Name ______________________________________ Date __________________ Period ____________
DNA Unit Review Worksheet
1) The primary function of DNA in cells is to
a. serve as a storage form for unused nucleotides
b. occupy space in the nucleus to keep the nucleus from collapsing
c. store information that tells the cells which proteins to make
d. serve as template for making long, spiral carbohydrates
2) The two strands of a DNA molecule are held together by
a. ionic bonds
b. covalent bonds
c. peptide bonds
d. hydrogen bonds
3) According to the base-pairing rules, guanine (G) binds with
a. cytosine (C)
b. adenine (A)
c. thymine (T)
d. guanine (G)
4) During DNA replication, the enzyme DNA polymerase
a. separates the two nucleotide chains in a DNA molecule
b. constructs new nucleotide chains that are complementary to the chains in the original DNA
molecule
c. breaks down the original DNA molecule into individual nucleotides
d. joins two DNA molecules into a single molecule
5) The scientists credited with establishing the structure of DNA are
a. Avery and Chargaff b. Watson and Crick c. Hershey and Chase
d. Mendel and Griffith
6) A section of one DNA strand has the sequence ACCGAGGTT. What is the sequence of an mRNA
transcribed from this section of DNA?
a. ACCGAGGUU
b. ACCGAGGTT
c. TGGCTCCAA
d. UGGCUCCAA
7) What process is shown in the
diagram to the right?
a. replication
b. transcription
c. translation
d. protein synthesis
8) Describe the differences between transcription and translation.
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
9) What would be the nucleotide sequence of the RNA molecule that is transcribed from DNA with a
nucleotide sequence of GCTAATCCG?
___________________________________________
Use the given chart showing
the genetic code and its
corresponding codons and
amino acids to help answer
the questions that follow.
10) The mRNA codon of
CCG codes for what amino
acid?
a. Leucine
b. Proline
c. Arginine
d. Glycine
11) Given the following DNA strand:
TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
c) What is the correct amino acid sequence to the mRNA strand given in part b?
12) Given the following amino acid sequence, fill in the blanks to the corresponding mRNA sequence.
Serine Glutamic Acid
Tryptophan
Histidine Cysteine
Isoleucine
U ____ G G A A ____ ____ ____ C ____ C U G U ____ U A
13) Ok…think you’re good at this…try this one. Fill in the blanks according to the rules of DNA
transcription and translation.
DNA strand
mRNA strand
Amino Acid
Sequence:
____ ____ ____ T A ____ G C A T G C A G C ____ C ____ ____ C ____
C U G A ____ A C G ____ A ____ G ____ ____ ____ A ____ C U ____ U
Leucine Isoleucine ______________ Threonine ____________ Serine ____________