+DO NOT WRITE ON ME+
HBS PRACTICE FINAL PART 1
+DO NOT WRITE ON ME+
Write your answers on looseleaf paper. Do not write on this document!
This document will serve as a studying tool – it is not a perfect match to your final or your EoC, but if you don’t know
something you should review it for your final and your EoC.
1. The nose is _______________________ to the neck.
A. Posterior
C. Inferior
B. Superior
D. Anterior
2. Surgery is being done on the proximal part of an arm.
Which location is the surgery being performed.
A. A
B. B
C. C
D. D
3. A child falls out of bed and suffers a broken metatarsal. The child has broken their ____________________.
A. Foot
C. Wrist
B. Hand
D. Ankle
4. You see a person winking at you. Which muscle is the person using?
A. Orbicularis oris
C. Orbicularis oculi
B. Ocularis orbuli
D. Temporalis
5. The branch of physical anthropology where anthropological data and techniques are used to determine sex, age,
race, or percentage of skeletal or biological materials in civil or criminal law.
A. Forensic Anthropology
C. Serology
B. Biometrics
D. Forensic Odontology
6. Animal tissue that function mainly to bind and support other tissues, having a sparse population of cells
scattered through an extracellular matrix.
A. Connective Tissue
C. Epithelial Tissue
B. Muscular Tissue
D. Nervous Tissue
7. The skeleton of the trunk and head is referred to as _____________.
A. Appendicular Skeleton
C. Peripheral Skeleton
B. Axial Skeleton
D. Connective Skeleton
8. Connective tissue in which fat is stored and which has the cells distended by droplets of fat.
A. Areolar Tissue
C. Epithelial Tissue
B. Adipose Tissue
D. Smooth Muscle Tissue
9. Which of the following describes tissues?
A. A group of organs with similar structure and function
B. Sheets of cells connected together by membranes.
C. A group of cells in the same area of the body.
D. A group of associated cells with similar structure and function.
10. Which type of tissue is shown in Figure 1?
A. Connective
C. Muscular
B. Epithelial
D. Nervous
11. Which type of tissue is shown in Figure 1?
A. Adipose
C. Simple columnar epithelium
B. Skeletal muscle
D. Bone
12. A person suffers from a condition resulting in a lack of coordinated movement in the walls of the small
intestine. Which tissue is most likely malfunctioning?
A. Skeletal muscle
C. Cardiac muscle
B. Smooth muscle
D. Epithelial tissue
13. You are looking at a prepared slide with a microscope and see striations. What tissue are you looking at?
A. Connective
B. Epithelial
C. Muscular
D. Nervous
14. What are the most probable functions of the tissue in the figure to the right?
A. Contraction of chambers of the heart
C. Energy storage and insulation
B. Control and integration of stimuli
D. Secretion and absorption
15. Which of the following bones would be best used to determine gender?
A. Femur
C. Pelvis
B. Skull
D. Humorous
16. Which of the following bones would be best used to determine height?
A. Femur
C. Pelvis
B. Skull
D. Humorous
17. The separation of nucleic acids or proteins, on the basis of their size and electrical charge, by measuring their
rate of movement through an electrical field in a gel
A. Biometrics
C. Polymerase Chain Reaction (PCR)
B. Gel Electrophoresis
D. Agarose Gel Plates
18. When DNA moves through an Agarose gel during electrophoresis, the fragments with _____________ base pairs
move more quickly and are further towards the end of the gel when the run is complete.
A. More
C. Tightly bonded
B. Less
D. Weakly bonded
19. A molecule that encodes the genetic instructions used in the development and functioning of all known living
organisms and many viruses is ____________.
A. ATP
C. PCR
B. DNA
D. BMI
20. The measurement and analysis of unique physical or behavioral characteristics, especially as a means of
verifying personal identity.
A. Forensic Anthropology
C. Serology
B. Biometrics
D. Forensic Odontology
21. DNA is _____________ and will move through the gel toward the ________end of the electrophoresis chamber.
A. Neutral, negative
C. Positive, negative
B. Negative, neutral
D. Negative, positive
22. Which biometric is considered Non-Invasive?
A. Retinal Scan
B. Vein Mapping
C. Voice Recognition
D. All of these
23. Differences in DNA sequence on homologous chromosomes that can result in different patterns of DNA
segments resulting from treatment with restriction enzymes.
A. PCR
C. DNA
B. RFLPs
D. Ribosomes
24. An enzyme that cuts DNA at or near specific recognition nucleotide
sequences known as restriction sites.
A. Restriction Enzymes
C. DNA Ligase
B. Polymerase
D. Endonuclease
Identify the labeled structures found in the brain on the diagram to the left.
25. Corpus Callosum
28. Frontal Lobe
26. Occipital Lobe
29. Pons
27. Cerebellum
28.
29.
30. A depression on the surface of the brain is __________________________.
A. Sulcus
C. Brain Stem
B. Gyrus
D. Lobe
31. The brain and spinal cord are part of which nervous system?
A. Central Nervous System
C. Appendicular Nervous System
B. Peripheral Nervous System
D. Axial Nervous System
32. Breathing and Heart rate are controlled by the _______________________.
A. Brain stem
C. Parietal lob
B. Occipital lobe
D. Cerebellum
33. Vision is controlled by the ___________________.
A. Brain stem
C. Parietal lobe
B. Occipital lobe
D. Cerebellum
34. If the cerebellum experiences a large blow from a blunt object, what would probably happen?
A. Uncoordinated body movements
C. Loss of memory
B. Blurred vision
D. A change in breathing rate
35. Nerves that carry impulses toward the brain are ___________________________.
A. Sensory Neurons
C. Motor Neurons
B. Efferent Neurons
D. Interneurons
36. A simple spinal reflex goes along which of the following reflex arcs?
A. Efferent neuron, interneuron, afferent neuron
B. Afferent neuron, efferent neuron, interneuron
C. Afferent neuron, interneuron, efferent neuron
D. Efferent neuron, afferent neuron, interneuron
37. An automatic response to a stimulus that often does not pass through the brain is called ___________________.
A. Synapse
C. Reflex
B. Reaction
D. Acton Potential
38. Which membrane protein is responsible for restoring the original concentration of ions during the action
potential?
A. Na+ Channel
C. Ca+ Channel
+
B. K Channel
D. Na+/K+ Pump
39. Which portion of the neuron contains the most neurotransmitter receptor sites?
A. Schwann cells
C. Dendrites
B. Axons
D. Soma (cell body)
40. At rest, the outside the axon is:
A. Positive
B. Negative
41. At rest there is a higher concentration of potassium ions ___ the axon.
A. Outside
B. Inside
42. During ___, an axon is sending an impulse.
A. Resting potential
C. Repolarization
B. Depolarization
D. Hyperpolarization
43. During depolarization of an axon, ___ ions diffuse into the cell.
A. Sodium
C. Potassium
B. Chloride
D. Calcium
Identify the labeled structures of the action potential diagram below.
44. Depolarization
45. Resting potential
46. Threshold
47. Hyperpolarization
48. Repolarization
49. What causes the inside of the membrane to reverse charge
and begin the action potential?
A. When K+ channels close and Na+ rushes in
B. When Na+ channels close the K+ rushes in
C. When the Na+ K+ pump stops working
D. None of the above
Identify the labeled structures of the neuron diagram below.
50. Synapse
51. Axon
52. Dendrite
53. Myelin Sheath
54. Soma (cell body)
55. Axon Terminal
56. Which gland secretes hormones that regulate the anterior pituitary and the posterior pituitary?
A. Hippocampus
C. Endocrine gland
B. Thalamus
D. Hypothalamus
57. The destination cell for each specific hormone.
A. Target Cell
B. Blood Cell
C. Reflex Cell
D. Receptor Cell
58. A gland secretes a substance into the small intestine through a duct. This gland is considered a (an)
A. Exocrine gland
C. Endocrine gland
B. Target gland
D. Endocrine and exocrine gland
59. Circulating chemical signals found in all multicellular organisms that are formed in specialized cells, travel in
body fluids, and coordinate the various parts of the organism by interacting with target cells.
A. Hormone
C. Restriction enzyme
B. Enzyme
D. Synapse
60. A group of subcortical structures (as the hypothalamus, the hippocampus, and the amygdala) of the brain that
are concerned especially with emotion and motivation.
A. Diencephalon
C. Limbic System
B. Peripheral Nervous System
D. Central Nervous System
61. Which hormone is produced by the pancreas to promote the increase in the sugar content of the blood by
breaking down glycogen in the liver?
A. Glucose
C. Tyroxine
B. Glucagon
D. Insulin
62. Say a person eats a doughnut with extra sprinkles. What hormone
would be released to promote cells to take in this extra energy for storage?
A. Estrogen
C. Thyroid
B. Insulin
D. Glucagon
Hormone
63. Using the diagram to the right, what type of hormone is represented?
A. Steroid
B. Non-steroid / Protein
64. Using the diagram to the right, the hormone is most likely?
A. Estrogen
B. Insulin
65. A ________________________ is a type of self-regulating system where increased output from the system
inhibits future production by the system. In other words, the system controls how much product it makes by
shutting down manufacturing when levels of output or the amount of accumulated product gets too high.
A. Positive feedback loop
C. Circulatory feedback loop
B. Negative feedback loop
D. Bilateral feedback loop
66. The glands and parts of glands that produce secretions help to integrate and control bodily metabolic activity,
and include especially the pituitary, thyroid, parathyroid, adrenals, islets of Langerhans, ovaries, and testes.
A. Limbic System
C. Integumentary System
B. Endocrine System
D. Lymphatic System
67. An endocrine gland at the base of the hypothalamus; consists of a posterior lobe, which stores and releases two
hormones produced by the hypothalamus, and an anterior lobe, which produces and secretes many hormones
that regulate diverse body functions.
A. Pituitary Gland
C. Adrenal Gland
B. Thalamus
D. Thyroid
68. Glands that secrete their essential product by way of a duct to some environment external to itself, either inside
the body or on a surface of the body.
A. Endocrine Gland
C. Salivary Glands
B. Exocrine Gland
D. Pancreatic Gland
69. Visual condition in which the eye focuses an image behind the retina. Vision is better from a distance.
A. Glaucoma
C. Myopia
B. Hyperopia
D. Astigmatism
70. A misshapen lens causes this eye disorder.
A. Astigmatism
B. Cataracts
C. Near-Sightedness
D. Myopia
71. The major differences between a rod and a cone are _____________________.
A. Cones sense color and rods sense light
C. Rods sense faint light & color, cones only sense light
B. Rods sense color and cones sense light
D. Cones sense color and light, rods only sense color
72. This is a measure of body fat based on both height and weight of an individual.
A. BMR
C. TDEE
B. BMI
D. ATP
73. A friend tells you ventral and anterior can be interchangeable. Is this statement accurate? Why or Why not?
A. Yes, because they both mean in the front
B. No, it depends on the organism (bipedal or quadrapedal)
C. Yes, because he is really smart
D. No, because one refers to the front and the other terms refers to the back
74. You are a surgeon who has just made a transverse cut on the superior end of the proximal radius. Where is your
patient having surgery?
A. Wrist
C. Shoulder
B. Elbow
D. Ankle
75. A person is suffering from overactive bladder. They consistently have to urinate, because their bladder is
contracting. Which type of the tissue is to blame?
A. Muscle Tissue
C. Epithelial Tissue
B. Connective Tissue
D. Adipose Tissue
76. What structure are the true ribs attached to on the anterior side of the body?
A. Sternum
C. Scapula
B. Clavicle
D. Vertebrae
77. Which type of tissue has a high rate of cancer because it is found in areas of the body that are in direct contact
with the outside environment.
A. Skeletal muscle tissue
C. Epithelial tissue
B. Nervous tissue
D. Adipose tissue
78. Which is the correct order of process for gel electrophoresis?
A. Amplifying or copying DNA, cutting the DNA with restriction enzymes, gel electrophoresis
B. Gel electrophoresis, amplifying or copying DNA, adding restriction enzymes
C. Amplifying or copying DNA, gel electrophoresis, cutting with enzymes
D. None of the above
79. Why do scientists load DNA of known sizes (ladder) into the Agarose gel?
A. It makes it easier to determine sizes of unknowns using comparison techniques.
B. To fill in all the slots on the gel so you can run it
C. The practice loading the DNA before you get to the important DNA.
D. Do they know how long the gel needs to run
80. A woman suffered severe damage to her brain stem in a car accident and was pronounced dead at the scene.
Why was that injury so lethal?
A. Any damage to the brain or spinal cord is lethal
B. The brain stem regulates sleeping patterns
C. The brain stem is too soft to withstand any type of trauma
D. The brain stem is responsible for involuntary vital functions in the body
81. A young woman suffers blunt force trauma to the head. In the years following, she cannot seem to retain
information from the previous days, but she does know who her family is and a lot about her past. What part of
her brain suffered damage?
A. Hypothalamus
C. Wernicke’s Area
B. Hippocampus
D. Brocca’s Area
82. The motor cortex is located at the back of the ___________________ in the cerebrum and is responsible for
_________________________.
A. Frontal, Movement
C. Occipital, Movement
B. Parietal, Memory
D. Temporal, Memory
83. Multiple Sclerosis affects the nervous system in that it degrades the myelin sheath that surrounding the axon of
neurons. How does this account for the symptoms associated with multiple sclerosis?
A. The electrical signals are completely inhibited so that an affected individual gradually loses
function of all body systems
B. The electrical signals in the CNS are disrupted in a way that that causes a wide range of
symptoms that vary between affected individuals
C. The electrical signals in the peripheral nervous system over fire causing an affected
individuals to have intense seizures
D. The neurons begin to completely degrade and electrical signals cannot be carried out leaving
an affect individual paralyzed
84. When an action potential is generated, which is the first to take place?
A. Sodium channels open
C. Sodium channels close
B. Potassium channels open
D. Potassium channels close
85. When the patellar tendon is hit with a hammer, what happens?
A. The signal travels to the spinal cord back to the knee causing a kick jerk reflex
B. The signal travels to the spinal cord back to the knee causing a voluntary response
C. The signal travels to the brain back to the knee causing a kick jerk reflex
D. The signal travels to the brain back to the knee causing a voluntary response
86. Shortly after eating a meal, the blood glucose level in the human body rises. Which hormone is produced to
restore normal blood glucose levels?
A. Glucagon
C. Insulin
B. Glycogen
D. Thyroxine
87. Why are hormones able to travel past all kinds of cells/ tissues and go directly to its target organ of choice?
A. The hormones are always released by a gland that is close in proximity to its target organ,
ensuring no connections with unwanted cells.
B. The Target organ releases receptors out into the blood stream so that the hormone can find and
follow them to the target organ.
C. The target cell has specific receptors on its surface that only the desired hormone will attach to.
D. Hormones are only selective to the desired body system and not to specific cells.
88. The hypothalamus and the pituitary glands are sometimes referred to as the “master” glands, because their
hormones either directly or indirectly control the entire endocrine system. One of the hormones that it secretes
is Growth Hormone (GH), what is its target organ?
A. The Adrenal Gland
C. The pancreas
B. The Thyroid Gland
D. Stimulates all body cells
89. Light passes through the following structures in which order?
A. Vitreous humor, lens, aqueous humor, cornea
B. Cornea, aqueous humor, lens, vitreous humor
C. Cornea, vitreous humor, lens, aqueous humor
D. Aqueous humor, cornea, lens, vitreous humor
90. When a person can see something from 50 feet that others with “normal” vision can see at 20 feet, that person
is said to have ________________ Vision.
A. 20/20
C. 50/20
B. 20/50
D. Poor
91. Which of the following organs of the digestive system is different from the others because it does NOT produce
any secretions that aid in the digestive process?
A. Salivary glands
C. Liver
B. Esophagus
D. Stomach
92. Why does the digestive system have three different types of Amylase: Salivary Amylase, Pancreatic Amylase,
and Intestinal Amylase.
A. Each type of Amylase breaks down a different type of Carbohydrate
B. As the Salivary enzyme moves through the stomach it gets denatured and new ones need to
be produced to continue to break down Carbohydrates
C. Salivary Amylase breaks down Carbohydrates, Pancreatic Amylase breaks down protein, and
Intestinal Amylase breaks down fats.
D. Each enzyme attaches to its predecessor to help break down the larger foodstuff.
93. You have just taken a bite out of grilled chicken. Which of the following enzymatic descriptions matches what
will happen to this bite of food as it travels through the digestive system.
A. Protein digestion begins in the mouth with salivary Amylase, as it travels to the stomach more amylase
from the pancreas is secreted to continue the large molecule breakdown. Lastly, intestinal amylase breaks
the smaller pieces down until they can be absorbed into the blood stream.
B. Protein digestion begins in the intestines where bile acids emulsify (break down) the large molecules into
smaller ones so that it can be moved into the blood stream for transport around the body.
C. Protein digestion begins in the stomach, where gastric juices begin to break down the molecules. Then in
the small intestines, several pancreatic enzymes continue to break the molecules down into amino acids.
D. Chicken is composed completely of dietary fiber, so it will only go through mechanical digestion and exits
the body without absorption.
94. Below is a plasmid with restriction sites for BamHI and EcoRI. Which lane shows a digest with EcoRI only?
A. I
B. II
C. III
D. IV
95. Evaluate the following segment of DNA using the knowledge that EcoRI recognizes the sequence 5’ GAATTC 3’
and cuts between the G and the A base creating single strand “sticky ends”.
GGAATTAAGCTTATTGAATTCTTAAAGCTTTAGAATTCGGGGCCCACATGAATTCAATT
CGTTAATTCGAATAACTTAAGAATTTCGAAATCTTAAGCCCCGGGTGTACTTAAGTTAA
What are the sizes of the fragments from largest to smallest?
A. 16, 13, 13, 5
C. 16, 13, 15, 5
B. 18, 16, 14, 7
D. 16, 14, 13, 6
96. Phineas Gage suffered a severe injury to his brain, when tamping dynamite at a railroad construction site.
Miraculously he survived, but he suffered drastic changes to his personality. Before the accident he had been
their most capable and efficient foreman, and who was looked on as a shrewd smart businessman. He was now
fitful, irreverent, and grossly profane, showing little concern for his fellows. He was also impatient and
obstinate, yet capricious and vacillating, unable to settle on any of the plans he devised for future action. His
friends said he was "No longer Gage." What part of this brain suffered the injury?
A. Frontal lobe
C. Brain stem
B. Limbic System
D. Parietal Lobe
97. An inhibitory neurotransmitter fails to reuptake. Which of the following is a consequence of this?
A. The neurotransmitter can no longer bind to the receptor, inhibition can no longer take place
B. The neurotransmitter continues to bind the receptor, the receptor is over stimulated
C. The inhibitory neurotransmitter is degraded in the synapse and no consequence occurs
D. The dendrites release a counter neurotransmitter to return to homeostasis
98. Pituitary disorders are often very hard to diagnose as they cause such a variety of hormonal and neurological
symptoms. Tumors can actually stimulate or inhibit hormone production. Your patient is suffering from
Hypothyroidism and is receiving too little T3/T4, two hormones that control your body’s metabolism and works
through a negative feedback system. What symptoms might occur and how might his doctor solve his problem
A. He will experience weight gain, and he needs to be given more T3/T4
B. He will experience weight loss, and he needs to be given more T3/T4
C. He will experience weight gain, and he needs to decrease T3/T4 Levels
D. He will experience weight loss, and he needs to decrease T3/T4 levels
99. After a recent eye exam, Emily now has new prescription eyeglasses to correct myopia. She notices that the
lenses have a concave curvature. Which phrase completes the following sentence regarding the purpose of
concave shaped corrective lens?
Concave lenses cause the incoming light rays to ____________________________.
A. Come together (converge), moving the focal point from in front of the retina to directly onto
the retina.
B. Come together (converge), moving the focal point from behind the retina to directly onto the
retina.
C. Spread apart (diverge), moving the focal point from behind the retina directly onto the
retina.
D. Spread apart (diverge), moving the focal point in front of the retina to directly onto the
retina.
100. You are a dietitian. Your patient Janie is a 30-year-old administrative assistant who worries about her
weight, but has recently lacked the time and motivation to do something about it. She is 5’3” or 1.6 m and 160
(lbs) or 73 kg. She was a collage athlete, but has not recently been able to participate in sports because of her
job commitment. Janie spends countless hours at her computer planning and making calls. She often skips
lunch, because she is so busy and forgets. Then later comes home and snacks, and then eats dinner an hour
later. She has no food allergies and cooks dinner most nights. These meals tend to be balanced with a protein,
carb, and a vegetable.
Calculate Janie’s BMR and BMI. Using the following formulas.
BMI: Weight (kgs)/ Height (m)2
BMR: = 655.1 +(9.5663 x Weight in kg) +(1.85 x Height in cm) – (4.676 x Age)
A. BMI= 10, BMR= 960
C. BMI= 45, BMR= 1,216
B. BMI= 21, BMR= 1,140
D. BMI= 28.5, BMR= 1,509