The Pirbright Institute
Culicoides DNA
Barcoding Initiative
Protocols
The Pirbright Institute Culicoides DNA Barcoding
Initiative Protocols
Background
Culicoides biting midges (Diptera: Ceratopogonidae) cause significant biting
nuisance to humans, livestock and equines and are the biological vectors of a range
of internationally important pathogens of both veterinary and medical importance..
The delimitation and evolutionary relationship between Culicoides species, however,
remains at best problematic. Species complexes frequently occur within the genus
and the monophyly of many of the subgeneric groupings remains doubtful, potentially
confounding results obtained from epidemiological and ecological investigations.
Matched morphological and genetic data for Culicoides are an essential taxonomic
resource for Culicoides workers, enabling investigation of the phylogenetic
relationship of species, examination of the validity of morphological species
identifications and, in particular in relation to arbovirus vectors, providing a
mechanism for cross-checking Culicoides DNA sequence data produced from vector
competence experiments, which require the use of destructive RNA extraction
methods. For further details on the current status and future directions of Culicoides
taxonomy including the utility of genetic data and in particular the COI Barcode
region for Culicoides taxonomy see Harrup et al. (2014).
The Pirbright Institute DNA Barcoding Initiative aims to develop and implement
standardised protocols for the high-throughput production of matched morphological
and genetic data for both the UK, and through collaboration, the global Culicoides
fauna. The protocols contained within this document were developed for use within
the India Bluetongue Vector Network (IBVNet). The IBVNet is an Indo-UK
collaborative project jointly funded by the UK Department for International
Development (DFID), the Biotechnology and Biological Sciences Research Council
(BBSRC) and the Scottish Government via the Combating Infectious Diseases of
Livestock for International Development (CIDLID) initiative, investigating BTV
epidemiology in southern India (BBSRC grants BB/H009205/1, BB/H009167/1 and
BB/H009493/1). For further details of the IBVNet project see www.ibvnet.com.
Version 1 of this handbook was also the basis of the practical teaching sessions at
the BBSRC International workshop ‘Reaching a consensus on Culicoides taxonomic
identification in India’ (BBSRC grant BB/K021214/1) in Chennai, India in July 2013.
Protocols covered within this handbook include specimen collection/preservation,
genomic DNA extraction, amplification of the mitochondrial Cytochrome Oxidase I
(COI) Barcode gene region and purification of resulting PCR products. Protocols for
Sanger sequencing reactions have not been included and will depend on the
sequencing platform being utilised. The protocols contained within this handbook
have been designed for the production of matched morphological and genetic data
for Culicoides at a medium to high-throughput, utilising equipment commonly
available within entomological and molecular biology laboratories and readily
available consumables. Where details of suitable consumables and/or equipment
have been suggested, mention of proprietary products does not constitute a
commercial endorsement by the authors or by The Pirbright Institute for their use.
Many of the protocols can be adapted to locally available equipment and/or to
increase throughput, particularly through the use of robotic liquid handling platforms.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 2 of 65
rd
Version 2 (3 July 2014)
Care must be taken, however, to ensure cost-savings do not negatively influence the
quality of resulting data.
Protocols covering the assembly, alignment and phylogenetic analysis of resulting
sequence data are also currently not included in this handbook as numerous
resources are available online, good introductory texts on these topics include Hall
(2004) and Harrison and Landale (2006). Further details and tutorials on DNA
Barcoding are available via the Consortium for Barcode of Life (CBOL)
www.barcodeoflife.org and the Barcode of Life Database (BOLD) website
www.boldsystems.org.
Personnel using the protocols contained within this handbook are responsible for
ensuring that they have read and understood the contents, and the procedure is
followed. The Pirbright Institute accepts no liability for results produced using the
protocols within this handbook, which are provided solely as a guide to aid the
production of high-quality matched morphological and genetic data for Culicoides.
The protocols should be conducted in accordance with the user’s institution’s current
health and safety policy, with due regard to relevant biodiversity legislation relating to
the collection of specimens etc. A brief guide to good molecular laboratory practice is
included in Appendix A together with example forms for data collection in Appendix B
and C. Full details of the metadata standards required to obtain Barcode data status
can be found at:
http://www.barcodeoflife.org/sites/default/files/DWG_data_standards-Final.pdf.
If you would like to be kept informed of future updates to these protocols please send
your contact details to lara.harrup@pirbright.ac.uk to be added to the mailing list.
This protocol handbook may be cited as:
Harrup, L.E. (2014) The Pirbright Institute Culicoides DNA Barcoding Protocols,
Version 2, updated 3rd July 2014, available at www.ibvnet.com
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 3 of 65
rd
Version 2 (3 July 2014)
References
Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan
invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294-299.
Hall, B.G., 2004. Phylogenetic Trees Made Easy: A How-To Manual 2nd ed. Sinauer
Associates, Inc, Sunderland, MA, USA.
Harrison, C.J., Landale, J.A., 2006. A step by step guide to phylogeny reconstruction.
The Plant Journal 45, 561-572.
Harrup, L., Bellis, G.A., Balenghien, T., Garros, C., 2014. Culicoides Latreille
(Diptera: Ceratopogonidae) taxonomy: Current challenges and future directions.
Infect. Genet. Evol. in press.
Table of Contents
TPI:ENT:MET-01 Collection of Culicoides using Light-Suction Traps _____________________ 6
TPI:ENT:MET-02 Identification and Storage of Adult Culicoides _______________________ 14
TPI:ENT:MET-03 Sub-Sampling Adult Culicoides Collections _________________________ 18
TPI:ENT:MET-04 Destructive DNA Extraction using Qiagen DNeasy® Spin Columns _______ 21
TPI:ENT:MET-05 Non-Destructive Culicoides DNA Extraction using Novogen Pellet Paint®
Co-Precipitant _____________________________________________________________ 25
TPI:ENT:MET-06 Non-Destructive Culicoides DNA Extraction using Glycogen from Mytilus
edulis (Blue mussel) _________________________________________________________ 29
TPI:ENT:MET-07 PCR Amplification of DNA Barcode Segment from Culicoides DNA
Extractions ________________________________________________________________ 33
TPI:ENT:MET-08 Agrose Gel Electrophoresis using a Horizontal Electrophoresis Tank, TAE
Buffer and SYBR® Safe DNA Gel Stain ___________________________________________ 38
TPI:ENT:MET-09 Agrose Gel Electrophoresis using Pre-Cast High-Throughput E-Gels™ ____ 44
TPI:ENT:MET-10 PCR Product Purification – Using Qiagen MinElute® Spin Columns ______ 47
TPI:ENT:MET-11 Slide Mounting Culicoides Voucher Specimens ______________________ 50
Appendix A
The Pirbright Institute Culicoides DNA Barcoding Initiative Good Laboratory Practice
Guide ________________________________________________________________ 58
Appendix B _______________________________________________________________ 61
TPI:ENT:FOR-1 Specimen Record Form ______________________________________ 61
Appendix B _______________________________________________________________ 64
TPI:ENT:FOR-2 96 Well Plate Record Form ___________________________________ 64
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 4 of 65
rd
Version 2 (3 July 2014)
Workflow
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 5 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-01 Collection of Culicoides using
Light-Suction Traps
This protocol describes a general procedure for the collection of adult Culicoides into
solution using light-suction traps powered by rechargeable sealed lead-acid battery.
Equipment Required
•
•
•
•
•
•
•
•
•
•
•
•
Light-suction insect trap e.g.
o Miniature UV Centre for Disease Control traps (John W. Hock Ltd
www.johnwhock.com or BioQuip www.bioquip.com/)
o Dual power Onderstepoort Veterinary Institute (OVI) traps (ARCOnderstepoort Veterinary Institute, Republic of South Africa
www.arc.agric.za/arc-ovi/Pages/ARC-OVI-Homepage.aspx)
o BioQuip UV LED CDC trap with collection pot and net (model
#2770) (BioQuip www.bioquip.com/)
o Miniature incandescent Centre for Disease Control Traps (John W.
Hock Ltd www.johnwhock.com or BioQuip www.bioquip.com/)
Photoswitch (dependent upon trap type, see light-suction trap manufacturer for
availability e.g. BioQuip 6V Photoswitch for LED trap model #2770) (optional)
Sealed lead-acid rechargeable battery (voltage and Ah rating required
dependent upon light-suction trap type, see manufactures instructions)
Battery charger with auto cut-off
500ml plastic measuring beaker
Small fine mesh plastic sieve
30ml dropper bottle (for dispensing detergent)
Multimeter/volt meter (optional)
Length of narrow rope
Cover for battery to prevent exposure to heavy rain (optional)
Global Positioning System (GPS) unit
Digital camera (optional)
Consumables Required
•
•
•
•
•
•
250ml screw cap sample pots with sample labels
Container seal tape
Liquid detergent (any make of mild domestic washing up liquid or laboratory
detergent, should not contain bleaching agent)
70% ethanol (EtOH)
Water
Unbleached muslin cloth squares (approximately 15cm wide by 15cm long)
(optional)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 6 of 65
rd
Version 2 (3 July 2014)
Method
1. Charge battery as per manufactures instructions.
2. Unpack and assemble light-suction trap as per the manufactures’
instructions.
3. Select trap site for the collection of adult Culicoides. Each trap sites should
have a suitable area from which the trap can be hung out of reach of
livestock etc. and where the battery can be placed so that it is not exposed
to excessive moisture. The light trap should be positioned as follows:
a. Outside i.e. not within a stable or other livestock building (unless
specifically investigating endophilic tendencies in Culicoides (MET-01
Figure 1).
b. With the light platform 1.5-2.0m above ground level (MET-01 Figure
1).
c. At least 50m (or out of sight) of other light-sources, or ideally turn off
any local light sources on the night trapping is to be carried out.
d. In an area where the wires and battery can be placed out-of-reach of
livestock etc.
e. In an area where the battery can be placed in an area not prone to
flooding.
f. If being used, an area where the photoswitch can be positioned so
that the photosensitive resistor (MET-01 Figure 2) is facing outwards
and is not obscured e.g. by vegetation (MET-01 Figure 3a).
4. Following the selection of a trap site geographical coordinates (latitude and
longitude) of the traps location should be taken and recorded using a Global
Positioning System (GPS) unit. In addition it is good practice to, photograph
(i) the trap in situ, (ii) the area surrounding the trap, and (iii) examples of the
breeds of sheep, goats, cattle, buffalo and other potential hosts in close
proximity to the trap site.
5. On the evening collections are due to take place (approximately 2-3 hours
before sunset) hang the light-suction trap in the selected location.
6. Place 200-250ml of clean water (measured using the measuring beaker)
and two drops of detergent using a dropper bottle or equivalent (MET-01
Figure 4a); into the trap collecting pot (MET-01 Figure 4b). Gently swirl the
water to mix the detergent and water. Only one to two drops of detergent are
required, this is sufficient to break the surface tension of the water allowing
collected insects to sink into the solution, excessive detergent (MET-01
Figure 4c) will increase the risk of the collected insects degrading.
7. Carefully, to avoid spilling any solution, fix the collection pot to the mesh net
tube of the light-suction trap as per manufactures’ instructions. If the
collection pot attaches to the trap via a fabric & mesh type tube, screw the
collecting pot in place securely over the solid fabric end of the net so that it
is covered by the fabric (if using a clear pot, this will reduce collected
insect’s exposure to sunlight improving preservation) (MET-01 Figure 5 and
6a). Do not screw the collecting pot in place over the mesh part of the net as
this will increase the likelihood of holes and tears developing in the net
(MET-01 Figure 6b).
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 7 of 65
rd
Version 2 (3 July 2014)
8. Connect the trap’s cables to the external photoswitch cables’ the battery as
per manufactures guidelines, or connect the light-suction trap directly to the
battery (red to red connector-cable, black to black connector-cable). For the
Bioquip #2770 model LED light-suction trap, each end of the external
photoswitch is marked as either ‘trap’ or ‘battery’: connect the cables from
the ends of the photoswitch to either the battery or the trap as marked (MET01 Figure 7). Position the photoswitch so that the photosensitive patch
(MET-01 Figure 2) is not in shade (MET-01 Figure 3a).
9. Check the bulbs and fan motor are working correctly (if using a photoswitch
temporarily cover the light-sensitive patch on the photoswitch with your hand
to activate the fan and light) (MET-01 Figure 3b).
10. Cover the battery with waterproof material if heavy rain is expected.
11. Leave the light-suction trap to run overnight; if used, the photoswitch will
automatically turn the light and fan when the light levels fall below a certain
threshold (see manufactures’ information for further details).
12. The following morning (1-2 hours after sunrise is ideal) recheck that the light
and fan motor are working correctly (if using a photoswitch temporarily
covering the light-sensitive patch on the photoswitch with your hand to
activate the fan and lights (MET-01 Figure 3b).
13. Disconnect the trap, and if being used the external photoswitch, from the
battery.
14. Pour the contents of the collection pot directly into the sieve and fill the
beaker with approximately 500ml clean water using this to gently rinse any
remaining insects from the collecting pot into the sieve.
15. Label a sample pot with the following information about the collection:
a. The date the trap was set in day/month/year format.
b. Indicate whether the trap was functioning correctly i.e. the light and fan
were working when the trap was set and when the sample was
collected.
c. Sufficient detail to describe the traps location e.g. latitude and
longitude or trap location ID if part of for example a surveillance
network.
d. Name or initials of who set the trap
e. If more than one trap type are being utilised details of trap type used.
16. Using the wash bottle containing 70% ethanol (EtOH) and forceps as
required transfer the collected insects from the sieve to the labelled sample
pot.
17. Fill the sample pot with 70% EtOH and screw the lid shut, placing a length of
container seal tape around the lid to prevent leakage (MET-01 Figure 9).
The sample pot should be no more than 2/3 full of insects to ensure there is
sufficient EtOH to preserve the specimens collected. Two or more pots may
be used per collection if needed, in this event ensure each pot is labelled to
indicated how many sample pots the collection is split over e.g. ‘1 of 3’.
18. Store pots containing collected insects in a secure, cool, dark area
(exposure to sunlight will cause wing patterns to fade and potentially DNA to
degrade).
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 8 of 65
rd
Version 2 (3 July 2014)
19. If necessary for the site concerned remove the battery, trap and photoswitch
and store until required. Cover battery terminals with tape during storage to
prevent accidentally short circuiting the battery (MET-01 Figure 10).
20. Recharge the battery (see manufacturer’s instructions): battery voltage may
be checked prior to use with a suitable volt-meter or multi-meter.
MET-01 Figure 1. Example location and correct positioning of a BioQuip LED
trap (model #2270) for a collection site at a livestock farm
MET-01 Figure 2. Photosensitive patch on a photoswitch for a BioQuip 6V LEDsuction traps (model #2770)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 9 of 65
rd
Version 2 (3 July 2014)
MET-01 Figure 3. Example positioning of the BioQuip photoswitch for
automatic operation of #2770 model light trap and checking the operation of
the LEDs and photoswitch (left: photoswitch uncovered, LEDs and fan off
during daylight; right: photoswitch covered, LEDs and fan on)
MET-01 Figure 4. Collection solution a. correct amount of detergent, b.
excessive detergent, c. detergent dropper bottle
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 10 of 65
rd
Version 2 (3 July 2014)
MET-01 Figure 5. How to attach the collecting pot to the light trap
MET-01 Figure 6. Positioning of collection pot and net
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 11 of 65
rd
Version 2 (3 July 2014)
MET-01 Figure 7. Connecting the trap, battery and photoswitch
MET-01 Figure 8. Transferring collected insects from the collection pot
containing detergent solution to a sample pot to be filled with 70% ethanol.
MET-01 Figure 9. Sample pot sealed and labelled for storage and transport
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 12 of 65
rd
Version 2 (3 July 2014)
MET-01 Figure 10. Battery terminals covered for storage
Additional Notes and Troubleshooting
•
•
•
Adult Culicoides may also be collected using a variety of other trap types such
as semiochemical baited miniature Center for Disease Control Traps e.g.
Harrup et al (2012).
Ensure that the sieve mesh is of small enough aperture that the smallest
Culicoides cannot pass through. If you have difficulty finding a suitable sieve a
square of muslin can be placed in the sieve and the contents of the collection
pot poured over the muslin square in the sieve (collected insects will be retained
on the muslin square) (MET-01 Figure 8). Then fill the beaker with
approximately 500ml clean water and use the water to gently rinse any
remaining insects from the collecting pot onto the muslin square and to gently
rinse the insects on the muslin square to remove any residual detergent.
Carefully remove the muslin square from the sieve, folding it around the insects
and place the muslin square with collected insects directly into the sample pot
and fill with EtOH and seal for storage (MET-01 Figure 9).
A variety of other collection media may also be used instead of water with
detergent including 70% EtOH, phosphate buffered saline etc. See the
published literature for further details to ensure the collection media used is
suitable for the required downstream applications.
References
Harrup, L.E., et al (2012) Collection of Culicoides (Diptera: Ceratopogonidae) using
CO2 and enantiomers of 1-octen-3-ol in the United Kingdom. Journal of Medical
Entomology, 49, 112-121].
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 13 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-02 Identification and Storage of Adult
Culicoides
General procedure for separation of adult Culicoides from non-Culicoides and
morphological species identification of adult Culicoides specimens.
Equipment Required
(MET-0 Figure 1)
•
•
•
•
•
•
•
•
•
•
•
•
Binocular Stereo Microscope (approximately 10-40x magnification)
Glass flat bottom petri dish (approximately 8cm diameter)
Storage boxes (must exclude light from samples)
Fine mesh sieve (≤300µm mesh)
Watchmaker No. 3 fine point stainless steel forceps
Wash bottle (250-500ml)
100-1000ml plastic or glass measuring cylinder
250-1000ml plastic or glass bottle
Pencil
Tally counter
Pipette (20-200µl)
Fridge (4°C)
Consumables Required
•
•
•
•
•
•
•
2ml screw cap tubes (or similar)
Small paper slips for inside screw cap tubes
Permanent adhesive circular labels for top of screw cap tubes (e.g. Tough
Spots™)
Disposable pipette tips (20-200µl)
200µl reaction tubes
Sterile water (H2O)
Analytical grade 100% (absolute) ethanol (EtOH)
Method
1. Make stock of 70% EtOH (30ml H20 per 70ml 100% EtOH), aliquot 70%
EtOH into an appropriately labelled wash bottle
2. Record the relevant information from the sample to be identified and create
a sample code, i.e. trap code, collection date and identifier initials.
3. Strain the stored insect sample into a fine sieve (≤300µm mesh) using water
to wash remaining insects from the sample pot and off the muslin square if
used, discarding the muslin square and the 70% EtOH used to store the
sample (MET-02 Figure 2).
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 14 of 65
rd
Version 2 (3 July 2014)
4. Transfer the insects retained in the sieve using forceps to a petri dish.
(Depending on the intended use of the resulting data, if the sample is
visually estimated to contain greater than 1000 Culicoides method
TPI:ENT:MET-03 sub-sampling adult Culicoides collections may be utilised,
and use the fraction of the sample selected by the procedure described in
TPI:ENT:MET-03 for identification purposes. Record whether the sample
has been sub-sampled or not.)
5. Add a small amount of 70% EtOH using a wash bottle to the petri dish
(enough to keep the sample wet but not flooded).
6. Using forceps and a binocular microscope (10-40x magnification) separate
Culicoides from other insects collected, with reference to taxonomic guides
as required.
7. Discard non-Culicoides specimens.
8. With reference to taxonomic guides as required identify the remaining
Culicoides to species or species group/complex level based on morphology.
Using the forceps, tally counter and a binocular microscope count the
number of each species of Culicoides collected. Record the number of each
species collected split by their: sex (male; female) and for female individuals
their state (non-pigmented; pigmented; blood-fed; gravid). If a Culicoides
individual is too damaged to successfully make a species identification,
record these as ‘damaged’.
9. For Culicoides to be identified using molecular techniques using a pipiette
transfer 200µl of 70% EtOH per well of a 96 well PCR plate or 200µl reaction
tube, fill sufficient number of wells for the number of Culicoides specimens
selected. Then transfer individually using forceps each selected Culicoides
to the 96-well PCR plate or 200µl reaction tube containing 70% EtOH (one
Culicoides specimen per well). Record the location of the specimen such
that the specimen collection details can be associated with the
morphological specimen and assign a unique identifier to the specimen
following the DarwinCore triplicate code format of Institution : Group :
Unique Identifier e.g. TPI:ENT:#0000235 (this sample is from Institution=
The Pirbright Institute, Group= Entomology, sample number #0000235).
Seal the plate or tubes with caps and store at +4°C until needed for further
processing in protocols TPI:ENT:MET-04 or TPI:ENT:MET-05. See
Appendix C TPI:ENT:FOR-01 for an example 96 well plate plan.
10. Once all remaining Culicoides are identified and counted, place a paper
label with the sample code written in pencil inside an appropriate size
storage vial (only use pencil, EtOH will cause writing in pen to run). Half fill
the storage vial with 70% EtOH and transfer identified Culicoides to the
storage vial, top the storage vial up with sufficient 70% EtOH to fill the
storage vial. Fill the storage vial no more than 2/3 full with Culicoides to
ensure sufficient EtOH is present to preserve specimens (MET-02 Figure 3).
Using a pencil fill out the same information as on the internal label on a
second small circular adhesive label and secure to the top of the storage vial
(MET-02 Figure 3).
11. Store vials in the nominated storage box (MET-02 Figure 4) and record
where the sample is stored in the nominate lab book.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 15 of 65
rd
Version 2 (3 July 2014)
MET-02 Figure 1. Equipment and consumables required (*stereo microscope,
water and EtOH not shown)
MET-02 Figure 2. Transferring stored insect collections to petri dish for
identification
MET-02 Figure 3. 2ml vials containing identified Culicoides
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 16 of 65
rd
Version 2 (3 July 2014)
MET-02 Figure 4. Storage of identified Culicoides
Additional Notes and Troubleshooting
•
Storage of specimens in 70% ethanol selected for molecular identifications at
temperatures lower than 4°C is generally not needed for the PCR amplification
of DNA. Specimens stored at room temperature have also been successfully
processed with a general rule that specimen up to a year old make good targets
for molecular identification.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 17 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-03 Sub-Sampling Adult Culicoides
Collections
This protocol describes a method for sub-sampling adult Culicoides collections in
order to estimate the number and range of species collected in very large collections,
where the benefit of the additional information gained by identifying the entire catch is
outweighed by the time and effort required to identify the entire catch.
Equipment Required
•
•
•
•
•
•
•
•
•
•
Stainless steel or brass frame test sieve, 200mm diameter, 3.35mm mesh (U.S.
Standard No. 6)
Stainless steel or brass frame test sieve, 200mm diameter, 2.00mm mesh (U.S.
Standard No. 10)
Stainless steel or brass frame test sieve, 200mm diameter, 1.00mm mesh (U.S.
Standard No. 18)
Stainless steel or brass frame test sieve, 200mm diameter, 300µm mesh (U.S.
Standard No. 50)
Watchmaker No.3 fine point stainless steel forceps
Balance (accuracy +/- 0.001g)
2000ml plastic beaker with handle
Flat-bottomed glass petri-dish (approximately 8cm diameter)
Wash bottle (250-500ml)
2x Plastic tray or bowl
Consumables Required
•
•
Disposable weigh boats
Water (H2O)
Method
1. Assemble test sieves in decreasing order of mesh sieve, i.e. the finest mesh
at the bottom (MET-03 Figure 1a).
2. Based on criteria set out in protocol ‘Identification and Storage of Adult
Culicoides’ select trap catch to be sub-sampled.
3. Place the assembled test sieves in a plastic tray or bowl (MET-03 Figure
1a).
4. Pour the trap catch onto the centre of the uppermost test sieve (3.35mm
mesh diameter). Use a small amount of water to rinse any remaining insects
from the sample pot onto the uppermost test sieve. Spread trap catch out
evenly across the surface of the sieve.
5. Pour 2000ml of water evenly over the insects spread out on the surface of
the upper most test sieve (3.55mm mesh diameter), rinsing any insects
smaller than the mesh diameter onto the lower sieve.
6. Remove the uppermost sieve (3.55mm mesh diameter) (MET-03 Figure 1b).
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 18 of 65
rd
Version 2 (3 July 2014)
7. Pour 2000ml of water evenly over the insects spread out on the surface of
the upper most test sieve (2.00mm mesh diameter), rinsing any insects
smaller than the mesh diameter into the lower sieves.
8. Remove the uppermost sieve (2.00mm mesh diameter).
9. Pour 2000ml of water evenly over the insects spread out on the surface of
the upper most test sieve (2.00mm mesh diameter) (MET-03 Figure 1c),
rinsing any insects smaller than the mesh diameter into the lower sieves
(MET-03 Figure 1d).
10. Remove the uppermost sieve (1.00mm mesh diameter) and move the lower
sieve (300µm) from the tray containing water to an empty tray or bowl (MET03 Figure 1e).
11. Discard insects retained in other sieves (3.35mm, 2.00mm and 1.00mm
mesh diameter).
12. Use water from the beaker and/or wash bottle to rinse the insects retained in
the lower sieve (300µm mesh diameter) into a pile for ease of removal
(MET-03 Figure 1f).
13. Select and place a weigh boat on the balance (MET-03 Figure 1h), zero/tare
the balance (MET-03 Figure 1i). Then, using the forceps, transfer the insects
retained in the lower sieve (300µm mesh diameter) to the disposable weigh
boat (MET-03 Figure 1j). Record the weight of the total sieved insect
sample.
14. Transfer 1g of insects from the weigh boat to a flat-bottomed glass petri-dish
(MET-03 Figure 1k).
15. With reference to taxonomic guides and relevant methods, count and
identify all Culicoides specimens in the 1g sub-sample, discard nonCulicoides.
16. Repeat steps 12-13 until at least 650 Culicoides have been counted and
identified. Count the entire 1g sample do not stop at 650. For example if 1g
contained 870 Culicoides only 1g of the sample need be identified. However
if 1g only contained 520 Culicoides a second 1g sample must be identified.
In this example if the second 1g sample contained 340 Culicoides a total of
860 Culicoides will have been identified, higher than the 650 threshold
hence no further 1g sample need be identified.
17. Record the number of grams removed and identified from the total sieved
trap catch.
18. Record the number of each species identified from the sub-sample.
19. Calculate the estimated number of each species in the total sample using
the following formula:
Estimated Total =
Total weight of sieved sample
Number of grams of sample identified
X
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Number of Culicoides
in the sub-sample
identified
Page 19 of 65
rd
Version 2 (3 July 2014)
Figure 18. Sub-sampling procedure
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 20 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-04 Destructive DNA Extraction using
Qiagen DNeasy® Spin Columns
Protocol for the preparation of DNA extractions from Diptera specimens, where a
morphological voucher specimen is not required e.g. PCR positive controls.
Equipment Required
•
•
•
•
•
•
•
•
Pipettes (2-20µl, 20-200µl, 100-1000µl)
Vortex
Centrifuge with rotor capable of holding 1.5ml centrifuge tubes and spin
columns at up to 20,000 x g (e.g. 5430R Eppendorf centrifuge with FA-45-2411-HS High Speed Rotor and FA-45-24-11-Kit Rotor).
Dry heat block (capable of holding 1.5ml centrifuge tubes at 56˚C)
PCR laminar flow hood
Timer
Fridge (+4°C)
Freezer (-20°C)
Consumables Required
•
•
•
•
•
•
•
•
•
Disposable pipette tips containing hydrophobic filters (2-20µl, 20-200µl, 1001000µl)
1.5ml flip-top microcentrifuge tubes (e.g. Eppendorf Safe Lock Tubes: 0030
123.328)
Microcentrifuge tube labels (e.g. Diversified Biotech Direct Thermal Cryo Tags
38x13mm Tag and 9.5mm Spot Combo label: Web Scientific BTCR-6000)
Solvent resistant cryopen
Qiagen DNeasy® Blood and Tissue Kit (Qiagen 50 columns: 69504; 250
columns: 69506), includes:
o Buffer AL
o Buffer AW1
o Buffer AW2
o Buffer AE (10mM Tris-Cl, 0.5mM EDTA; pH 9.0)
o Proteinase K
o DNeasy® mini spin column
o DNeasy® collection tubes
Phosphate buffered saline (PBS) pH 7.2 (50mM potassium phosphate; 150mM
NaCL)
Analytical grade 100% ethanol (EtOH)
Invitrogen DNAZap™ Solutions (AM9890)
Nitrile gloves
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 21 of 65
rd
Version 2 (3 July 2014)
Samples
•
Culicoides specimens
Method
1. Autoclave or purchase sterile/nuclease free: microcentrifuge tubes and
pipette tips.
2. Put on nitrile gloves.
3. Use DNAZap™ solutions to clean all surfaces to be used to reduce/remove
any potential DNA contamination.
4. Discard used gloves and put on a new pair of nitrile gloves and wear
throughout the remainder of the procedure.
5. Add 100% EtOH to Buffers AW1 and AW2 from Qiagen DNeasy® Blood and
Tissue Kit (see bottle labels for volumes required).
6. Fit appropriate rotor into the centrifuge and pre-cool the centrifuge to 21°C.
7. Pre-heat heat block to 56˚C
1. Aliquot 180µl PBS into appropriately double labelled 1.5ml microcentrifuge
tubes.
2. Flame sterilize forceps by dipping forceps in 100% EtOH and igniting on a
propane burner for 1-2 second and transfer selected Culicoides individually
into the microcentrifuge tubes containing PBS. Flame sterilize forceps
between samples to prevent cross-contamination
3. Homogenize the Culicoides individually using an autoclaved disposable
pellet pestle, by rotating the pellet pestle in each microcentrifuge tube for
approximately 30 seconds. Use a new pestle per tube to prevent crosscontamination, discard used pellet pestles.
4. Add 20µl proteinase K to each microcentrifuge tube containing homogenised
Culicoides. Use a new tip per tube to prevent cross-contamination, discard
used tips.
5. Add 200µl Buffer AL (without added ethanol) to each microcentrifuge tube.
Use a new tip per tube to prevent cross-contamination, discard used tips.
6. Immediately seal tubes and vortex briefly.
7. Transfer tubes to dry block heater and incubate tubes at 56°C for 10
minutes.
8. Remove tubes from the dry block heater and transfer to a microcentrifuge
tube rack.
9. Add 200µl 100% EtOH to each tube. Use a new tip per tube to prevent
cross-contamination, discard used tips.
10. Immediately seal tubes and vortex briefly.
11. Arrange labelled DNeasy® spin columns with collection tubes in a
microcentrifuge tube rack.
12. Pipette the mixture including any precipitate from each tube into the
appropriate DNeasy® spin column. Use a new tip per tube to prevent crosscontamination, discard used tips.
13. Centrifuge at ≥6000 x g (~8000rpm) at 21°C for 1min
14. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 22 of 65
rd
Version 2 (3 July 2014)
15. Transfer DNeasy® spin columns to new collection tubes. Discard flowthrough and used collection tubes.
16. Add 500µl Buffer AW1 to each spin column. Use a new tip per tube to
prevent cross-contamination, discard used tips.
17. Centrifuge tubes at ≥6000 x g (~8,000rpm) at 21°C for 1 minute.
18. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
19. Transfer DNeasy® spin columns to new collection tubes. Discard flowthrough and used collection tubes.
20. Add 500µl Buffer AW2 to each spin column. Use a new tip per tube to
prevent cross-contamination, discard used tips.
21. Centrifuge tubes at 20,000 x g (~14,000rpm) at 21°C for 3 minutes.
22. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
23. Transfer DNeasy® spin columns to new appropriately double-labelled fliptop 1.5ml microcentrifuge tubes. Discard flow-through and used collection
tubes. On the sample label include sample id, relevant lab book
name/number or your initials, the date and sample description e.g. ‘DNA
Extraction’.
24. Pipette 100µl of Buffer AE (10mM Tris-Cl, 0.5mM EDTA; pH 9.0) directly on
to the DNeasy® membrane. Use a new tip per tube to prevent crosscontamination, discard used tips.
25. Incubate at room temperature (approximately 21˚C) for 1 minute.
26. Centrifuge tubes at ≥6,000 x g (~8000rpm) at 21°C for 1 minute to elute
DNA.
27. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
28. Repeat elution: Pipette 100µl of Buffer AE (10mM Tris-Cl, 0.5mM EDTA; pH
9.0) directly on to the DNeasy® membrane. Use a new tip per tube to
prevent cross-contamination, discard used tips.
29. Incubate at room temperature (approximately 21˚C) for 1 minute.
30. Centrifuge tubes at ≥6,000 x g (~8000rpm) at 21°C for 1 minute to elute
remaining DNA.
31. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
32. Discard DNeasy® spin column, seal microcentrifuge tubes and store at 4°C
if to be used within 24 hours, otherwise store at -20°C.
33. Use DNAZap™ solutions to clean all surfaces used to reduce/remove any
potential DNA contamination.
34. Remove and discard gloves.
Troubleshooting
•
Homogenates from up to 50mg of arthropod specimen may be applied to the
DNeasy® spin column. From 1 to 20 Culicoides have been tested with this
protocol without problem.
•
A nanodrop spectrophotometer or Life Technologies Qubit® Flurometer may be
used to confirm the DNA yield of the DNA extractions produced using DNeasy®
spin columns.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 23 of 65
rd
Version 2 (3 July 2014)
•
If the DNA yield is too low for downstream applications, for future samples try
either a single elution of 100µl or two elutions of 50µl (total elution volume
should not exceed 200µl).
•
When not in use, once cooled, the mobile propane burner together with any
spare cartridges should be stored in a flammables cabinet.
•
See the Qiagen DNeasy® Blood & Tissue handbook for further information.
•
If DNAZap™ is not available, following appropriate health and safety
assessments, benches may be wiped down with a 10% sodium hypochlorite
solution as an alternative.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 24 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-05 Non-Destructive Culicoides DNA
Extraction using Novogen Pellet Paint®
Co-Precipitant
For the preparation of DNA extractions from Culicoides specimens where a
morphological voucher specimen is required e.g. DNA Barcoding.
Equipment Required
•
•
•
•
•
•
•
•
•
•
•
•
•
Pipettes (20-200µl, 100-1000µl)
Vortex
Thermal cycler with 200µl reaction tube block
Centrifuge with rotor capable of holding 1.5ml centrifuge tubes at up to 14,000 x
g (e.g. 5430R Eppendorf centrifuge with FA-45-24-11-HS High Speed Rotor or
FA-45-24-11-Kit Rotor).
PCR laminar flow hood
1.5ml microcentrifuge tube rack
50ml centrifuge rack
200µl reaction tube rack
Watchmaker number 3 fine point stainless steel forceps
Bench top propane burner and lighter
Timer
Fridge (+4°C)
Freezer (-20°C)
Consumables Required
•
•
•
•
•
•
•
•
•
•
•
•
•
Disposable pipette tips containing hydrophobic filters (0.1-2.0µl, 1-10µl, 20200µl, 100-1000µl)
50ml centrifuge tubes
Plastic or Glass measuring cylinder
250-500ml plastic or glass bottle
200µl thin-wall reaction tubes as individual tubes, 8 or 12 tube strips or as PCR
Plates
1.5ml microcentrifuge tubes (e.g. Eppendorf Safe Lock Tubes: 0030 123.328)
Microcentrifuge tube labels (e.g. Diversified Biotech Direct Thermal Cryo Tags
38x13mm Tag and 9.5mm Spot Combo label: Web Scientific BTCR-6000)
Solvent resistant cryopen
Qiagen DXT tissue digest reagent (Qiagen 950183)
Proteinase K (>600mAU/ml solution) (e.g. Qiagen 19131)
10 mM Tris HCL pH 8.0 (e.g. Qiagen EB Buffer 19086)
3M sodium acetate (NaOAc) pH 5.0 (e.g. Sigma: S7899)
Invitrogen DNAZap™ Solutions (AM9890)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 25 of 65
rd
Version 2 (3 July 2014)
•
•
•
•
Deionized water
Analytical grade 100% ethanol (EtOH)
Nitrile gloves
Novogen Pellet Paint® Co-Precipitant (Novogen 69049)
Samples
•
Culicoides specimens
Method
1. Autoclave or purchase sterile/nuclease free: microcentrifuge tubes, pipette
tips, 200µl reaction tubes, forceps.
2. Put on nitrile gloves.
3. Use DNAZap™ solutions to clean all surfaces to be used to reduce/remove
any potential DNA contamination.
4. Discard gloves, put on a new pair and wear throughout remainder of
procedure.
5. Make a stock solution of 70% EtOH (for 100ml add 30ml deionized water to
70ml analytical grade 100% EtOH), store at room temperature.
6. Aliquot a working stock of analytical grade 100% EtOH in to a glass or
plastic container.
7. Aliquot a small volume of analytical grade 100% EtOH into a 50ml centrifuge
tube for use in flame sterilizing forceps.
8. Make sufficient stock solution of Qiagen DXT tissue digest reagent with 1%
Proteinase K i.e. for 50ml of tissue digest solution add 0.5ml of Qiagen
Proteinase K to 49.5ml Qiagen DXT tissue digest reagent) in a centrifuge
tube or similar and mix well. Label using solvent resistant maker or printed
labels the solution with your initials, the name of solution and the date the
solution was made. Store at +4°C when not in use. This solution is hereafter
referred to as ‘tissue digest solution’. Prior to use bring the tissue digest
solution to room temperature, shake tube to mix, ensuring any precipitate
formed during storage at +4°C has dissolved.
9. Appropriately label 200µl individual reaction tubes, tube strips or PCR plates
so that tubes can be linked to each specimen’s unique identifier code.
10. Aliquot, from the working solution, 200µl of digest solution per 200µl tube.
11. Store remaining stock solution of tissue digest solution at +4°C.
12. Flame sterilize forceps by dipping forceps in 100% EtOH and igniting on a
propane burner for 1-2 seconds. Individually transfer selected Culicoides to
the reaction tube containing the digest solution from the corresponding
reaction tube containing 70% EtOH (retain original tubes containing 70%
EtOH for use in step 14, resealing tubes to prevent evaporation). Flame
sterilize forceps between samples to avoid cross-contamination.
13. Using a thermal cycler or incubator incubate the reaction tubes containing
Culicoides and digest solution for 16 hours at 40°C.
14. Immediately following the 16 hour incubation, using forceps, individually
transfer the Culicoides from the reaction tubes containing digest solution to
their corresponding reaction tube containing EtOH (retained from step 11),
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 26 of 65
rd
Version 2 (3 July 2014)
store tubes at 4˚C until required. Flame sterilise forceps between samples to
prevent cross-contamination.
15. Reseal the reaction tubes containing digest solution, return tubes to the
thermal cycler, and incubate tubes for 15 minutes at 70°C, with a final hold
at 4°C.
16. Pre-cool centrifuge to +4°C.
17. UV sterilise PCR laminar flow hood.
18. Double label sufficient 1.5ml microcentrifuge tubes and arrange in a
microcentrifuge tube rack.
19. Bring Novogen Pellet Paint® Co-Precipitant to room temperature and invert
several times to achieve a uniform suspension (do not vortex).
20. Bring NaOAc to room temperature
21. Add 20µl NaOAc, 400µl 100% EtOH and 2µl Novogen Pellet Paint® CoPrecipitant to each microcentrifuge tube.
22. Transfer each 200µl of the tissue digest solution containing the DNA extract
from the reaction tubes from step 15 to their corresponding microcentrifuge
tube. Use a new tip per tube to prevent cross-contamination, discard used
tips.
23. Close all tubes and briefly vortex.
24. Incubate tubes at room temperature (approximately 21˚C) for 2 minutes.
25. Centrifuge all tubes at 16,000g (~12,000 rpm) for 5 minutes. Position tubes
with the hinge facing outwards in the rotor, an easily identifiable pink
coloured pellet will form on the hinge side of the tube.
26. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
27. Using a pipette carefully remove supernatant without disturbing the pellet.
Use a new tip per tube to prevent cross contamination, discard used tips.
28. Add 500µl 70% EtOH to all tubes. Use a new tip per tube to prevent crosscontamination, discard used tips.
29. Close all tubes and centrifuge at 16,000g (~12,000 rpm) at 4˚C for 5
minutes.
30. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
31. Using a pipette carefully remove supernatant without disturbing the pellet.
32. Add 500µl 100% EtOH to all tubes. Use a new tip per tube to prevent crosscontamination, discard used tips.
33. Close all tubes and centrifuge at 16,000g (~12,000 rpm) at 4˚C for 5
minutes.
34. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
35. Using a pipette carefully remove supernatant without disturbing the pellet.
Use a new tip per tube to prevent cross-contamination, discard used tips.
36. Place the rack of tubes inside the PCR laminar flow hood with the power on
and the door closed (UV light off) and leave the tubes unsealed to air dry
until all traces of EtOH have evaporated (approximately 20-30 minutes).
37. Add 100µl Qiagen EB Buffer (10mM Tris HCL pH 8.0) to each dry
microcentrifuge tube to resuspend pellets. Use a new tip per well to prevent
cross-contamination, discard used tips.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 27 of 65
rd
Version 2 (3 July 2014)
38. Close all tubes and store at 4˚C if to be used within 24 hours otherwise store
at -20˚C.
39. Use DNAZap™ solutions to clean all surfaces used to reduce/remove any
potential DNA contamination.
40. Remove and discard gloves.
Additional Notes and Troubleshooting
•
•
•
•
•
A nanodrop spectrophotometer or a Life Technologies Qubit® Flurometer may
be used to confirm the DNA yield of the DNA extractions produced using this
protocol. However, if Novagen Pellet Paint® Co-Precipitant has been used
during the ethanol precipitation due to the florescence of the dye in Pellet Paint®
an additional absorbance (A) reading at 555nm must be taken and subtracted
from the measured absorbance at 260nm where the difference between these
absorbance’s is the component contributed by the Pellet Paint®, which then
must be subtracted from the total absorbance at 260nm to calculate the nucleic
acid absorbance component of the DNA extraction. See the Novagen Pellet
Paint® Co-Precipitant User Protocol for further information.
If the DNA yield is too low or high, adjust the elution volume as appropriate.
A vacuum aspirator with disposable tips may also be used to aid removal of
supernatant in steps 27, 31 and 35
The use of molecular grade glycogen or Novagen Pellet Paint® Co-Precipitant
(a brightly coloured polymeric carrier molecule) during ethanol precipitation are
used to improve nucleic acid precipitation, improve adhesion of the pellet to the
tube wall and enhance pellet visibility. If neither are available the protocol for
ethanol precipitation using glycogen may be followed without the inclusion of
glycogen, however nucleic acid precipitation may be reduced and in addition an
increased incidence of pellet loss may occur. If neither glycogen nor Novagen
Pellet Paint® Co-Precipitant are available, TPI:ENT:MET-06 may be followed
without adding glycogen and reducing the volume of 100% EtOH used in step
16 from 600µl to 500µl. Novagen Pellet Paint® Co-Precipitant is glycogen
based, but in comparison to using only glycogen the pellet paint protocol
reduces the time required to complete the ethanol precipitation as no extended
centrifugation or refrigeration steps are required.
If DNAZap™ is not available, benches may be wiped down with a 10% sodium
hypochlorite solution as an alternative.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 28 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-06 Non-Destructive Culicoides DNA
Extraction using Glycogen from Mytilus edulis (Blue
mussel)
For the preparation of DNA extractions from Culicoides specimens, where a
morphological voucher specimen is required e.g. DNA Barcoding.
Equipment Required
•
•
•
•
•
•
•
•
•
•
•
•
•
Pipettes (20-200µl, 100-1000µl)
Vortex
Thermal cycler with 200µl reaction tube block
Centrifuge with rotor capable of holding 1.5ml centrifuge tubes at up to 14,000 x
g (e.g. 5430R Eppendorf centrifuge with FA-45-24-11-HS High Speed Rotor or
FA-45-24-11-Kit Rotor).
PCR laminar flow hood
1.5ml microcentrifuge tube rack
50ml centrifuge rack
200µl reaction tube rack
Watchmaker number 3 fine point stainless steel forceps
Bench top propane burner and lighter
Timer
Fridge (+4°C)
Freezer (-20°C)
Consumables Required
•
•
•
•
•
•
•
•
•
•
•
•
•
Disposable pipette tips containing hydrophobic filters (0.1-2.0µl, 1-10µl, 20200µl, 100-1000µl)
50ml centrifuge tubes
Plastic Glass measuring cylinder
250-500ml plastic or glass bottle
200µl thin-wall reaction tubes as individual tubes, 8 or 12 tube strips or as PCR
Plates
1.5ml microcentrifuge tubes (e.g. Eppendorf Safe Lock Tubes: 0030 123.328)
Microcentrifuge tube labels (e.g. Diversified Biotech Direct Thermal Cryo Tags
38x13mm Tag and 9.5mm Spot Combo label: Web Scientific BTCR-6000)
Solvent resistant cryopen
Qiagen DXT tissue digest reagent (Qiagen 950183)
Proteinase K (>600mAU/ml solution) (e.g. Qiagen 19131)
10 mM Tris HCL pH 8.0 (e.g. Qiagen EB Buffer 19086)
3M sodium acetate (NaOAc) pH 5.0 (e.g. Sigma: S7899)
Invitrogen DNAZap™ Solutions (AM9890)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 29 of 65
rd
Version 2 (3 July 2014)
•
•
•
•
Deionized water
Analytical grade 100% ethanol (EtOH)
Nitrile gloves
Glycogen from Mytilus edulis (Blue mussel) aqueous solution 20mg/ml (Roche:
10901393001; Sigma: G1767-1VL)
Samples
•
Culicoides specimens
Method
1. Autoclave or purchase sterile/nuclease free: microcentrifuge tubes, pipette
tips, 200µl reaction tubes, forceps.
2. Put on nitrile gloves.
3. Use DNAZap™ solutions to clean all surfaces to be used to reduce/remove
any potential DNA contamination.
4. Discard used gloves and put on a new pair of nitrile gloves and wear
throughout remainder of procedure.
5. Appropriately label 200µl individual reaction tubes, tube strips or PCR plates
so that tubes can be linked to each specimen’s unique identifier code.
6. Aliquot, from the working solution, 200µl of digest solution per 200µl tube.
7. Store remaining stock solution of tissue digest solution at +4°C.
8. Individually transfer Culicoides to the reaction tube containing the digest
solution from the corresponding reaction tube containing 70% EtOH (retain
original tubes containing 70% EtOH for use in step 10, resealing tubes to
prevent evaporation). Flame sterilize forceps between samples to avoid
cross-contamination i.e. by dipping forceps in 100% EtOH and igniting on a
propane burner for 1-2 seconds.
9. Using a thermal cycler incubate the reaction tubes containing Culicoides and
digest solution for 16 hours at 40°C with a final hold at 4°C.
10. Immediately following the 16 hour incubation, using forceps, individually
transfer the Culicoides from the reaction tubes containing digest solution to
their corresponding reaction tube containing EtOH (retained from step 8),
store tubes at 4˚C until required. Flame sterilise forceps between samples to
prevent cross-contamination i.e. by dipping forceps in 100% EtOH and
igniting on a propane burner for 1-2 second.
11. Reseal the reaction tubes containing digest solution, return tubes to the
thermal cycler, and incubate tubes for 15 minutes at 70°C, with a final hold
at 4°C.
12. Pre-cool centrifuge to +4°C.
13. Bring NaOAc to room temperature
14. Thaw and vortex glycogen.
15. Double label sufficient 1.5ml microcentrifuge tubes and arrange in a
microcentrifuge tube rack.
16. Add 20µl NaOAc, 600µl ice-cold 100% EtOH and 1µl glycogen to each
microcentrifuge tube.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 30 of 65
rd
Version 2 (3 July 2014)
17. Transfer each 200µl DNA extraction from the reaction tubes from step 11 to
their corresponding microcentrifuge tube. Use a new tip per tube to prevent
cross-contamination, discard used tips.
18. Close all microcentrifuge tubes and briefly vortex tubes.
19. Store microcentrifuge tubes at -20°C for at least 1 hour.
20. Centrifuge microcentrifuge tubes at 18,500 x g (~ 13, 0000 rpm) at 4°C for
30 minutes (position all tubes with the hinge facing outwards in the rotor, the
pellet will form on the hinge side of the tube and be easier to identify).
21. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
22. Using a pipette carefully remove supernatant without disturbing the pellet.
Use a new tip per tube to prevent cross-contamination, discard used tips.
23. Add 1ml 70% EtOH to each microcentrifuge tube. Use a new tip per tube to
prevent cross-contamination, discard used tips.
24. Close all microcentrifuge tubes and centrifuge all tubes at 18,500 x g
(~13,000 rpm) at 4°C for 10 minutes (position all tubes with the hinge facing
outwards in the rotor, the pellet will form on the hinge side of the tube and be
easier to identify).
25. Transfer tubes from the centrifuge to a microcentrifuge tube rack.
26. Using a pipette carefully remove supernatant without disturbing the pellet.
Use a new tip per tube to prevent cross contamination, discard used tips.
27. Discard contents of the beaker.
28. UV sterilize PCR laminar flow hood.
29. Place tubes within the PCR laminar flow hood with the power on and the
door shut (UV light off) and leave the tubes unsealed to air dry until all traces
of EtOH have evaporated (approximately 30-60 minutes).
30. Once dry remove tubes from PCR Laminar flow hood
31. UV sterilize PCR laminar flow hood.
32. Add 100µl Qiagen EB Buffer (10 mM Tris HCL pH 8.0) to each dry
microcentrifuge tube to resuspend pellets. Use a new tip per well to prevent
cross-contamination, discard used tips.
33. Close all tubes and store at 4˚C if to be used within 24 hours otherwise store
at -20˚C.
34. Use DNAZap™ solutions to clean all surfaces used to reduce/remove any
potential DNA contamination.
35. Remove and discard gloves.
Additional Notes and Troubleshooting
•
A nanodrop spectrophotometer or Life Technologies Qubit® Flurometer may be
used to confirm the DNA yield of the DNA extractions produced using this
protocol. However, if Novagen Pellet Paint® Co-Precipitant has been used
during the ethanol precipitation due to the florescence of the dye in Pellet Paint®
an additional absorbance (A) reading at 555nm must be taken and subtracted
from the measured absorbance at 260nm where the difference between these
absorbance’s is the component contributed by the Pellet Paint®, which then
must be subtracted from the total absorbance at 260nm to calculate the nucleic
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 31 of 65
rd
Version 2 (3 July 2014)
acid absorbance component of the DNA extraction. See the Novagen Pellet
Paint® Co-Precipitant User Protocol for further information.
•
If the DNA yield is too low or high, adjust the elution volume as appropriate.
•
A vacuum aspirator with disposable tips may also be used to aid the removal of
supernatant in steps 27, 31 and 35
•
Molecular grade glycogen or Novagen Pellet Paint® Co-Precipitant (a brightly
coloured polymeric carrier molecule) during ethanol precipitation are used to
improve nucleic acid precipitation, improve adhesion of the pellet to the tube
wall and enhance pellet visibility. If neither are available the protocol for ethanol
precipitation using glycogen may be followed without the inclusion of glycogen,
however, nucleic acid precipitation may be reduced and an increased incidence
of pellet loss may occur. If neither glycogen nor Novagen Pellet Paint® CoPrecipitant are available TPI:ENT:MET-06 may be followed without adding
glycogen and reducing the volume of 100% EtOH used in step 16 from 600µl to
500µl. Novagen Pellet Paint® Co-Precipitant is glycogen based but in
comparison to using only glycogen the pellet paint protocol reduces the time
required to complete the ethanol precipitation as no extended centrifugation or
refrigeration steps are required.
If DNAZap™ is not available benches may be wiped down with a 10% sodium
hypochlorite solution as an alternative.
•
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 32 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-07 PCR Amplification of DNA Barcode
Segment from Culicoides DNA Extractions
Protocol for the amplification of the ‘DNA Barcode’ segment of the mitochondrially
encoded cytochrome oxidase subunit I (COI) region using Folmer et al. (1994)
primers LCO1490 and HCO2198 from Diptera DNA extractions.
Equipment Required
•
•
•
•
•
•
•
•
•
Pipettes (0.1-2.0µl, 1-10µl, 20-200µl, 100-1000µl, 5-50µl multichannel)
Vortex
200µl reaction tube spinner or centrifuge with plate rotor (e.g. Eppendorf 5430R
Centrifuge with A-2-MTP swing bucket rotor)
200µl reaction tube rack
1.5ml microcentrifuge tube rack
Thermal cycler with 200µl reaction block
PCR Laminar Flow Hood
Fridge (+4°C)
Freezer (-20°C)
Consumables Required
•
•
•
•
•
•
•
•
•
•
•
•
•
Disposable pipette tips containing hydrophobic filters (0.1-2.0µl, 1-10µl, 20200µl, 100-1000µl)
200µl thin-wall reaction tubes as individual tubes, 8 or 12 tube strips or PCR
plates
1.5ml screw cap microcentrifuge tube
1.5ml or 2ml flip-top microcentrifuge tube or 15ml centrifuge tubes
Microcentrifuge tube labels (e.g. Diversified Biotech Direct Thermal Cryo Tags
38x13mm Tag and 9.5mm Spot Combo label: Web Scientific BTCR-6000)
Adhesive PCR film (only required if using PCR plates)
Solvent resistant cryopen
25ml divided reagent reservoirs (e.g. BioPure 25ml reservoir with divider: Web
Scientific REBP-2000) (optional if using PCR plates)
Nuclease Free Water (NFW) (e.g. Qiagen: 129114)
Forward primer LCO1490 (5’-GGTCAACAAATCATAAAGATATTGG-3’) of
Folmer et al. (1994)
Reverse primer HCO2198 (5’-TAAACTTCAGGGTGACCAAAAAATCA-3’) of
Folmer et al. (1994)
Qiagen TopTaq™ Master Mix Kit (Qiagen 200403)
Nitrile Gloves
Samples
• Culicoides DNA Extractions
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 33 of 65
rd
Version 2 (3 July 2014)
Method
1. Autoclave (or purchase sterile/nuclease free): centrifuge tubes, pipette tips,
reaction tubes and UV sterilize PCR laminar flow hood.
2. Put on nitrile gloves and wear throughout.
3. If primers LCO1490 and HCO2198 received dry resuspend:
a. To resuspend dry primers to 100µM add volume of NFW or Qiagen EB
Buffer (10 mM Tris HCL pH 8.0) indicated by supplier to each dry primer
and vortex briefly.
b. Store resuspended primers at 4°C for 20 minutes
c. Make a working stock of 10µM primer by briefly vortexing resuspended
100µM primers, then make a 1/10 dilution in a second double-labelled
screw cap 1.5ml microcentrifuge tube (10µl re-suspended 100µM primer
to 90µl NFW or Qiagen EB Buffer (10 mM Tris HCL pH 8.0)).
4. Store re-suspended 100µM primer at -20°C, store working stock 10 µM
primer at +4°C if to be used immediately or store at -20°C until required.
5. Appropriately label 200µl individual reaction tubes, tube strips or PCR plates
so that tubes can be linked to each specimen’s unique identifier code.
6. Thaw (if required), then briefly vortex 10µM forward (LCO1490) and 10µM
reverse (HCO2198) primers.
7. Briefly vortex DNA extractions (DNA template), TopTaq Mastermix and
CoralLoad Concentrate.
8. In a 1.5ml or 2ml microcentrifuge tube or 15ml centrifuge tube as
appropriate, make sufficient master mix of the following (volume per reaction
x number of reactions required +10% to allow for pipetting error, use of
reagent resevoirs etc.).
Component
Initial
Concentration
Final
Concentration
Nuclease Free Water (NFW)
2x contains TopTaq 1.25 units Top Taq
DNA Polymerase, DNA Polymerase,
PCR Buffer (with
1x PCR Buffer,
Qiagen TopTaq™ Mastermix
3mM MgCl2) and 1.5mM MgCL2 and
400µM each dNTP
200µM of each
dNTP
CoralLoad Concentrate
10x
1x
Forward Primer LCO1490 (5’10µM
0.5µM
GGTCAACAAATCATAAAGATA
TTGG-3’) of (Folmer et al.,
1994)
Reverse Primer HCO2198 (5’10µM
0.5µM
TAAACTTCAGGGTGACCAAAA
AATCA-3’) of (Folmer et al.,
1994)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Volume
Per
Reaction
2.5µl
12.5µl
2.5µl
1.25µl
1.25µl
Page 34 of 65
rd
Version 2 (3 July 2014)
9. Vortex the above master mix and aliquot 20µl into each well.
10. Use a new pipette tip per well to prevent cross-contamination transfer 5µl of
each DNA template into the corresponding labelled 200µl reaction tube and
if individual tubes or tube strips seal securely as each DNA extraction is
added to reduce the possibility of cross-contamination.
11. Using a new pipette tip transfer 5µl of the nominated positive control sample
into the reaction tube labelled positive control and if using individual tubes or
strips seal securely. Use a new pipette tip per well to prevent crosscontamination.
12. Using a new pipette tip transfer 5µl of NFW into the reaction tube labelled
negative control and if using individual tubs or strips of tubes seal securely
13. If using PCR plates seal the plate securely with PCR adhesive film.
14. Vortex tubes or plate briefly.
15. Spin reaction tubes or plate for approximately 5s in the reaction tube spinner
/ centrifuge.
16. Place reaction tubes in the thermal cycler and carry out PCR amplification
using the following thermal profile:
3 minutes
94˚C
Denaturation:
30 seconds
94˚C
Annealing
30 seconds
46˚C
Extension
1 minute
72˚C
10 minutes
72˚C
Initial denaturation
3-step Cycling (35 Cycles)
Final extension
17. When the thermal cycle is finished, remove reaction tubes from the thermal
cycler and store PCR product at 4°C, if not being used within 24 hours, or at
-20˚C otherwise.
18. Confirm successful amplification of the COI gene segment via agrose gel
electrophoresis on a 2% agrose gel using either protocol TPI:ENT:MET-08
or TPI:ENT:MET-09. Successful amplification of the COI segment is
indicated by the presence of a single band at approximately 700bp (MET-07
Figure 1), results are recorded as the presence or absence of the band. No
band should be present in the negative control lane.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 35 of 65
rd
Version 2 (3 July 2014)
MET-07 Figure 1 PCR product visualized on 2% Invitrogen 96-well highthroughput pre-cast E-Gel® stained with SYBR® Safe DNA Stain against
Invitrogen Low Mass Quantitative DNA Ladder run for eight minutes on
program EP
Additional Notes and Troubleshooting
•
Qiagen TopTaq™ Mastermix is stable at room temperature and with storage at
4˚C therefore reaction setup over ice is not required. For further details see the
Qiagen TopTaq PCR Handbook.
•
This protocol may be adapted for use with a variety of other mastermixes and
taqs from other suppliers. Care must be taken, however, when selecting
alternative reagents that cost-savings do not negatively influence the quality of
resulting data. We have noted in general that primers LCO1490 and HCO2198
appear to require a relatively high final concentration (0.5mM) to ensure
consistent amplification. We have found that Qiagen TopTaq™ mastermix
offers a good compromise between, cost-saving, ease of use and efficient and
accurate amplification. As an alternative we also use Invitrogen Platinum® Taq
DNA Polymerase with more difficult templates. D-(+)-Trehalose may also be
added at a final concentration of 5% as a PCR enhancer. The addition of
Trehalose when used with Invitrogen Platinum® Taq DNA Polymerase also
allows mastermixes to be aliquoted out into PCR plates and frozen ready for
use. Ready-made frozen plates of this type should be used within 3 months.
•
Approximate yield may be determined by running the PCR product on an
agrose gel against an appropriate quantitative DNA ladder, or following
purification a nanodrop spectrophotometer may be used to confirm the purified
PCR product’s yield.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 36 of 65
rd
Version 2 (3 July 2014)
•
Approximately 10ng of DNA should be added to each reaction, depending on
the DNA yield of the DNA extractions the volume of DNA template added to
each reaction may need to be increased or decreased as required, (increasing
or decreasing the volume of NFW to insure the total volume including template
is constant at 25µl to maintain the concentration of other reagents in the
mastermix).
•
If after the PCR process the samples have appeared to condense, the caps or
sealing film may not have been attached correctly or the heated lid may not
have been set to be on during the thermal cycle. Correct and repeat as
required.
•
Alternative primer sets are avaliable and have been used to sucessfully amplify
the COI Barcode region from Culicoides specimens, the choice of primer set(s)
will depend on the Culicoides taxa being investigated, see the litrature for
further details.
References
Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan
invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294-299
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 37 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-08 Agrose Gel Electrophoresis using a
Horizontal Electrophoresis Tank, TAE Buffer and
SYBR® Safe DNA Gel Stain
Protocol for the visualization of PCR product for confirmation of amplification
success.
Equipment Required
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Pipettes (0.2-2µl, 2-20µl)
50ml conical flask
100ml measuring cylinder
Microwave
Balance (0.001g accuracy)
Electrophoresis gel tank with power pack
Electrophoresis gel comb
Electrophoresis gel tray
500ml wash bottle
10 litre carboy or 1 litre glass or plastic bottle for 1x TAE solution
Transilluminator (both UV transillumination and blue-light transillumination is
suitable for use with Invitrogen SYBR® Safe DNA Gel Stain)
Amber filter protective viewing glasses (optional if Gel Doc is used)
Image capture device
Heat-proof glove or similar
Fridge (+4°C)
Freezer (-20°C)
Consumables Required
•
•
•
•
•
•
•
•
Sterile disposable pipette tips containing hydrophobic filters (0.2-2µl, 2-20µl)
50x tris-acetate-EDTA (TAE) (2M tris-acetate, 0.05M EDTA, pH 8.3, nuclease
free)
Deionized water
DNA loading dye e.g. Qiagen Gel Pilot Loading Dye 5x (Qiagen 239901) (not
required if PCR product already contains a loading dye e.g. Qiagen CoralLoad
Concentrate)
DNA Ladder (e.g. Invitrogen E-Gel® Low Range Quantitative DNA Ladder
(Invitrogen 12373-031); Invitrogen TrackIt™ 50bp DNA Ladder (Invitrogen
10488058); Qiagen GelPilot 100bp Plus DNA Ladder (Qiagen 239045))
Agarose for electrophoresis
Invitrogen SYBR® Safe DNA Gel Stain (Invitrogen S33102)
Parafilm® or 200µl reaction tubes (not required if PCR product already contains
a loading dye e.g. Qiagen CoralLoad Concentrate)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 38 of 65
rd
Version 2 (3 July 2014)
•
•
•
•
Autoclave tape
Blue roll
Nitrile Gloves
Invitrogen DNAZap™ Solutions (AM9890)
Samples
•
PCR product
Method
1. Put on nitrile gloves
2. Use DNAZap™ solutions to clean all surfaces to be used to reduce/remove
any potential DNA contamination.
3. Discard gloves
4. Put on a new pair of nitrile gloves.
5. Prepare 1x TAE buffer (20ml 50x TAE per 980ml deionized water).
6. Fill a labelled wash bottle with 1x TAE buffer.
7. Fill the gel tank with sufficient 1x TAE to cover gel.
8. Add 3µl SYBR® Safe DNA Gel Stain to the positive end of the gel tank.
9. Cast an appropriate sized and percentage gel (see MET-8 Table 1) by
following the steps below:
a. Prepare casting tray by sealing ends using autoclave tape and fit the gel
comb to the appropriate position in the tray.
b. Measure the required amount of 1x TAE (see MET-8 Table 1) using a
measuring cylinder
c. Add the required amount of agarose (see table below) to a conical flask.
d. Add the measure 1x TAE to the conical flask containing the agrose.
e. Heat the conical flask containing the agrose and 1x TAE in a microwave
oven briefly to dissolve the agarose (beware of boiling agarose it can
easily overflow and burn, use a heat proof glove or similar when handling
the hot conical flask).
f. Allow the conical flask containing the agrose solution to cool (to
approximately 60˚C, approximately so that the conical flask feels warm but
not hot to the touch).
g. Add 3µl SYBR® Safe DNA Gel Stain to the cooled melted agarose
solution and gently swirl solution to mix (avoid making bubbles in the
solution).
h. Gently pour the melted agarose solution into the prepared casting tray
(pop any bubbles in the poured agarose using a pipette tip, discard any
used pipette tips).
i. Allow the gel to set at room temperature for at least 30 minutes or until
adequately set.
j. Wash used conical flasks and measuring cylinders
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 39 of 65
rd
Version 2 (3 July 2014)
MET-08 Agrose gel concentrations
Percentage of Gel
Efficient Range
of Separation of
Linear DNA
molecules (bp)
Volume of
1x TAE
(ml)
Amount
of
Agarose
(g)
0.5
1000-30,000
30
0.15
50
0.25
100
0.50
30
0.21
50
0.35
100
0.70
30
0.30
50
0.50
100
1.00
30
0.36
50
0.60
100
1.20
30
0.45
50
0.75
100
1.50
30
0.60
50
1.00
100
2.00
0.7
1.0
1.2
1.5
2.0
800-12,000
50-10,000
400-7,000
200-3,000
50-2,000
10. If the PCR product does not already include a loading dye (e.g. Qiagen
CoralLoad Concentrate), add an appropriate amount to a subsample of the
PCR product either in separate drops on a sheet of parafilm or in new 200µl
reaction tubes (add 4 volumes Qiagen Gel Pilot Loading Dye 5x to 1 volume
PCR product i.e. for 10µl wells add 8µl Qiagen Gel Pilot Loading Dye 5x to
2µl PCR product).
11. Reseal tubes containing remaining PCR product immediately and store if
required for further applications, at 4˚C if to be used with 24 hours otherwise
store at -20˚C, or discard if no longer required.
12. Remove the autoclave tape from the end of the gel tray and then carefully
remove the comb from the gel itself.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 40 of 65
rd
Version 2 (3 July 2014)
13. Load the gel with ladder and PCR product by either:
a. Placing the gel on a sheet of blue roll and using the wash bottle
dispense a small amount of 1x TAE buffer over the surface of the gel
to fill the wells. Add 8µl of suitably sized DNA ladder with loading dye
in the first and last wells to be used of each row on the gel, between
which load one sample per well (use a new tip for each well to
prevent cross-contamination). Then carefully lower the gel into the
electrophoresis tank with the wells at the black end.
or
b. Lower the gel into the electrophoresis tank with the wells at the black
end and add 8µl suitably sized DNA ladder with loading dye in the
first wells of each row on the gel. Then load one sample per well (use
a new tip for each well to prevent cross-contamination), leaving the
final well on the row empty into which load a 8µl suitably sized DNA
ladder with loading dye.
14. Place the lid on the gel tank and connect all wires required between the
power pack and the gel tank.
15. Run the gel at ~100 volts for 45-60 minutes or as required (monitor the
progress based on the migration distance of the gel tracking dyes in the
loading dye (see example MET-08 Table 2 and MET-08 Table 2)).
MET-08 Table 2. Qiagen GelPilot DNA loading dye migration distance of gel
tracking dyes in TAE buffer:
% Gel
Xylene Cyanol (Light Blue)
0.8
1.0
1.5
2.0
5000bp
3000bp
1800bp
1000bp
Bromophenol
Blue (Dark Blue)
800bp
400bp
250bp
200bp
Orange G
(Orange)
150bp
<100bp
<100bp
<100bp
MET-08 Table 3. Qiagen CoralLoad Concentrate loading dye migration distance
of gel tracking dyes in TAE buffer:
% Gel
0.8
1.0
1.5
2.0
Red Dye
500bp
300bp
250bp
100bp
Orange Dye
~80bp
~40bp
~20bp
<10bp
16. When sufficient time has elapsed, turn off and disconnect the power supply
and carefully remove the gel from the electrophoresis tank.
17. Visualize the gel on UV transilluminator or blue-light transilluminator.
18. Record details of which wells correspond to which samples, the presence
and size of bands present and details of any wells where bands are not
present, cross-referencing to relevant method sheets as required. If a gel
doc with camera is available save a copy of an image of the gel as a jpg or
TIF
19. Dispose of gel according to local waste disposal regulations.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 41 of 65
rd
Version 2 (3 July 2014)
20. Use DNAZap™ solutions to clean all surfaces used to reduce/remove any
potential DNA contamination.
21. Remove and discard gloves
Additional Notes and Troubleshooting
•
•
•
•
•
Ethidium Bromide (10mg/ml) or Biotium GelRed™ (10mg/ml) can be used as an
alternative to Invitrogen SYBR® Safe DNA Gel Stain. UV transillumination is
suitable for use with the following DNA dyes: Invitrogen SYBR® Safe DNA Gel
Stain, Ethidium Bromide and Biotium GelRed™, Blue-light transillumination
suitable for use with Invitrogen SYBR® Safe DNA Gel Stain. Biotium GelRed™
while less mutagenic than Ethidium Bromide is still a DNA-binding material and
so should be regarded as potentially mutagenic, an appropriate risk assessment
must be carried out and appropriate personnel protective equipment required
must be used.
SYBR® Safe DNA gel stain should ideally be stored at 4°C, however, can be
stored at between 2 to 25°C. Undiluted SYBR® Safe in DMSO freezes at low
temperatures; therefore, if frozen the product must be completely thawed and
mixed before using. Repeated freeze-thawing has minimal impact on product
performance.
If step 9g was missed and the SYBR® Safe DNA Stain was not added prior to
the gel setting and being run i.e. up to step 17, the gel may be stained postelectrophoresis. Add 3µl of SYBR® Safe DNA stain to 50ml of 1x TAE (50ml is
sufficient to cover most minigels, adjust volumes as required for larger gels),
place the gel to be stained in a plastic container (do not use a glass container,
as the dye in the staining solution may adsorb to the walls of the container,
resulting in poor gel staining) and gently poor sufficient 1x TAE with SYBR®
Safe DNA Stain into the plastic container such that the gel is fully immersed.
Cover the container with aluminium foil and incubate at room temperature for 30
minutes, placing the container on an orbital shaker at 50rpm to agitate the
solution. After the 30 minutes has elapsed, turn off the shaker and remove the
gel, continuing with the protocol at step 17, no destaining is required.
If the agarose gel is observed to melt during an electrophoretic separation it is a
sign that either the electrophoresis buffer has been omitted in the preparation of
the gel or has become exhausted during the course of the run. For high-voltage
electrophoresis over long time periods, TBE (Tris/Borate/EDTA) buffer should
be used instead of TAE buffer as it has a greater buffering capacity.
If poor resolution of DNA fragments are observed following electrophoresis the
most frequent cause is an inappropriate choice of agarose concentration. Low
percentage agarose gels should be used to resolve high-molecular-weight DNA
fragments and high percentage gels for low-molecular-weight DNA (see Table
of agrose gel concentrations). Fuzzy bands, encountered particularly with small
DNA fragments, result from diffusion of the DNA through the gel, this is
especially true when gels are run for long periods of time at low voltages.
Reassess the choice of gel time, running voltage and time the gel is run for and
repeat as required.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 42 of 65
rd
Version 2 (3 July 2014)
•
Trailing and smearing of DNA bands is most frequently observed with highmolecular-weight DNA fragments, this is often caused by overloading the DNA
sample or running gels at high voltage. DNA samples loaded into torn sample
wells will also cause extensive smearing, as the DNA will tend to run in the
interface between the agarose and the gel support. Do not use torn gels, if
trailing/smearing of band is observed in an untorn gel reassess the volume of
DNA sample added per well and the voltage the gel is run at, and re-run a new
gel as required.
•
If DNAZap™ is not available, following appropriate health and safety
assessments, benches may be wiped down with a 10% sodium hypochlorite
solution as an alternative.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 43 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-09 Agrose Gel Electrophoresis using
Pre-Cast High-Throughput E-Gels™
Procedure for the visualization of PCR product for confirmation of amplification
success, using high-throughput 96 well pre-cast agrose gels.
Equipment Required
•
•
•
•
•
•
Pipettes (2-20µl)
Invitrogen E-Gel® High-Throughput DNA Electrophoresis System E-Base™
Integrated Power System (EBM03)
Transilluminator (UV transillumination is suitable for use with the following DNA
dyes Invitrogen SYBR® Safe DNA Gel Stain and Ethidium Bromide stained EGels, Blue-light transillumination are suitable for use with Invitrogen SYBR®
Safe DNA Gel Stained E-Gels®)
Amber filter protective viewing glasses
Image capture device
Invitrogen E-Editor™ Software
Consumables Required
•
•
•
•
•
•
•
•
Sterile disposable pipette tips preferably containing hydrophobic filters (2-20µl)
Sterile deionized water
DNA loading dye e.g. Qiagen Gel Pilot Loading Dye 5x (239901) (not required if
PCR product already contains a loading dye e.g. Qiagen CoralLoad
Concentrate)
Invitrogen E-Gel® 96 2% with SYBR® Safe (G7208-02) or E-Gel® 48 2% Agrose
Gel (stained with Ethidium Bromide) (G8008-02) or E-Gel® 96 2% Agrose Gel
(stained with Ethidium Bromide) (G7008-02)
Invitrogen E-Gel® Low Range Quantitative DNA Ladder (12373-031)
Parafilm® or 200µl reaction tubes
Nitrile/latex Gloves
Blue roll
Method
1. Put on nitrile gloves.
2. Use DNAZap™ solutions to clean all surfaces to be used to reduce/remove
any potential DNA contamination.
3. Remove gloves and discard.
4. Put on new nitrile gloves.
5. Unseal package and remove the E-Gel®, carefully remove the comb from
the gel and place E-Gel® on the white back of the packet.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 44 of 65
rd
Version 2 (3 July 2014)
6. Load deionized water into E-Gel® as below:
a. For a 48 well E-Gel®: add 5µl of deionized water to each marker lane,
10µl of deionized water to each lane a sample is to be run in and 15µl
deionized water into all remaining lanes.
b. For a 96 Well E-Gel®: add 10µl of deionized water to each marker
lane, 15µl of deionized water to each lane a sample is to be run in and
20µl deionized water into all remaining lanes.
7. If the PCR product does not already include a loading dye e.g. Qiagen
CoralLoad Concentrate, add an appropriate amount of loading dye to a
subsample of the PCR product either in separate drops on a sheet of
parafilm or in new 200µl reaction tubes (e.g. add 4 volumes Qiagen Gel Pilot
Loading Dye 5x to 1 volume PCR product). Reseal tubes containing
remaining PCR product immediately and store at 4˚C until required, if no
longer required for further applications, discard remaining PCR product.
8. Plug in the E-Base™ and set required time and program.
9. Clip the loaded gel into the E-Base™, if the gel is properly inserted the fan in
the E-Base™ will start to run and the red light illuminates.
10. To begin electrophoresis press and release the pwr/prg button on the EBase™, the red light will change to green and the time start counting down.
11. When the gel has finished running the E-Base™ will beep and the green
light will change to a red flashing light.
12. Turn off the E-Base™ and remove the E-Gel®.
13. Visualize the gel on UV Transilluminator or blue-light transilluminator (UV
transillumination is suitable for use Invitrogen E-Gel® 96 with SYBR® Safe).
14. Using a gel documentation system save a copy of an image of the gel as a
jpg or TIF.
15. Align and analyse gel image using E-Editor™ software.
16. Record details of which wells correspond to which samples, the presence
and size of bands present and details of any wells where bands are not
present, cross-referencing to relevant method sheets as required.
17. Use DNAZap™ solutions to clean all surfaces used to reduce/remove any
potential DNA contamination.
18. Dispose of the used E-Gel® according to local waste disposal regulations.
19. Remove gloves and discard.
Additional Notes and Troubleshooting
•
While Invitrogen SYBR® Safe DNA Gel Stain is considered safer/less
mutagenic than either Ethidium Bromide it is still a DNA-binding material and so
should be regarded as potentially mutagenic, and appropriate personnel
protective equipment must be used with reference to the appropriate health and
safety assessments.
•
Each E-Gel® should be loaded within 30 minutes of removing the gel from the
package and run within 15 minutes of loading.
•
Store unused E-Gel® packets at room temperature.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 45 of 65
rd
Version 2 (3 July 2014)
•
If poor resolution of DNA fragments occurs following electrophoresis, the most
frequent cause is an inappropriate choice of agarose concentration or too little
separation between adjacent bands. For example Invitrogen E-Gel® with
SYBR® DNA Stain are suitable for the resolution of 100bp to 2kb fragments.
The detection sensitivity is 1ng per band of DNA.
•
Adjust the run time for the E-Gel® as appropriate for the fragments being used
such that they are well distributed across the run length, but not such that they
overrun into the next well.
•
Trailing and smearing of DNA bands is often a result of overloading the DNA
sample. Do not load more than 100ng of each band per well, adjust the ratio of
sample to deionized water at step 6 to dilute as required and re-run a new gel
as required.
•
See
the
Invitrogen
EGel®
Technical Manual for further
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
information.
Page 46 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-10 PCR Product Purification – Using
Qiagen MinElute® Spin Columns
Procedure for the purification of PCR product prior to sequencing using Qiagen
MinElute® spin columns.
Equipment
•
•
•
•
•
•
Pipettes (1-10µl, 20-200µl, 100-1000µl)
1.5ml microcentrifuge tube rack
Centrifuge capable of holding 1.5ml centrifuge tubes and spin columns at up to
18,500 x g (e.g. 5430R Eppendorf centrifuge with FA-45-24-11-Kit Rotor).
Serological Pipette Filler
Fridge (+4°C)
Freezer (-20°C)
Consumables
•
•
•
•
•
•
•
•
•
•
•
•
Disposable pipette tips containing hydrophobic filters (1-10µl, 20-200µl, 1001000µl)
1.5ml flip-top microcentrifuge tubes
Microcentrifuge tube labels
25ml serological pipette
Solvent resistant cryopen
Nuclease Free Water (NFW) (Qiagen: 129114)
Qiagen MinElute® PCR Purification Kit (50 Columns: 28004; 250 Columns:
28006), contains:
MinElute® spin columns
o 2ml collection tubes
o pH Indicator
o Buffer PB
o Buffer PE
o Buffer EB (10mM Tris HCL pH 8.0)
3M pH 5.0 sodium acetate (NaOAc)
100% analytical grade ethanol (EtOH)
Nitrile Gloves
Invitrogen DNAZap™ Solutions (AM9890)
Samples
•
PCR Product
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 47 of 65
rd
Version 2 (3 July 2014)
Method
1. Autoclave or purchase sterile/nuclease free 1.5ml flip-top microcentrifuge
tubes, pipette tips and serological pipettes.
2. Use DNAZap™ solutions to clean all surfaces to be used to reduce/remove
any potential DNA contamination.
3. Remove gloves and discard.
4. Put on new nitrile gloves.
5. Add 100% EtOH to Qiagen MinElute Buffer PE (see bottle label for volume),
tick box on top of Buffer PE label to indicate EtOH added. Shake bottle to
mix, store at room temperature.
6. Add 1:250 volume pH indicator to Qiagen Buffer PB (120µl pH indicator to
30ml Buffer PB). The yellow colour of Buffer PB with pH indicator I indicates
a pH of ≤7.5. Store at room temperature.
7. Pre-cool centrifuge to 21°C.
8. Aliquot 5 volumes of Buffer PB to 1 volume of PCR product (i.e.100µl per
20µl PCR product). Use a new tip per well to prevent cross-contamination.
Seal tubes and vortex briefly.
9. PCR product/Buffer PB mix should be pale yellow if the solution is orange or
violet add 10µl 3M NaOAc pH 5.0 reseal tubes and vortex briefly (solution
should turn pale yellow). If CoralLoad Concentrate has been used in PCR
mix add 10µl 3M NaOAc pH 5.0 to all tubes.
10. Arrange MinElute® collection tubes in a microcentrifuge tube rack and place
one appropriately labelled MinElute® PCR purification columns per collection
tube.
11. Transfer the PCR product/Buffer PB mix to the corresponding MinElute®
PCR purification column and seal the cap on the spin column. Use a new tip
per tube to prevent cross-contamination.
12. Centrifuge all MinElute® PCR purification columns in their collection tubes at
18,500 x g (~13,000rpm) at 21°C for 1 minute.
13. Discard flow through in each collection tube, returning each column to its
original collection tube to prevent cross-contamination.
14. Aliquot 750µl of Buffer PE to each MinElute® PCR purification column. Use a
new tip per column to prevent cross-contamination. Seal cap on column.
15. Centrifuge all MinElute® PCR purification columns with their collection tubes
at 18,500 x g (~13,000rpm) at 21°C for 1 minute.
16. Discard flow through in each collection tube and return each column to its
original collection tube to prevent cross contamination.
17. Centrifuge all MinElute® PCR purification columns with their collection tubes
at 18,500 x g (~13,000rpm) at 21°C for 1 minute.
18. Place double-labelled 1.5ml microcentrifuge tubes in a microcentrifuge tube
rack.
19. Transfer each MinElute® PCR purification column to the corresponding
microcentrifuge tube, discard Qiagen collection tubes.
20. Add 10µl Buffer EB (10mM tris.CL, pH 8.5) to the centre of each MinElute®
PCR purification column membrane. Use a new tip per column to prevent
cross-contamination.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 48 of 65
rd
Version 2 (3 July 2014)
21. Allow MinElute® PCR purification columns to stand for 1 minute at room
temperature (~21°C).
22. Centrifuge all MinElute® PCR purification columns with their microcentrifuge
tubes at 18,500 x g (~13,000rpm) at 21°C for 1 minute.
23. Discard MinElute® PCR purification columns and seal all microcentrifuge
tubes.
24. Store purified PCR product at 4°C if to be used within 24 hours, otherwise
store at -20°C.
25. Use DNAZap™ solutions to clean all surfaces used to reduce/remove any
potential DNA contamination.
26. Remove and discard gloves.
Additional Notes and Troubleshooting
•
A nanodrop spectrophotometer or Life Technologies Qubit® Flurometer may be
used to confirm the purified PCR product’s yield.
•
See the Qiagen MinElute® PCR Purification handbook for further information or
contact a Qiagen technical representative.
•
There are several other methods are available for PCR product purification, see
manufactures guidelines for further details on their use. Care must, however, be
taken when selecting alternative reagents that cost-savings do not negatively
influence the quality of resulting data. We have found that Qiagen MinElute®
spin columns offer a good compromise between, cost-saving, ease of use and
good quality results. If PCR products are being set for sequencing at a
commercial company, 96-well plate sequencing (rather than sequencing of
samples in individual tubes) purification may also be included in the cost of the
sequencing reaction, check with the sequencing companies’ representatives for
further details.
•
If DNAZap™ is not available, following appropriate health and safety
assessments, benches may be wiped down with a 10% sodium hypochlorite
solution as an alternative.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 49 of 65
rd
Version 2 (3 July 2014)
TPI:ENT:MET-11 Slide Mounting Culicoides Voucher
Specimens
Procedure for slide mounting Culicoides for permanent storage as morphological
voucher specimens.
Equipment
•
•
•
•
•
•
•
•
•
•
•
Stereomicroscope (x10 – 40 magnification)
Timer
Watchmaker No. 3 fine-point stainless steel forceps (e.g. SLS INS4322)
Pipette (20-200µl)
2x microscalpel (e.g. Interfocus Micro Knife Angled 22.5˚ 10316-14)
Angular or straight dissecting needle (optional)
1-2mm outside diameter glass rod between 5-10cm long
Timer
4 Glass and/or plastic 250ml to 500ml bottles
2x Amber glass 250ml to 500ml bottles
Thermal or direct thermal printer for labels (optional)
Consumables
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
76mm x 26mm x 1mm ground edge high-optical clarity microscope slides
5-10mm wide round or square No.1 (13-0.16mm thick) or No. 0 (0.08-0.10mm
thick) glass coverslips (e.g. Agar Scientific L46R7-1)
Slide labels
Solvent resistant fine-point pen
Paper towel
No.1 fine paintbrush
For specimen clearing steps: 200µl reaction tubes or PCR Plate
For specimen ethanol dehydration steps: 200µl reaction tubes, PCR Plate or
ELISA microplates
For specimen clove oil dehydrations steps: 1ml glass bijous or PCR Plate
Euparal mountant (e.g. Agar Scientific R1344A)[~RI=1.48]
Euparal essence (e.g. Agar Scientific R1344B) (optional)
Analytical grade 100% ethanol (EtOH)
Deionized water
Clove oil (e.g. Sigma C8392)
10% w/v or 2M acetic acid solution (e.g. Fisher Scientific J/0549/PB17) (optional
see the ‘Additional Notes and Troubleshooting’ section of this protocol)
10% w/v potassium hydroxide solution (e.g. VWR 35615.K2) (optional see the
‘Additional Notes and Troubleshooting’ section of this protocol)
Propan-2-ol (e.g. VWR 2-Propanol AnalaR NORMAPUR® 20842)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 50 of 65
rd
Version 2 (3 July 2014)
•
•
•
Nitrile Gloves
Microfiber cleaning cloth
Lint-free lens cleaning tissue (e.g. Whatman 2105-841)
Samples
•
Culicoides specimens
Method
1. Make stock solutions of 70%, 80% and 90% EtOH using deionized water in
glass or plastic containers, label appropriately and store at room
temperature. Store in a suitable flammable cabinet when not in use.
2. Make a stock solution of 50:50 clove oil to 100% EtOH in an amber glass
bottle i.e. for 200ml add 100ml clove oil to 100ml 100% EtOH (clove oil
cannot be stored in plastic bottles as it will melt most plastics). Label bottles
appropriately and store at room temperature. Store in a suitable flammables
cabinet when not in use.
3. Aliquot a working stock of 100% clove oil to an amber glass bottle (clove oil
cannot be stored in plastic bottles as it will melt most plastics). Label bottles
appropriately and store at room temperature. Store in a suitable flammables
cabinet, when not in use.
4. Aliquot a working stock of analytical grade 100% EtOH into a glass or plastic
container, label appropriately and store at room temperature. Store in a
suitable flammables cabinet when not in use.
Specimen Clearing
Clear Culicoides specimens in preparation for dehydration then slide mounting
using the procedure below:
5. If specimens have previously been prepared for slide mounting following
DNA extraction using method TPI:ENT:MET-05 or TPI:ENT:MET-6 move to
step 15 if not continue with step 8.
6. Make sufficient stock solution of Qiagen DXT tissue digest reagent with 1%
Proteinase K i.e. for 50ml of tissue digest solution add 0.5ml of Qiagen
Proteinase K to 49.5ml Qiagen DXT tissue digest reagent) in a centrifuge
tube or similar and mix well. Label using solvent resistant marker or printed
labels the solution with your initials, the name of solution and the date the
solution was made. Store at +4°C when not in use. This solution is hereafter
referred to as ‘tissue digest solution’. Prior to use bring the tissue digest
solution to room temperature, gently invert the tube several times to mix,
ensuring any precipitate formed during storage at +4°C has dissolved (do
not vortex the digest solution as this will cause an excess of bubbles).
7. Aliquot 200µl of tissue digest solution into a sufficient number of wells of a
96 well PCR plate or 200µl reaction tubes for the number of specimens
which require preparing for slide mounting i.e. clearing the fat body etc.
Discard used pipette tips.
8. Transfer Culicoides individually using forceps into an appropriately labelled
PCR plate well or 200µl reaction tubes containing tissue digest solution
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 51 of 65
rd
Version 2 (3 July 2014)
(specimens may float at first but will sink into the tissue digest solution
during the later incubation step). Record specimen details or unique
identifiers in lab book or a 96 well plate plan form (see Appendix C
TPI:ENT:FOR-02 for an example).
9. Seal the caps on reaction tubes or seal the PCR plate with caps or adhesive
PCR film or foil (if using adhesive film or foil do not shake or invert the plate
to ensure specimens do not become stuck to the adhesive).
10. Incubate the reaction tubes or PCR plate containing specimens in tissue
digest solution in a thermal cycler or incubator at 40°C for 16 hours.
11. Aliquot 200µl of 70% EtOH into a sufficient number of wells of a 96 well PCR
plate or 200µl reaction tubes for the number of specimens which are being
prepared for slide mounting. Discard used pipette tips.
12. Following incubation transfer the Culicoides individually using forceps to the
reaction tubes or PCR plate wells containing 200µl of 70% EtOH. Discard
used pipette tips and tubes/plate containing used tissue digest solution.
13. If when selected a specimen has been noted as having a particularly dark
integument, transfer the specimen using forceps to a drop of 70% EtOH on a
microscope slide and under a stereomicroscope at between x4-10
magnification, check the specimen to be mounted has been sufficiently
cleared. If insufficient clearing is observed see the section ‘Additional Notes
and Troubleshooting’ section of this protocol, if clearing is sufficient return
sample to the 70% EtOH and continue with step 14.
14. At this stage reaction tubes or PCR plates containing Culicoides in 70%
EtOH can be stored at room temperature or ideally at +4°C for an extended
period of time prior to slide mounting continuing at step 15. Ideally the
remainder of this procedure should be carried out as soon as possible after
the incubation period; however specimens should be stored in 70% EtOH for
at least 1 hour before continuing with the dehydration procedure in step 15.
Specimen Dehydration
Dehydrate Culicoides which have been cleared using the above procedure in
preparation for slide mounting by passing through an ethanol dehydration series
(80%, 90%, 100%) followed by a soak in a 50:50 mix of 100% EtOH and clove oil
and a final soak in 100% clove oil using the procedure below.
15. Aliquot 200µl of 80% EtOH into a sufficient number of wells of an
appropriately labelled 96 well microplate, 96 well PCR plate or 200µl
reaction tubes for the number of specimens which are being prepared for
slide mounting.
16. Transfer Culicoides stored in 70% EtOH from step 12 individually using
forceps into 200µl reaction tubes or wells of a 96 well microplate or 96 well
PCR plate containing 80% EtOH.
17. Seal the caps on reaction tubes or seal the microplate or PCR plate with
caps or adhesive PCR film or foil (if using adhesive film or foil to not shake
or invert the plate to ensure specimens do not become stuck to the
adhesive).
18. Incubate the plate containing Culicoides specimens in 80% EtOH at room
temperature for 60 minutes.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 52 of 65
rd
Version 2 (3 July 2014)
19. Aliquot 200µl of 90% EtOH into a sufficient number of wells of an
appropriately labelled 96 well microplate, 96 well PCR plate or 200µl
reaction tubes for the number of specimens which are being prepared for
slide mounting.
20. Transfer Culicoides stored in 80% EtOH from step 18 individually using
forceps into 200µl reaction tubes or wells of a 96 well microplate or 96 well
PCR plate containing 90% EtOH.
21. Seal the caps on reaction tubes or seal the microplate or PCR plate with
caps or adhesive PCR film or foil (if using adhesive film or foil to not shake
or invert the plate to ensure specimens do not become stuck to the
adhesive).
22. Incubate the plate containing Culicoides specimens in 90% EtOH at room
temperature for 60 minutes.
23. Aliquot 200µl of 100% EtOH into a sufficient number of wells of an
appropriately labelled 96 well microplate, 96 well PCR plate or 200µl
reaction tubes for the number of specimens which are being prepared for
slide mounting.
24. Transfer Culicoides stored in 90% EtOH from step 22 individually using
forceps into 200µl reaction tubes or wells of a 96 well microplate or 96 well
PCR plate containing 100% EtOH.
25. Seal the caps on reaction tubes or seal the microplate or PCR plate with
caps or adhesive PCR film or foil (if using adhesive film or foil to not shake
or invert the plate to ensure specimens do not become stuck to the
adhesive).
26. Incubate the plate containing Culicoides specimens in 100% EtOH at room
temperature for 60 minutes.
27. Aliquot 200µl of a 50:50 mix of 100% EtOH and clove oil into a sufficient
number of wells of an appropriately labelled 96 well PCR plate or glass
bijous for the number of specimens which are being prepared for slide
mounting (microplates and some types of reaction tubes cannot be used
with clove oil as it melts the plastic).
28. Transfer Culicoides stored in 100% EtOH from step 26 individually using
forceps into the wells of a 96 well PCR plate or glass bijous containing the
50:50 mix of 100% EtOH and clove oil.
29. Seal the wells on the PCR plate or glass bijous with caps.
30. Incubate the plate or tubes containing Culicoides specimens in the 50:50
mix of 100% EtOH and clove oil at room temperature for 60 minutes.
31. Aliquot 200µl of clove oil into a sufficient number of wells of an appropriately
labelled 96 well PCR plate or glass bijous for the number of specimens
which are being prepared for slide mounting (microplates and some types of
reaction tubes cannot be used with clove oil as it melts the plastic).
32. Transfer Culicoides stored in the 50:50 mix of 100% EtOH and clove oil from
step 30 individually using forceps into the wells of a 96 well PCR plate or
glass bijous containing the clove oil.
33. Seal the wells on the PCR plate or glass bijous with caps.
34. Incubate the plate or tubes containing Culicoides specimens in clove oil at
room temperature for approximately 3 days.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 53 of 65
rd
Version 2 (3 July 2014)
Slide Mounting
Follow the steps below individually for each Culicoides specimen which has been
cleared and dehydrated using the above procedure in order to create permanent
slide mounts.
35. Label a clean microscope slide with either the specimens unique identifier
e.g. TPI:ENT:#0000036 if part of the Culicoides DNA Barcoding Initiative or
the following information
• Species (if know)
• Sex (Male; Female)
• If female, the status (Non-Pigmented; Pigmented; Bloodfed; Gravid)
• Geographical coordinates of collection site (Latitude; Longitude)
• Type of trap used for specimen collection
• Name and affiliation of identifier
• Type of mounting media used
• Sample ID if used
• Wipe the microscope slide with a microfiber cloth and or lens
cleaning tissue to remove any marks, dust etc.
36. Using the glass rod place four drops of mountant on the microscope slide at
the corners of a square on the central area of the microscope slide.
37. Transfer the Culicoides specimen to be mounted from the clove oil from step
34, briefly touching the individual to a clean paper towel to remove excess
clove oil and place in the lower left drop of mountant on the microscope
slide.
38. In the lower left drop of mountant position the Culicoides specimen dorsal
side up and starting with the left wing using the microscalpel separate the
wing from the thorax and place it with the wing arculus to the right in the
centre of the top half of the bottom right-hand square of mountant. Repeat
for the right wing placing it below the left wing in the bottom half of the
bottom right-hand square of mountant with the wing arculus to the left (see
MET-11 Figure 1).
39. With a micro-scalpel remove the head and place it in the centre of the upper
right-hand square of mountant, with the antennae to the left (see MET-11
Figure 1).
40. Reposition the remainder of the Culicoides ventral side up and using the
microscalpel to separate the abdomen from the thorax and place the
abdomen ventral side up at the centre of the top left square of mountant.
Leave the thorax and legs in the bottom left-hand square of mountant (see
MET-11 Figure 1).
41. In the bottom left-hand square of mountant reposition the remainder of the
Culicoides on its right-hand side and using the micro-scalpel separate the
mesonotum together with the scutellum from the legs and position the
mesonotum dorsal side up at the centre of the bottom left-hand drop of
mountant, together with the legs (see MET-11 Figure 1)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 54 of 65
rd
Version 2 (3 July 2014)
42. Check the mountant has not set too much in any of the four areas, add more
using the glass rod before placing coverslips if required.
43. Using forceps select a cover slip and starting with the upper right-hand drop
of mountant ease the cover slip down from right to left, so that the antennae
flow out and away from the head to ease identification. Without crushing the
specimen, gently press the coverslip to flatten. Minor adjustments to the
position of the specimen under the coverslip can be made by gently tapping
in the appropriate area; the vibrations in the mountant will help the specimen
flow away from the source of the tapping. Repeat for the remaining three
areas of mountant.
44. Reduce the magnification so that all four coverslips can be easily seen and
check there is sufficient mountant to cover to the edges of the coverslip if not
use a glass rod with a very small amount of mountant on the end to carefully
touch the edge of the coverslip, capillary action will pull the mountant under
the coverslip. Excess Euparal mountant can be cleaned from the slide using
a fine paintbrush dipped in 100% EtOH or Euparal Essence.
45. Position the slide horizontally on a slide tray (MET-11 Figure 2a) and place
the slide tray back in its box. Allow slides to dry/set completely before
handling.
46. Ensure the slides are stored in the dark (i.e. the slide tray is kept in its box)
and flat, as the mountant may take several weeks to fully harden. Once slide
are completely dry and hardened, slides may be transferred to slide storage
boxes where they are stored vertically (MET-11 Figure 2b).
47. Following drying of the slides, check that excessive shrinkage of the
mounting media has not occurred, if so top up the mounting media as
described in step 44 and allow to dry again. This step should be repeated
periodically throughout the storage lifetime of the slides.
Additional Notes and Troubleshooting
•
If insufficient clearing of specimens is observed at step 12, individually place the
Culicoides which require further clearing in a drop of ethanol on a microscope
slide and remove the wings and mount as described in steps 35 to 38 with the
exception of placing the Culicoides in a drop of ethanol rather than a drop of the
mountant and only placing one drop of Euparol rather than four in step 36,
cover wings with a cover slip as in step 47. Then transfer the remainder of the
Culicoides (now minus its wings) to a 500µl eppendorf with 200µl 10% KOH
overnight (approximately 16 hours). Label the eppendorf with the appropriate
Sample ID using a solvent resistant pen or solvent resistant printed label.
Following the incubation neutralise the KOH by moving the specimen
individually to a new 500µl eppendorf containing 200µl of 10% acetic acid for 30
minutes. Label the eppendorf with the appropriate sample ID using a solvent
resistant pen or solvent resistant printed label. Repeat for all specimens which
require additional clearing and carry on with mounting as described in steps 36
onwards (taking account that the wings have already been mounted), mounting
the remainder of the Culicoides on the slide which the corresponding wings had
previously been mounted (the wings are removed prior to KOH and acetic acid
treatment to prevent damage to them). Laboratory coat and gloves must be
worn when handling KOH and acetic acid.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 55 of 65
rd
Version 2 (3 July 2014)
•
•
•
•
•
•
•
•
•
•
•
•
•
Significant shrinkage of mounting media may occur during drying and storage.
In moderately thick preparations, this results in shrinkage away from the edges
of the cover slip. It may therefore be necessary to top up the mountant where
required as described step 48.
Remounting of specimens should be avoided wherever possible, however, if
required, Euparal mounted specimens may be removed by soaking in absolute
EtOH or Euparal essence.
When working in a 96 well format the use of microplates rather than PCR plates
for steps 15 to 26 makes it easier to transfer specimens between the ethanol
dilutions due to the wider area and better visibility of the microplate wells in
comparison to a 96-well PCR plate well. Microplates are, however, not
compatible with clove oil or solutions containing clove oil as it melts the plate.
PCR plates have in general been found to be compatible with the use of clove
oil, however, if using a new brand a test run with clove oil over an extended
length of time should be completed to ensure the clove oil does not melt the
plastic. e.g. aliquot 200µl clove oil per well and leave at room temperature for 7
days.
Regularly wipe forceps, microscaples etc. to prevent build-up of mountant while
mounting specimens.
Two labels, one either end of the slide, may be used to allow all the required
information to be included.
Labels with permanent adhesive should be used; if non-laminated paper labels
are used they can be sealed by brushing a fine layer of PVA adhesive over the
label(s) and at the edges of the label(s).
If 5mm, 7mm or 10mm square coverslips are not available, larger coverslips
may be cut using a diamond knife to the required size.
If the glass rods for dispensing mounting media are not available the plunger of
a 1mm syringe can be used.
If digital images of slide mounted specimens will be required be aware of the
field-of-view of the microscope camera to be used, this is often narrower than
that observed by looking through the eye pieces of the same microscope, as
this may affect how the specimen needs to be positioned under the coverslips.
Unlike in many other mounting media types small air bubbles trapped in slide
preparations are absorbed by the Euparal during drying, although this may take
several days.
The Euparal mounting medium is relatively fast-drying even at room
temperature. Placing slides in a drying oven/incubator set at between 35-40°C
or over a specialist slide drying hot plate will increase the speed at which the
mountant hardens. All slides should however ideally always be stored
horizontally for at least the first few months to prevent slippage of any media
which has not fully set. The drying progress can be checked by very lightly
pressing on the centre of the coverslip and watching to see if there is any
movement of the specimen in the medium.
Purchase pre-washed/pre-cleaned microscope slides to limit the dirt, dust etc.
on slides, a microfiber cleaning cloth or propan-2-ol (isopropanol) applied using
a lint-free foam/cotton swabs may also be used to further clean slides as
required.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 56 of 65
rd
Version 2 (3 July 2014)
MET-11 Figure 1 Standardised slide layout and labelling
MET-11 Figure 2 Storage of slide mounted voucher specimens a. flat storage b
vertical storage (only suitable once slides fully dried and hardened)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 57 of 65
rd
Version 2 (3 July 2014)
Appendix A: The Pirbright Institute Culicoides DNA
Barcoding Initiative Good Laboratory Practice Guide
The techniques required for DNA barcoding and species-specific polymerase chain
reaction (PCR) for Culicoides species identification involve the use PCR to amplify
the region of interest. These methods are particularly sensitive and prone to
contamination both between samples in a sample-batch and between samplebatches. Contamination can arise from several different sources, including repeated
isolation of template (genomic) nucleic acids, and previously amplified molecules
(amplicons) with DNA templates typically more prone to contamination than RNA
templates as they are more stable. When arranged in a linear fashion the steps
involved in DNA barcoding and species-specific PCR for Culicoides species
identification can be separated into three major groups, the pre-PCR activities
(sample preparation and PCR preparation), the post-PCR activities (PCR execution
and analysis) and sequencing. Consistently observing a network of protocols focused
on maintaining laboratory areas in a contamination-free condition, is essential for
successful Culicoides species identification via molecular techniques.
The essential parts of a contamination control program should include space and
time separation of pre-PCR, post-PCR and sequencing activities, use of physical aids
to reduce and/or eliminate contamination of work areas, the use of aliquoted
reagents, incorporation of positive and negative i.e. blank PCRs (H2O substituted for
template) controls during PCR amplification.
Personnel protective equipment (PPE) should include long sleeved Howie type labcoats, gloves, and where required eye protection, these items should be used to
protect your samples from contamination carried by yourself and protect yourself
from contact with hazardous reagents e.g. ethidium bromide. Dedicated equipment,
in particular pipettors, should be used for the pre-PCR, post-PCR and sequencing
procedures and not shared between these areas or between laboratories. Sterile,
nuclease free-water should be used for all pre-PCR, post-PCR and sequencing
reactions. Bench areas in PCR laboratories should be wiped daily with DNAZap™ , a
10% sodium hypochlorite solution or equivalent before and after use and, where
available, UV sterilisation of work areas used before and after working in an area.
Steam autoclaving of items at 121˚C for 20 minutes at 15psi is generally sufficient to
destroy DNA contamination and nucleases, but not RNases from most items.
However, times, temperatures and pressures may vary depending on the type of
autoclave used and the type of items to be autoclaved. Further specific
contamination prevention measures are described below.
Reagents
Reagents including PCR mastermixes, primers etc. should be aliquoted in
appropriate volumes for the usage requirement of the assay and to minimise the
number of freeze-thaw cycles. Primers are particularly sensitive to contamination and
aliquots of primers should not be open when DNA extractions, PCR products etc are
being used. New batches of reagents e.g. primers, Taq DNA polymerase etc. need to
be assessed for performance against well-characterized control material. A positive
amplification control should be used for every batch of PCR reactions set-up. The
positive control should normally be an extract that amplifies weakly but consistently
within an acceptable range. Use of a strong positive is an unnecessary risk as it can
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 58 of 65
rd
Version 2 (3 July 2014)
be a possible reservoir of contamination. In addition, a negative or ‘no template’
amplification control, e.g. nuclease free water, should always be included in each
reaction batch to check for potential contamination of the reagent mastermix and
equipment required used to prepare the PCR reactions.
Pre-PCR
Sample and PCR preparation should occur inside a laminar flow hood, preferably
equipped with a UV light. UV radiation is effective for reducing contamination of PCR
process for amplicons >300bp. Manufacture’s instructions regarding the use of UV
decontamination of laminar flow hoods should be followed to prevent exposure of
staff and students to UV radiation. In addition, the walls of the hood should be wiped
with a 10% hypochlorite solution (1 part hypochlorite: 9 parts water, freshly made on
a regular basis) or other suitable solution e.g. DNAZap™ (Invitrogen Life
Technologies) before and after processing samples or preparing PCR reactions. No
handling of PCR products containing the sequence to be amplified should take place
within this area. Specialized barrier or positive-displacement pipettes dedicated for
use during pre-PCR procedures should be used with sterile disposable pipette tips
with hydrophobic filters to prevent the carryover of aerosols created during pipetting
and transfer of contaminants between pre-PCR, post-PCR and sequencing
procedures. Racks dedicated for use in pre-PCR procedures should be used and
regularly autoclaved. Lab coats and gloves should be worn for all steps, and washed
and changed on a regular basis respectively. The steps of the pre-PCR protocol
should be streamlined to minimise manipulation of samples during DNA extraction
and PCR setup.
Post-PCR Area
A dedicated and where possible a physically separate area from pre-PCR area,
should be used for manipulation of post-amplification products including agrose gel
electrophoresis and PCR purification. Specialized barrier or positive-displacement
pipettes dedicated for use during post-PCR procedures should be used with sterile
disposable pipette tips with hydrophobic filters to prevent the carryover of aerosols
created during pipetting. Racks dedicated for use in post-PCR procedures should be
used and regularly autoclaved. Lab coats and gloves should be worn for all steps,
and washed and changed on a regular basis respectively. Nitrile gloves should be
used in preference to latex gloves when handling items containing, or in contact with,
ethidium bromide, as latex may not provide a complete barrier against exposure to
this carcinogen. The steps of the post-PCR protocol should be streamlined to
minimise manipulation of the PCR product. Suitable eye protection should be worn to
prevent exposure to UV radiation during gel visualisation.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 59 of 65
rd
Version 2 (3 July 2014)
Sample Management
The maintenance of an identifiable chain between voucher specimen, DNA
extraction, PCR product and COI sequence is essential for accurate Culicoides
species identification. All samples should be double labelled with their unique
identifying code using either solvent-resistant cryo labels (e.g. ToughTags™ and
ToughSpots™ (Diversified BioTech) or solvent-resistant cryopen. Accurate records of
work undertaken should be made by staff and students in laboratory notebooks on a
daily basis and on all forms required for sample management.
Training
All staff and students using the pre-PCR, post-PCR and sequencing areas should
read, understand and receive appropriate training in all relevant protocols and be
aware of the issue raised above and the specific preventative measures and
understand how they play an important role in the prevention of contamination.
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 60 of 65
rd
Version 2 (3 July 2014)
Appendix B
TPI:ENT:FOR-1 Specimen Record Form
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 61 of 65
rd
Version 2 (3 July 2014)
Plate Number
Lab Book Number
Specimen ID
Plate
Location
Specimen
Number
Collection Information
Collection
Location
Habitat
Collection
Date &
Time
Collector
(Initials)
Specimen Details
Collection
Method
Sex
Identification Details
Parity Life Morphological Identifier
Status Stage
Species
(Initials)
DNA
Extraction
Completed
(Initials)
Identification
Method
Additional Notes (including details of acronyms and initials used)
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
TPI:ENT:FOR-01
rd
Version 2 (3 July 2014)
nd
Plate Number: Date in DD.MM.YYYY format, specimen selectors initials, plate number for the day e.g. 12.08.2013 LEH Plate 2 (2 plate of specimens selected by Lara
th
Harrup plate started 12 August 2013)
Plate Location: Alpha-numeric location on plate, reaction tube strip etc.
Specimen Number: Unique specimen ID assigned to morphological specimen. Using the Darwin Core/Barcode of Life Initiative compliant format of
Institution:Collection:SampleNumber e.g TPI:ENT:#0000140
Collection Location: Details of the location where the specimen was collected, Country, State/Province/County, Region, Site name including Latitude and Longitude if
available. Full details can be given in the additional notes section.
Habitat: Brief description of the habitat from which the specimen was collected
Collection Date and Time: Date specimen was collected in DD.MM.YYYY format and time period when specimen was collected e.g. overnight, 16:00 to 16:30
Collector’s Initials: Initials of the person who collected the specimen
Collection Method: Method by which the specimen was collected e.g. UV CDC trap, sweep net etc. If using a semiochemical lure or animal/human bait with any of the
traps provide details.
Sex: Male (M) or Female (F)
Parity Status: For female specimens only, non-pigmented/nulliparous (NP), blood-fed (BF), pigmented/parous (P) or gravid (G)
Life Stage: Adult (A), Pupa (P), Larvae (L), Egg (E),
Morphological Species: Morphological species suffix with a * if species identification is only an estimate. If the specimen has not been morphologically identified leave
blank or include details of any key morphological features.
Identifier’s Initials: Initials of the person who identified the species
Identification Method: Method used to identify the species including reference to any taxonomy keys used.
DNA Extraction Completed: To be completed with the initials of the person responsible for completing the DNA extraction of the specimen listed, when the extraction
has been carried out
Additional Notes: Details of any acronyms or initials used which are not listed in full below. Any other relevant information regarding the samples.
Institutional Acronyms
Initials
Collection Method Acronyms
UV CDC
John W Hock Miniature Downdraft UV Trap (Model 912)
W CDC
John W Hock CDC Miniature Light Trap with Incandescent Light (Model 512)
UV LED
BioQuip UV LED 390nm CDC Trap (Model 2770 UV)
G LED
BioQuip Green LED 570nm CDC Trap (Model 2770 G570)
UV OVI
Onderstepoort Veterinary Institute Type UV trap
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
TPI:ENT:FOR-01
rd
Version 2 (3 July 2014)
Appendix B
TPI:ENT:FOR-2 96 Well Plate Record Form
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
Page 64 of 65
rd
Version 2 (3 July 2014)
Plate Number
1
Lab Book Number
2
3
4
5
6
7
8
9
10
11
12
A
B
C
D
E
F
G
H
The Pirbright Institute Culicoides DNA Barcoding Initiative Protocols
Dr. Lara E. Harrup, lara.harrup@pirbright.ac.uk
The Pirbright Institute, Ash Road, Pirbright, Woking Surrey, GU24 0NF
TPI:ENT:FOR-01
rd
Version 2 (3 July 2014)