings the next amino acid into the A-site of the ribosome. A peptide bond forms between the first two amino acids. The tRNA is then moved from the A-site to P-site and the ribosome moves over one codon. The first tRNA is released from the E site. The process continues along the mRNA until a “stop” codon is reached. Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination 3 2 1 • end codon Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' CU GA A U mRNA A U G 3' E P A 5' UAC GAC A U G C U GAA U 5' 3' U A C GA C A U G C U G AAU 5' 3' U AC G A C AA U AU G C U G 3' A CC U GG U A A 3' •Tell the person next to you the process of translation. From gene to protein transcription DNA translation mRNA a a ribosome a a a a a a a a a a protein a a a a aa nucleus cytoplasm Protein targeting • Signal peptide • address label Destinations: start of a secretory pathway secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail large ribosomal subunit polypeptide 5' small ribosomal subunit tRNA E P A ribosome 3' Phenotypes are determined through protein activities. Point mutation leads to Sickle cell anemia What kind of mutation? Missense! Sickle cell anemia • Primarily Africans • recessive inheritance pattern • strikes 1 out of 400 African Americans Phenylketonuria (PKU) is an autosomal recessive genetic disorder caused by a mutation in the gene for an enzyme that is necessary to metabolize the amino acid phenylalanine. Untreated PKU can lead to mental retardation, seizures, and other serious medical problems. Treatment for PKU is a PHE-restricted diet. Cystic fibrosis • Primarily people of European descent • strikes 1 in 2500 births • 1 in 25 whites is a carrier (Aa) • normal allele codes for a membrane protein that transports Cl- across cell membrane • defective or absent channels limit transport of Cl- (& H2O) across cell membrane • thicker & stickier mucus coats around cells • mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections • without treatment children die before 5; with treatment can live past their late 20s Chloride channel Effect on Lungs normal lungs airway Cl- transports chloride through protein channel out of cell Osmotic effects: H2O follows ClCl- channel H 2O cells lining lungs cystic fibrosis ClH 2O bacteria & mucus build up thickened mucus hard to secrete mucus secreting glands Box 7 How does protein affect phenotype?