DNA It’s not just for college anymore! Web Sites • DNA structure and replication animation http://207.207.4.198/pub/flash/24/menu.swf • Overview of gene expression http://www.genomicseducation.ca/animations/gene_expression.asp • DNA Models & Translation model http://www.indigo.com/models/dna-models.html Learning Goals for DNA & Genetics • • • • Know structure/function of DNA Know DNA is genetic material Illustrate how DNA specifies traits Understand mutations are change in DNA sequence • Understand relationship between mutations in DNA and expressed phenotype What Is DNA • Deoxyribonucleic acid – Everyone knows this? • Molecule of heredity – Constitutes our genes – Genes are stretches of DNA sequence – DNA is present in each cell – Passed on to gametes and into progeny What is DNA, Really • Polymer of nucleotides • Polymer? Nucleotides? • Polymer – A large molecule that is a series of joined smaller molecules • Nucleotides – The small molecules that make up the large DNA polymer DNA Concepts • • • • • Genes Chromosomes Complementary base-paired double helix Polymer of nucleotides The sequence of nucleotides is the information of DNA DNA Concepts • • • • • DNA controls traits of organism Traits pass from parent to offspring DNA is copied during cell division DNA is present in sex cells DNA is passed from parent to offspring Why are DNA Concepts Difficult? • Chemical names? – Deoxyadenosine, purine, pyrimidine • Chemical processes? – base pairing, hydrogen bonds • Genetic principles? – DNA replication – Mutations – Chromosome segregation & assortment Why is DNA So Difficult? • Chemical Names – Deoxyadenosine monophosphate – Pyrimidine • Persons Names – Martina Navratilova – Hakeem Olajuwon How About Pictures + Names A B C E Hakeem Olajuwon __ F Purine __ C Kareem Abdul-Jabbar __ H Deoxyadenosine monophosphate __ B Pyrimidine D __ G Martina Navratilova __ D Deoxycytidine monophosphate __ A Nadia Comaneci __ F G E H Nucleotides The building blocks of DNA Nucleotide Structure Base always attached here Phosphates are attached there Nucleotides Adenosine monophosphate Cytidine monophosphate Guanosine monophosphate Uridine monophosphate Deoxyadenosine monophosphate Deoxycytidine monophosphate Deoxyguanosine monophosphate Deoxythymidine monophosphate Nucleotide Polymerization Reaction: Phosphodiester Bond Formation Order of Nucleotides • As nucleotides join the strand they generate a sequence • Inherent fidelity of DNA replication TAAGTGTACACGTA ATTCACATGTGCAT TAAGTGTACACGTA TAAGTGTACACGTA TCACATCGTAAGTGTACACGTA AGTCCGATCGTAACTGGGTCACATCGTAAGTGTACACGTA AGTCCGATCGTAACTGGG |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| TCAGGCTAGCATTGACCCAGTGTAGCATTCACATGTGCAT TCAGGCTAGCATTGACCC AGTGTAGCATTCACATGTGCAT ATTCACATGTGCAT TAAGTGTACACGTA ATTCACATGTGCAT DNA Sequence • Human Genome Project – sequencing the human genome • What does “sequencing” mean? – To determine the order of the nucleotides in the human DNA molecules – Human DNA molecules are our chromosomes – Each chromosome is a DNA double helix – Each DNA double helix is two single DNA molecules intertwined – Each single DNA molecule is a chain of nucleotide units – Sequencing is the method to determine what the exact order of units is in this chain Gene Expression DNA Gene Transcription RNA (messenger RNA) Translation Protein (sequence of amino acids) Functioning of proteins within living cells influences an organism’s traits. A Gene is a Transcription Unit Terminator Promoter & Regulatory sequences Coding sequences DNA Transcription mRNA 5 3 Start codon Ribosome binding site Open reading frame Stop codon Transcription Coding Overview of gene expression AC Translation Translation Elongation aa-tRNA entry Peptidyl transferase Translocation Termination Translation The code is 3 letter words, but what about punctuation? cbab GROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW • Code written in three letter words - codons • Ribosomes must start at the right place to read the message • There are three frames, but only one is read to give an intelligible message • Need a start codon (NOW) and a stop codon (END) to define the frame to use • frame b – NOW THE CAT SAW THE DOG BUT DID NOT RUN Reading Frames & Mutation Types • Frame shift mutations – Original reading frame is frame a – Insertions or deletions shift the reading frame a b c ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW ^ a b c ROWNDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW Reading Frames & Mutations a b c ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW • Once a ribosome begins translation in a particular frame (a) it does not shift frames • Therefore, if a mutation shifts the reading frame in the mRNA, the ribosome will read the wrong frame. ^ a b c ROWANDNOWTHECATSAWTHEADOGBUTDIDNOTRUNENDSEW NOW THE CAT SAW THE ADO GBU TDI DNO TRU NEN DSE W.. Reading Frames & Mutations a ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW • A change that creates a stop codon is a non-sense mutation • Generates a truncated protein ^^ a ROWANDNOWTHECATSAWTHEDOGBUTENDNOTRUNENDSEW NOW THE CAT SAW THE DOG BUT END Reading Frames & Mutations a ROWANDNOWTHECATSAWTHEDOGBUTDIDNOTRUNENDSEW • A change that creates a different codon is a mis-sense mutation • Generates a protein with an altered sequence ^ a ROWANDNOWTHECATSAWTHEHOGBUTDIDNOTRUNENDSEW NOW THE CAT SAW THE HOG BUT DID NOT RUN END Molecular Basis of Phenotype Effect of Mutations • Sickle cell disease – single nucleotide change AT