BIOTECHNOLOGY AND GENETIC ENGINEERING Text reading LAB Lyle and Louis Murder Mystery LAB Splicing a plasmid LAB Extracting DNA Worksheet “Gene Technology” Worksheet Chap 16 DNA Tech Web activity http://learn.genetics.utah.edu/content/labs/gel/ Important 3rd Quarter Dates: Bonus #1 – Feb. 18 Bonus #2 – March 18 CP #1- Feb 11 CP #2 – March 11 Video – April 6 Vocabulary (69-75) restriction enzyme, plasmid, gene cloning, gene therapy, chimera, hybrid read 226-228, 234,236-239, 246, 247 for next section on genetic engineering BIOTECHNOLOGY ARTICLES TO READ (ques. due Wednesday) (13 pts.) Definitions… Technology – any tool that makes life easier (toothpick, phone, space shuttle, screwdriver, computer) Biotechnology – the tool is a living creature that makes our life easier or better (usually dealing at the cellular or DNA level but might also include a cow pulling a plow) Genetic Engineering - modification of the DNA in an organism or exchange of DNA between organisms – why would we want to do this? BASICS OF INHERITANCE DNA is the hereditary molecule BLUE PRINT for all traits Universal and Interchangeable HUMAN CHROMOSOMES Coiled strands of DNA 23 pairs of chromosomes 23 from ♀ egg 23 from ♂ sperm DNA EXTRACTION LAB Crack open cells (squishing bag of fruit) Extract DNA (salty soapy solution) Isolate DNA (cold ethanol) Stringy and clumpy DNA – how does this fit with what we learned last chapter? Is strawberry DNA the same as human DNA? Would we extract human DNA the same way? I. Sexual reproduction ADD DRAWING TO NEXT PAGE II. Hybrid Offspring produced by the mating of different species. Every cell contains DNA from both species Can you name some hybrid animals? Peekenese and a poodle = peek-a-poo Horse and a donkey= mule ADD DRAWING TO NEXT PAGE Wolf/dog hybrid Liger or tiglon Zonkey or zedonk Llamal llama/camel hybrid III Chimera Produced in the laboratory EMBRYO FUSION- see article on "GEEP" Draw diagram of hybrid and chimera III Chimera Produced in the laboratory EMBRYO FUSION- see article on "GEEP" Draw diagram of hybrid and chimera GEEP IV IN VITRO FERTILIZATION Test tube babies Procedure female injected with hormones to cause ovulation of many eggs Male donates sperm Egg and sperm are mixed in a dish in a lab to create embryos Embryo implanted in surrogate mother Test Tube Babies In Vitro Fertilization (IVF) and Embryo Transfer (ET) 20% success rate Can be used for : Infertile couples Experimentation Increase the population of endangered species QUESTION? What do we do with the left over human embryos? V. Surrogate Motherhood VI Genetic Engineering and Moving Genes -Human Genome Project (video) HGP READ pg. 236 -(HGP)sequence all the base pairs in the human genome (2-3 billion pairs) (100,000 genes) -genome -all the possible bases in a species or individual gene- DNA sequence that codes for a protein. The protein may lead to a visible trait (I.e. eye color, hair texture, blood type etc) Genetic Disease- disease caused by a defective or mutant gene. Considered hereditary, if it can be passed on to the next generation (i.e. Huntingtons, Sickle Cell are major examples) MOVING GENES (the basics) Recombinant DNA involves 4 steps Procedure 1. DNA is cut and desired gene is removed 2. gene is attached to a vector for delivery into another cell 3. cloning - multiple copies of the gene are made by allowing the host cell to multiply 4. screening- cells with the new gene are sorted from the multitude produced BT Corn Insulin from bacteria Artificial insemination or embryo transfer How is the DNA cut? Restriction enzymes- recognize a specific DNA sequence and cuts it at every location How is the DNA delivered? Viruses, yeast or plasmid can be used. A plasmid is a loop of DNA that are independent of the main DNA of a bacteria cell. The same restriction enzyme is used to open the plasmid. Nucleotide pairs on the end of the gene and plasmid join in a complimentary fashion. The gene is now part of the host’s DNA How is the DNA separated? electrophoresis VIII Moral and Ethical issues WHY IS THIS BEING DONE? HOW IS THIS BEING DONE? WHO OR WHAT CAN IT BE DONE TO? Should this be done? Will anyone or any organism be injured? Who will benefit from this research? Are there alternatives to this procedure? How will this be paid for? What will be done after the process? Is there a danger to the environment? The Use of Animals in Science and Industry sources of food (w hole animal) sources of food byproduct (i.e. eggs, milk) industrial raw materials applications - source of f abric/clothing (i.e. w ool, leather) - source of industrial molecules (i.e. rennin) - testing of cosmetics medical applications - source of pharmaceutical molecules (i.e. insulin) - source of transplant organs (i.e. valves, cornea) transportation and laborers laboratory test specimen - testing of new drugs - testing of environmental hazards - f or endangered species protection - f or broadening scientif ic know ledge educational tools/teaching purposes - dissection - surgical practice - behavioral observation - physiological observation companions/pets Chimpanzee (vertebrate with very advanced nervous system) Monkey (vertebrate with advanced nervous system) Dog/Cat (vertebrate with advanced nervous system) Cow/ livestock (vertebrate with advanced nervous system) Rodent/Rat/Rabbit (vertebrate with more advanced nervous system) Birds/ Fowl (vertebrate with relatively simple nervous system) Frogs (vertebrate with relatively simple nervous system) Fish/ Zebrafish (vertebrate with relatively simple nervous system) Octopi (invertebrate with advanced nervous system) Worms (invertebrate with simple nervous system) Any animal of any kind should be used for this purpose. Anim al Use (general, - specific) No animal of any kind should be used for this purpose. Place an "X" in each box that you agree with the use of that species for that purpose. Place an "NO" in each box that you do not agree with the use of that species for that purpose. Place a "n/a" is placed where a decision is not applicable) Cloning Around (reproductive cloning) All SOMATIC CELLS (body cells) contain DNA blueprint for the individual organism Any cell can behave like a ZYGOTE to produce an entire individual HISTORY OF CLONING 1953 1996 2002 2003 2005 frog sheep cat horse dog 277 82 841 ATTEMPTS BEFORE SUCCESS CLONING BASICS Reproductive Cloning is expensive and inefficient CC cost $50,000 Horse 1/841 .12% Sheep 1/277 .36% STEM CELL RESEARCH What’s so special about Stem Cells? Biological immortality Pluripotentcan become any of 220 cell types Therapeutic potential Pancreas beta cells to produce insulin to relieve diabetes Dopamine producing cells in the brain to relieve Parkinson’s disease Regrowth of missing limbs ADULT STEM CELLS “cells in adult tissues that are undifferentiated” Multipotent (can become many of the 220 cell types) Sources bone marrow, umbilical cord, hair follicle, skin, adipose cells, More are known Most well know example of Adult Stem Cell… bone marrow stem cells TEST FRIDAY BIOTECHNOLOGY Text pages (226-228, 234, 236-239,246,247) 2 articles w/questions Worksheets Gene tech and DNA tech L and L Lab activity Interpret electrophoresis banding patterns Diagram and explain hybrids and chimera Provide examples of above Explain techniques and uses of IVF and ET Vocabulary (68-75) Be able to answer the question “Pick one example of biotechnology that we have studied, explain what it is and provide your view of the technology” Biotechnology Test Review Questions: Easy Small, circular piece of bacterial DNA is called a ____. Give two examples of vectors: The entire collection of genes within human cells is called the _______________. Difference between technology and biotechnology? Function of restriction enzymes? HGP stands for? How many base pairs in HG? How many proteins? Difference between surrogate and biological mother? A _____________ is caused by a defective or mutant gene. Define gene. The first cell created by sexual reproduction is called a Medium 1. Inserting unrelated pieces of DNA together will result in ____________________. 2. IVF stands for? What is a synonym used for IVF? 3. What does transgenic mean? 4. Identical twins are considered to be genetic ___________. 5. How does IVF work? What does the female have to do? What does the male have to do? 6. Why does IVF sometimes result in twins, triplets, or quads? 7. Difference between fraternal vs. identical twins? 8. How does Gel Electrophoresis separate DNA fragments? 9. What is an example of a genetic disease? 10. What kind of ethical questions arise from IVF? Difficult What is the difference between gene therapy and genetic engineering? Difference between a hybrid and chimera? Steps of genetic engineering? The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT What research can be done using gel electrophoresis?