Strategic Management Walter J. Ferrier Strategy as Process and Perspective Page 2 Strategic Management Process 1. Articulate Mission / Intent • Sense of purpose, direction… • • • • In which industries does firm compete? How does firm compete? Who are customers? Who are competitors? Page 3 2. Set Objectives & Performance Targets • Financial – Achieve 10% ROE and $1.55 EPS by YE08 – Increase stock price by $4.00-5.00/share • Strategic – Become low price leader in industry by YE09 – Enter five new country markets by YE11 Page 4 3. Develop a Strategy • Strategic themes/thrusts …How to compete: – International expansion – Increase brand name and reputation – Innovate by introducing new products – Aggressive behavior against rivals in old products Page 5 4. Implement Strategy • Develop action plan at functional level – Establish European distribution center • Buy warehouse facility near airport in Germany • Re-tool with robotic material handling system – Create new ad campaign for 2008 Olympics • Get endorsement contract with Lance Armstrong, Marylou Retton, Mia Hamm, and Michael Johnson • Develop TV ad with Spike Lee – Launch new version of product • Create multifunctional design team • License Oracle’s newest technology • Increase R&D budget by 30% – Cut prices on older version of product by 33% Page 6 5. Evaluation and Adjustment • Assess results relative to goals – Established price leadership in 2006 – Achieved only 4% ROI in 2006 • Identify new opportunities / constraints – New technologies are coming – Rivals are merging • Change strategy / implementation plan (as needed) Page 7 Strategic Planning vs. Strategizing Intended Strategy Strategy Carried Out Dropped Strategic Actions Emergent Strategic Actions Page 8 Miles & Snow Strategy Types Defenders Prospectors Analyzers Reactors (?) Competitive advantage results from a clear and direct match between the firm’s: – Mission and values • The firm’s definition of itself – Approach to business-level strategy • New vs. existing markets, first-mover advantage, cost vs. innovation – Characteristics and behaviors • Organizational structure, corporate culture, command/control systems Page 9 Defenders Perspective • Defend current markets • Narrow product domain • Cautious growth strategies • Emphasis on efficiency Process • Intensive, systematic strategic planning • Centralized control systems • Leverage existing, proven technologies • Performance based on efficiency Page 10 Prospectors Perspective • Open to experimentation • Exploration of new markets • Aware of external trends • Open to growth spurts • Emphasis on innovation Process • Strategy driven by innovation • First-mover advantage • Decentralized control systems • Performance based on results Page 11 Analyzers Perspective • Keenly aware of external trends • Balance between exploration and exploitation • Purposeful growth building on proven capabilities, ideas Process • Strategy driven by competitive intelligence, analysis • “Fast-second” strategic maneuvering • Performance based on results Page 12 What Makes Shareholders Rich? ...Create New Wealth – Vision looks beyond current boundaries – – – – Strategy as continuous process New perspectives, voices, conversations Change rules of game Experimentation, surprise Page 13 New Strategy Glossary – Fresh Perspective • Value migration: movement of growth and profit opportunities from one industry player to another • Co-evolution: by working with direct competitors, customers, and suppliers, a company can create new businesses, markets, and industries • White-space opportunity: overlooked areas of growth possibilities that don't exactly match existing skills • Strategic intent: corporate goal or destiny that represents a stretch for the organization, a point of view about the competitive position a company hopes to build over the coming decade Page 14 Adidas-Reebok Merger + vs. Page 15 Adidas-Reebok Merger + Employees 26,100 24,600 U.S. Market Share 21.1% 36.3% Global Market Share 25.0% 33.2% Net Income $517.9 mil $1.2 bil Hot Product SmartShoe + Nelly’s shoe line L. Armstrong apparel + iPod Sport Kit Page 16 Strategic Innovation Page 17 Tower-building Competition • Three teams build TinkerToy tower • 90 seconds each attempt • Tallest tower wins – Competing teams may observe/scout, plan, organize, etc. Page 18 High Jump Innovation: Scissor Kick 1929: 6’8” Page 19 High Jump Innovation: Forward Roll 1960: 7’1” Page 20 High Jump Innovation: Fosbury Flop 1968-present: 7’7” to 8’1/2” Page 21 High Jump Innovation 2.75m 2.50m Fosbury Roll 2.25m Scissor 2.00m 1925 1950 1975 2000 2025 Page 22 High Jump Innovation 2.75m The Ferrier Flight 2.50m ? Fosbury Roll 2.25m Scissor 2.00m 1925 1950 1975 2000 2025 Page 23 Innovation and Organic Growth • Emphasis on: – – – – – – – Top-line revenue Customer-centric, customer value Internal and external social interactions Cross-functional and cross-experiential teams Empathetic, high EI people Experimentation, learning Entrepreneurial culture, boldness, audacity • Value-creating strategy vs. Value-enhancing strategy Page 24 Value-creating vs. Value-enhancing Strategy Profit New Product Introduction Profit Plateau Product1 Competition Erodes Profits Product2 Product3 Product4 time Page 25 Apple iPod Page 26 Value-creating vs. Value-enhancing Strategy Profit New Product Introduction Profit Plateau Competition Erodes Value-creating Profits Product1 Product2 Innovation Product3 Product4 time Value-enhancing Innovation Profit Product1 Introduce iPod Windows compatible iPod Mini Product2 iPod Photo WiFi iPod BMW iPod Adaptor Price Cut iPod Wireless Remote iPod Video iPod + Nike Shoe iPod + Timex Watch Page 27 Alliance Network and Innovation Apple’s iPod Innovation Network 10 parts create 85% of the iPod’s cost Samsung (Korea) – Mobile SDRAM memory Toshiba (China) – Hard Drive Toshiba-Matsushita (Japan)Display Module Nike Disney Timex Broadcom (Singapore)Multimedia Processor PortalPlayer (US) Portal Player CPU Apple iPod Inventec (Taiwan)Assembly, Testing Renesas (Japan) Display Driver Digital Music Group Unknown Battery Pack GM Ford Delta Airlines Unknown Mainboard PCB Unknown Back Enclosure 400 additional inputs with values from $2 to fractions of a penny, with an average value of $.05 Source: Portelligent, Inc. and Linden, Kraemer & Dedrick, 2007. Page 28 Alliance Network and Innovation Apple Computuer High Level of VC + VE Apple – alliance network in 1995 Apple – alliance network from 1995-1997 Page 29 Introducing the iPod Commode-dore… Page 30 Innovation (good intentions)……………..……………….flop Page 31 Unique Perspective Page 32 How do you define the coffee industry? Leisure, Enjoyment, Social Interaction Coffee • Packaged • Convenience coffee • Café/restaurant drinking Caffeine Source Fashion Food & Beverage Item Page 33 How does Starbuck’s define coffee industry? Page 34 Red vs. Blue Oceans Red Ocean Strategy Blue Ocean Strategy Compete in existing market space Create uncontested market space Beat the competition Make the competition irrelevant Exploit existing demand Create and capture new demand Align organization towards strategic choice between low cost or differentiation Align organization towards pursuit of low cost and differentiation Page 35 Strategic Dimension 2 Coffee’s Next Blue Ocean? ? Strategic Dimension 1 Early U.S. Auto Industry Page 37 Blue Oceans and The Auto Industry Company / Product New/Incumbent Industry Char. Ford Model-T New Entrant Unattractive Toyota Corolla Incumbent Unattractive Chrysler Minivan Incumbent Unattractive Toyota Prius Hybrid Incumbent Unattractive Page 38 Blue Oceans and Computer Industry Company/Product New/Incumbent Industry Char. IBM System 360 mainframe New Entrant Attractive Apple PC (Apple II) New Entrant Attractive Apple PC (MacIntosh) Incumbent Unattractive Compaq Portable New Entrant Unattractive Dell Build-to-order/JIT New Entrant Unattractive Page 39 Strategic Map: PC Industry (Pre-MacIntosh) Fast/ High Capacity IBM Apple II Wang Slow/ Low Capacity Low Price High Price Strategic Map: PC Industry (Post-McIntosh; Pre-Dell) User Friendliness • • • • Apple MacIntosh GUI Drop & Drag Mouse WYSIWYG Wang DOS-based Operating System IBM >copy *.doc A:\ Low Margin High Margin Strategic Map: PC Industry (After Dell Enters) Dell High Quality & Dependability Apple H-P Lenovo Low Price Adequate Quality High Price “Regular” Supply Chain Management “Efficient” Supply Chain Management Strategic Dimension 2 Personal Computers …what’s the next big thing? ? Strategic Dimension 1 IBM Mainframe Wearable PC Tablet PC Compaq Laptop Apple II IBM Wearable PC Apple MacIntosh IBM PC Compaq Portable Page 44 Innovation in Shaving Razors Try the razors Compare Evaluate Page 45 Strategic Dimension 2 What’s the next big thing? ? Strategic Dimension 1 Gillette: More is Better…? 12 Blade Page 47 Razors • Design features of razors and shaving performance – Do they make a difference? – Do they create [real or perceived] value? • What are relevant “strategic dimensions” of razor industry? Strategic Dimension 2 – What needs [real or perceived] do these dimensions fulfill? ? Strategic Dimension 1 Page 48 MBA 606 New Restaurant Concepts 9 8 7 Chesterfield's Kaleidoscope Truman's Rhythm Afrique Crosshairs Quarter Pole 5-Alarm Firehouse Commonwealth 6 5 4 3 2 1 0 Theme Food Quality Location Price Point Food vs. Liquor Menu Breadth Page 49 MBA 606 New Restaurant Concepts 9 8 7 Chesterfield's Kaleidoscope Truman's Rhythm Afrique Crosshairs Quarter Pole 5-Alarm Firehouse Commonwealth 6 5 4 3 2 1 0 Theme Food Quality Location Price Point Food vs. Liquor Menu Breadth Page 50 MBA 606 New Restaurant Concepts 9 8 7 Chesterfield's Kaleidoscope Truman's Rhythm Afrique Crosshairs Quarter Pole 5-Alarm Firehouse Commonwealth 6 5 4 3 2 1 t Ar tio us ic M ea Br en u Pa dt h r qu o Li vs . od Fo M Po in t n ic e Lo ca tio Pr Fo od Th em Q ua lit y e 0 Page 51 LG Internet Refrigerator Page 52 Airbus A380 Page 53 Segway Personal Transporter Page 54 Tooth Tunes Page 55 Converging Industry Advantage Entertainment Palmtop Computing Wireless Telephony Page 56 Competitive Interaction Page 57 Competitive Outcomes Hardball? Organizational Characteristics Industry Characteristics Dethronement of the Leader Market Share Wal-Mart Sears JC Penney 1950 1960 1970 1980 1990 2000 Page 59 Dethronement of the Leader Market Share Boeing McDonnellDouglass Airbus 1950 1960 1970 1980 1990 2000 Page 60 Dethronement of the Leader Market Share (U.S.) Nike Reebok Adidas 1980 1990 2005 Page 61 King of the Hill – Fizzy Beverages Market Share Other ? Coke Pepsi 1970 1980 1990 2000 2010 2020 Page 62 Simple Rivalry: Prisoner’s Dilemma What to say to police? Criminal 2 Confess Confess Both Serve 5 Years in Jail Keep Quiet #2 Serves 10 Years in jail #1 Goes Free Criminal 1 Keep Quiet #1 Serves 10 Years in Jail Both Serve 1 Year in Jail #2 Goes Free Page 63 Three Stooges Larry, Moe, and Curley are in a 3-way duel and agree to take turns shooting each other, in that order Accuracy statistics: – Larry hits target 20% of the time – Moe hits target 80% of the time – Curley hits target 100% of the time When the duel starts, what should Larry do? Page 64 Competitive Intelligence A systematic and ethical program for gathering information about competitors and general business trends to further your own company’s goals Page 65 Why CI? Playing the Game Better Play the Game Differently • Focus on existing competitors/strategic position • Leverage value chain strengths • Incrementally improve existing strategies/tactics • New market opportunity • New customers • Develop/leverage new value chain strengths • New strategies/tactics • New “flow” of the game Figuring out what drives behavior • Environment/industry drivers • Organizational drivers • Managerial drivers Page 66 Competitor Intelligence Pyramid s Recommendations z Analysis of Data Sourcesaof Data Page 67 Competitor Intelligence Pyramid Recommendations Analysis of Data Sources of Data • Industry experts/analysts • Industry publications • Trade shows/conferences • Advertisements/PR • University research centers • Financial • Court documents/patents • Suppliers/customers • Newspapers/business wire • Help wanted ads • Reverse engineering labs Page 68 Your Rival’s Competitive Actions September 2006 to February 2007 • Contract with Spike Lee for TV ad • Increase R&D budget by 30% • Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system • License Oracle’s newest technology • Cut prices on older version of product by 33% • Endorsement contract with famous U.S. Olympic athletes • Create multifunctional new product design team Page 69 Competitor Intelligence Pyramid • Value chain analysis • Ratio analysis Recommendations • Benchmarking • Cost analysis • Trend analysis Analysis of Data • Personality profiling • Wargaming or scenario planning • Competitive behavior analysis Sources of Data Page 70 Competitor Intelligence Pyramid Recommendations Analysis of Data • Track Existing Rivals • Anticipate New Rivals • Inform Strategy: – Identify own/competitor’s strengths/weaknesses – Early warning system – Plan of attack/retaliation Sources of Data Page 71 The Cola Wars Page 72 Coke’s Market Share Competitive Action Repertoire The set of competitive actions carried out in a given time period MKT CAP SIG PROD PRICE MKT MKT PROD Repertoire Page 73 Your Rival’s Competitive Actions January-July 2008 • Contract with famous movie director, Spike Lee, for TV ad • Increase R&D budget by 30% • Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system • License Oracle’s newest technology • Cut prices on older version of product by 33% • Endorsement contract with famous U.S. Olympic athletes • Create multifunctional new product design team a b c d e Page 74 Competitive Dynamics Analysis • Observe competitive moves • Organize competitive moves –Action/response pairs –Action repertoires (year-end tallies) –Competitive attacks/sequences • Measurement/Analysis of Characteristics – Action pattern characteristics that improve: • Market share • Stock price • Profitability Page 75 Action-Reaction “Pairs” Action Pair 1 Coca-Cola d Pepsi Action Action Pair 2 Action Pair 3 d a d c a Response Action Pair 4 c e • Profits • Growth time • Mkt. Share Action “Repertoires” c Coca-Cola Pepsi Year-End Tallies c c a a a c d e time • Total Actions • Complexity • Profits • Growth • Mkt. Share Strategy and Adaptive Maneuvering 8 7 6 5 4 3 2 Chess: • Epaulette’s Mate • Sicilian Defense 1 a b c d e f g h Sequence Applications... COMPUTER PROGRAM: Jab...Jab…Uppercut LANGUAGE: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. MUSIC: DNA: CAGTACATAGTACGATACGA BOXING: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run; Competitive Actions Over Time Coke a a Pepsi a b b c d a b b c c c d d e e d c e e a a b Observed Sequence a b c d e c b Observed Sequence Page 80 Coke Strategic Non-Conformity Coke a a Industry Norm a b b c d a b b c c c d d e e d c e e a a b Observed Sequence a b c d e c b Observed Sequence Page 81 Pepsi Strategic Conformity Pepsi a Industry Norm a b a a b c c d b b c d d e c e e a b d e c Observed Sequence a a b c d e c b Observed Sequence Page 82 Coke Strategic Unpredictability Coke in time1 a a Coke in time2 a b a b c b b c d c d c d e e a d a b c Observed Sequence e e d b b c c e a Observed Sequence Page 83 Pepsi Strategic Predictability Pepsi in time1 a a Pepsi in time2 a b a b c c c d b b c d d e e a d a b c Observed Sequence e e a d b c c e b Observed Sequence Page 84 King of the Hill – Fizzy Beverages Market Share Other ? Coke Pepsi 1950 1960 1970 1980 1990 2000 Page 85 “Hardball” Competition • Total Actions –More actions are better • Average Response Time –Faster response time is better • Repertoire Complexity –Complex repertoire is better • Attack [Un-]Predictability –Unpredictability is better Page 86 Group Exercise: Coke vs. Pepsi • Total Actions –Count of total actions • Average Response Time –Avg. number of time units between last competitive move in Coke’s attack and Pepsi’s first competitive response, etc. • Repertoire Complexity –Extent to which entire pattern/repertoire is skewed/simple vs. balanced/complex • Attack [Un-]Predictability –Recognizable repetition or action combinations in the sequence of actions? Page 87 Scoring the Fight Coke Total Actions Pepsi Faster Responses More Complex Repertoire Unpredictable Attacks Who will win? Page 88 Implications for CI: Predict Future Behavior of Rivals Rivals’ prior behavior Drivers of Behavior • Patterns • Management orientation • Tendencies • Decision-making • Type & order of moves • Financial constraints • Proactiveness • Industry characteristics • Reactiveness Page 89 Implications for CI: Monitor Your Own Behavior • Objectively measures of competitive behavior • Safeguard against complacency, predictability, simplicity of your own company • Keep rivals off balance / disruption / guessing • What combinations of moves are effective? …which are ineffective? …smoke signals or bluffs? Page 90 Strategic Management …Questions?