TrueClone
TM
Human Full-Length cDNA Clones
Applicat ion Guide
Table of Contents
Package Contents and Storage Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Other required Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Related Products . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Description of TrueClone™ cDNA clones . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
What is defined as a full-length clone? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
How do I use the cDNA clone? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Production and Quality Assurance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Protocol for Plasmid DNA Recovery and Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Protocol for Primer Re-suspension and DNA Sequencing . . . . . . . . . . . . . . . . . . . . . . . . 6
Trouble-Shooting Guide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
Frequently asked questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
Appendix . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
Physical Maps of pCMV6-XL4, XL5, XL6 and Neo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
Polylinker Sequence of pCMV6-XL4, XL5, XL6 and Neo . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 1
TrueClone Insert . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
Nucleotide Sequences of pCMV6-XL4, XL5, XL6 and Neo . . . . . . . . . . . . . . . . . . . . . . . . . . 12
Package Contents and Storage Conditions
•
•
•
“cDNA clone” as 1 ug (or 10 ug in the case of SC clones) lyophilized plasmid DNA in
a 2-D bar-coded Matrix tube. Store at -20ºC. Once DNA is re-suspended in water,
store at -20ºC. For more information on the use of the bar-coded tubes, please
contact our customer care representatives at 1-888-267-4436, ext 2.
Forward (VP1.5) and reverse (XL39) DNA vector sequencing primers; dried onto
the bottom of screw cap tubes. Store at room temperature. Once DNA is re-suspended in water or TE, store at -20ºC.
Our cDNA TrueClones have had Cresol Red added to the DNA solution prior to
lyophilization. This material does not interfere with PCR amplifications or E. coli
transformations. Our 10 ug SC clones are provided without added Cresol Red.
Other required Reagents
• Competent cells
• LB agar + ampicillin plates
• LB broth (10 g/L Tryptone, 5 g/L Yeast Extract, 10 g/L NaCl. Adjust pH to 7.0 with
•
•
•
•
1 N NaOH and autoclave)
Ampicillin
DNA purification reagents
DNA sequencing reagents (for plasmid preparation confirmation)
Sterile deionized water
Related Products
HuSH™ shRNA Plasmids http://www.origene.com/rna/
Validated Antibodies http://www.origene.com/antibody/
Functional Proteins http://www.origene.com/protein/
Northern Blots http://www.origene.com/geneexpression/rna_blots/
Introduction
Overview
Having a gene sequence is one thing, but having a molecular clone of that gene is
quite something else. Functional genomics begins with having a full-length copy
of the gene of interest. The recent build of the human genome sequence has led
to the suggestion that our genome encodes fewer genes than originally predicted,
possibly only about 33,000 transcripts from 22,000 loci. Analysis of the human genome sequence also confirmed previous suggestions that many human genes have
alternative splicing of their RNA transcripts and that, on average, there are perhaps
1.54 times more transcripts than there are genes. Despite these uncertainties, what
is clear is that all these predictions have to be proven by the cloning of full-length
cDNAs before one can proceed to the functional dissection of each of the genes.
Due to the efforts of many individuals and groups, increasing numbers of putative
‘full-length’ cDNA sequences are being released to the public and are being annotated by the National Center for Biotechnology Information (NCBI), as well as by other
agencies. Currently, there are approximately 26,000 annotated mRNA sequences,
including alternative splicing products of the same gene, in the NCBI RefSeq curated
database. This reference database is a dynamic set in that only 45% have been
reviewed or validated. The remaining entries are subject to change and do indeed
change as more sequence evidence is revealed. It is for this reason that these references should be considered guidelines as opposed to standards.
The DNA vector primers are included in this shipment for use in sequencing the
ends of a TrueClone cDNA insert. Analysis of the end sequences of TrueClone inserts
is the best method to confirm that you have received or have purified the correct
full-length clone. It is best to first use the 5’ primer for this purpose to avoid the
difficulty of sequencing through a poly-A tail with the 3’ primer. Do not use other
common sequencing primers such as T7 or M13rev as they are not always unique in
the OriGene pCMV6 vector system.
Description of TrueClone™ cDNA clones
What is defined as a full-length clone?
Many of the ‘known’ genes have numerous redundant and overlapping sequences
in the public databases. The NCBI RefSeq sequences represent the best effort in
defining the most complete mRNA sequence, with an appropriate or putative open
reading frame and flanking nucleotide sequences of that gene. Each of OriGene’s
‘full-length’ clones has been sequenced at both its 5’ and 3’ ends, and the resulting
sequences are confirmed to align upstream and downstream of the start and stop
codons, respectively. All OriGene Custom Clones are fully sequenced to provide a
non-variant match to the expected reference without frameshifts.
How do I use the cDNA clone?
Plasmid DNA containing an insert of the appropriate cDNA fragment is provided in
a 2-D bar-coded Matrix tube, ready for elution and transformation into a competent
bacterial host. Verified colonies can be cultured to produce unlimited amounts of
plasmid DNA after standard plasmid purifications. The ‘full-length’ cDNA fragment
is present in an expression vector with the open reading frame located downstream
of a CMV promoter capable of driving heterologous gene expression in a variety
of mammalian cell lines in culture and supporting heterologous gene expression in
a variety of tissues in transgenic mice. This feature facilitates the investigation of
gene functions and development of transfected or transgenic cells for drug screens.
However, it has to be pointed out that there are examples in the literature suggesting post-transcriptional and/or translational regulation which may affect gene
expression, uncontrollable by either the strength or the specificity of the transcriptional promoter used. Examples include the effects of the presence of the 5’ or 3’
untranslated regions of the respective mRNA. The expression vector also contains a
prokaryotic transcriptional promoter (appendix), which supports coupled transcription-translation of the cDNA sequence using an appropriate cell-free system. This ap
proach may be used to generate recombinant proteins for testing activities in vitro
and for target identifications. However, we have to be reminded that successful use
of such applications is dependent on a variety of factors, including the length of the
5’ non-coding sequence, the strength of the protein initiation site, and the properties
of the gene product that the cDNA encodes. As well, these cDNA clones may be used
to generate hybridization probes, or antibodies via DNA immunization, and to search
for polymorphisms or alternatively spliced forms.
Production and Quality Assurance
The human full-length “TrueClones™” were isolated directly from human cDNA
libraries. The libraries were constructed using the pCMV6-XL4 vector, the pCMV6XL5 vector or the pCMV6-XL6 vector (see Appendix A), and the cDNA inserts were
cloned uni-directionally between the EcoR I and Sal I sites (see Appendix B). Please
note that the Sal I site was destroyed in the cloning process.
Each ‘full-length’ cDNA TrueClone is assured to represent the specified reference
sequence through strict BLAST requirements showing 5’-end and 3’-end alignments
upstream or downstream of the coding region, respectively. While the internal sequences were not always analyzed, the length of the complete cDNA has been confirmed to be similar to the expected size by its release from the cloning vector using
an appropriate restriction enzyme. OriGene has completed the full ORF sequence of
roughly 5000 popular clones, and also provides fully sequenced clones through our
Custom Clones program.
OriGene’s ‘full-length’ cDNA clones are for research use only and are not intended
for clinical use. As an “investigational tool,” they may differ from the reference
by acceptable single-nucleotide polymorphisms at the published rate of ~0.1%. All
cDNA libraries were generated using reverse transcriptase and without PCR amplification, thus having a low error rate. Even with the assumption that the annotated
sequence in the public database is correct, which is not always the case, it remains
impossible to distinguish between naturally occurring polymorphisms and mutations from unintentional errors that may exist in any molecular clone. It has to be
recognized that, in using these molecular clones, there are some inherent uncertainties and, hence, each should be viewed as a product for discovery. In most cases,
OriGene has a second independently derived clone of the same gene that has been
similarly confirmed for its 5’ and 3’ sequences, as well as for its approximate insert
size.
Vector primers were synthesized and validated by mass spectroscopy. After salt
removal, the oligo-nucleotide concentrations were determined by UV absorbance
and 100 pmol were dried onto the bottom of each tube. Every lot of primer is quality-tested to provide clean end-sequences of OriGene TrueClones devoid of any
(n-1) artifacts. These primers were also designed to not prime with any TrueClone
insert, thus avoiding multiple priming sites. Additional aliquots can be obtained from
OriGene.
Methods
Protocol for Plasmid DNA Recovery and Sequencing
Carefully open the tube, and add 15uL (66 ng DNA/uL) of sterile, deionized H2O
to the bottom or 100 uL (100 ng DNA/ul) in the case of 10 ug quantity stocks (SC
clones). NOTE: Dissolving the DNA in a lower volume is not recommended as an
increased final EDTA concentration may affect some downstream applications.
Close the tube and let sit for 10 minutes at room temperature, or 4ºC overnight.
After vortexing for 10 seconds, quick spin the tube.
Add a portion of the DNA solution to a mixture of competent cells and allow for DNA
transformation according to the manufacturer’s directions. The DNA solution is also
suitable for direct PCR amplification. The plasmid should be visible on an ethidiumbromide stained 1% agarose gel (load at least 5ul).
Note: We recommend using competent cells with a minimum efficiency rating of ≥
1x106 CFU/ug. When one-tenth of the transformation solution (100 ng plasmid DNA
eluant, 50 uL competent cells, and 950 uL SOC) is plated on an appropriate
LB-agar/ampicillin (100 ug/mL) plate, one can obtain between 100 to 1000 colonies.
Please note that due to the inherent nature of some plasmids, special handling may
be required to obtain colonies (see the Trouble-Shooting Guide below).
After the transformed cells have been incubated overnight at 37°C on an LB-agar/
ampicillin (100 ug/mL) plate, several options exist for use of the colonies. Each
colony should contain the desired plasmid, however, the evaluation of 2-5 independent colonies is recommended.
A single colony can be used for PCR amplification.
A single colony can be used to inoculate a growth culture for the creation of a glycerol stock.
A single colony can be used to inoculate a growth culture for DNA purification/
sequencing.
DNA sequencing from the 5’ end of the cDNA inserts should be performed with
Vector Primer 1.5. Its priming site is located approximately 120-bp upstream of the
polylinker. Sequencing of the 3’ end portion of the cDNA inserts should be performed using the XL39 vector primer. The priming site of XL39 is approximately 70
bp downstream of the polylinker sequence. Do not use other common sequencing
primers such as T7 or M13rev as they are not always unique in the OriGene pCMV6
vector system.
Protocol for Primer Re-suspension and DNA Sequencing
Carefully open the tube, and add 10uL of sterile, deionized H2O to the bottom to
obtain a 10uM stock. Alternatively, a low TE solution (10mM Tris (8.0), 0.1mM EDTA) is
advisable for long-term storage at -20°C.
Close the tube and let sit for at least 10 minutes at room temperature (or overnight
at 4°C).
After vortexing for 10 seconds, quick spin the tube to bring the contents to the bottom of the tube.
The primer stock (10uM) is now ready to be added to a DNA sequencing reaction
(1ul=10pmol).
To obtain a high quality sequencing signal, use 1ul of primer in an automated DNA
sequencing reaction containing 100-200ng of OriGene TrueClone plasmid DNA. Be
sure to retain some DNA for transformation into bacterial competent cells. OriGene
used 2ul of Big Dye® v1.1 (Applied Biosystems; Foster City, CA) in a 10ul reaction
volume to end-sequence the TrueClone collection.
The alignment of the end sequences to either the NCBI reference or the TrueClone
end sequence published on the website will confirm that the correct full-length clone
was obtained.
Trouble-Shooting Guide
Should these remedies fail to solve the problem, please call our technical support
specialists at (888) 267-4436 (US only) or (301) 340-3188.
After transformation, there were no colonies to pick.
Cause: The competent cells used in the transformation were of low efficiency. The
amount of DNA provided has been titered to yield a fixed number of colonies using
1x106 cfu/ug cells.
Remedy: Obtain a fresh batch of competent cells and ensure the efficiency rating by
performing a separate transformation reaction using a transformation-qualified control (usually a fixed amount of puc19). In some extreme cases, especially for larger
inserts (>5 kb), higher efficiency cells or electroporation may be required. Should a
gene prove to be toxic to the cells, transforming into strains that reduce the copy
number can help obtain colonies (i.e. ABLE-C or ABLE-K strains; Stratagene, La Jolla,
CA).
Cause: Too little DNA was added to the transformation reaction.
Remedy: Add more DNA (but not more than 10% of the volume of competent cells
used).
The plasmid DNA that I purified does not seem to be correct because the
sequence I obtained does not match the reference sequence.
Cause: The plasmid DNA provided may contain a previously undetected amount of
an unrelated plasmid. The contaminant plasmid must be < 2% of the total DNA, the
minimum detectable amount to be seen in OriGene’s vector-primed sequencing data;
however, this contaminant may exhibit a transformation/growth bias.
Remedy: OriGene strongly suggests that you pick 2-5 colonies for 5’ sequence confirmation before using the clone in an experiment. Bacterial growth for some larger
inserts (>3kb) is slower which results in smaller colonies. Be sure to pick a few different sized colonies whenever possible.
Cause: In some cases, the OriGene clone is longer on either end than the reference.
Some references contain no UTR sequence.
Remedy: Align your sequence with that published in OriGene’s website to make sure
that the correct clone was obtained. OriGene is publishing a genomic alignment
picture for each clone/reference pairing as well.
The restriction map of the clone is incorrect.
Cause: The transcript size published in the literature may be different than OriGene’s
transcript.
Remedy: Compare the insert size obtained with Not 1 to the size provided on the
specification sheet that accompanied the clone. The flanking untranslated regions
(UTR) may vary in length between transcripts. OriGene’s clones are primarily
selected to contain complete open reading frames (ORF).
Cause: There is an internal Not I site(s).
Remedy: Add up the all the band sizes obtained (except the vector ~4.5kb).
Cause: The expected restriction map with the enzymes used does not agree with
what is expected from the published reference because SNPs exist between
transcripts at an average rate of 1 per 1000bp. These can create internal restriction
sites that are unique to the reference or OTI clone.
Remedy: Obtain the DNA sequence of the OTI clone. Using this sequence,
create a new theoretical map.
Frequently asked questions
Why does the OTI clone that I sequenced match the correct gene, but represent
a variant having an alternate exon structure (splice variant)?
OriGene is sequencing the ORFs of thousands of transcripts each year to increase
the value of each clone. Sometimes a different splice variant will be delivered if
the ORF sequence is not yet available, even though the product specifications do
ensure the correct splice variant in most cases (verified by 5’ sequence alignment to
reference, 3’ sequence alignment to reference and insert size verification across the
ORF). Please call technical support to inquire if a replacement is available. OriGene
has multiple full-length cDNA clones for many genes.
Why does the OTI clone that I sequenced match the correct gene, but contain
short nucleotide changes (less than 9bp mismatches occurring < once per 1kb)?
SNPs (single nucleotide polymorphisms) reflect the unique differences from genes
expressed from different individuals. Published references may represent a different
SNP than the OriGene transcript. In addition, the sequence of cloned PCR products
can contain PCR-mediated mutations that are not biologically relevant. The OriGene
clones do not contain such mutations because only cDNA clones from cDNA libraries are provided. Should a specific SNP be required, this too can be contracted to
OriGene.
What is the TrueClone Guarantee?
OriGene warrants that the product will meet specifications listed. At OriGene’s
discretion, free replacement of any non-conforming product will be made if OriGene
is notified within 30 days of product receipt. If you experience any difficulty with any
OriGene product, please contact our Customer Care Team at 888.267.4436.
Does OriGene provide the full-length sequence for my clone?
Yes, if OriGene does not have the sequence for your clone published on the website, then this can be contracted for a nominal fee. Please call 1-888-267-4436 for a
quotation.
Appendix
Physical Maps of pCMV6-XL4, XL5 and XL6
The CMV promoter is covered under U.S. Patents 5,168,062 and 5,385,839 and its
use is permitted for research purposes only. Any other use of the CMV promoter
requires a license from the University of Iowa Research Foundation, 214 Technology
Innovation Center, Iowa City, IA 52242.
f1 ori
f1 ori
CMV promoter
CMV promoter
Amp resistant gene
Amp resistant gene
Sac 1
Sac 1
T7
T7
MCS
MCS
pCMV6-XL4
pCMV6-XL5
Sma I
Sma I
4707 bp
4482 bp
PolyA signal
PolyA signal
SV40 ori
SV40 ori
ColE1
ColE1
T7
f1 ori
f1 ori
CMV promoter
Amp resistant gene
pCMV6-XL6
Sac 1
SP6
MCS
CMV promoter
Amp resistant gene
pCMV6-Neo
Sma I
4483 bp
SV40 ori
Sma I
5838 bp
PolyA signal
ColE1
Sac 1
T7
MCS
PolyA signal
ColE1
SV40 ori
Neor
The pCMV-XL4 vector is 4.7 kb in size, and the pCMV-XL5 and pCMV-XL6 vectors
are 4.5 kb in size. All three vectors contain the same polylinker (Sac 1 to Sma I). The
cDNA library inserts are directionally cloned between the EcoR I and Sal I sites. Note
that the Sal I site is destroyed in the cloning process. The CMV promoter, which can
be used to express the cloned cDNA, is followed by the hGH (human growth hormone) polyA signal located downstream of the insert. The ColE1 ori is the bacterial
origin of replication, the SV40 ori allows for replication in mammalian cells and the
f1 ori is the filamentous phage origin of replication, which allows for the recovery
of single-stranded plasmids. Selection of the plasmid in E. coli is conferred by the
ampicillin resistance gene.
10
T7 RNA polymerase can be used for generating transcripts of the cDNA by in
vitro transcription. Apart from the T7 promoter site located within the polylinker
sequence in the pCMV-XL4 vector, there is a second but opposing T7 site (with a
one-base substitution on the 3’ end) located between ColE1 ori and SV40 ori. Since
a second T7 promoter site is present, the cDNA insert must first be released from
the vector. This may be accomplished by digesting with Sac 1 and Sma I before the in
vitro transcription reaction. The pCMV-XL5 vector does not have a second T7 promoter site, and the pCMV-XL6 vector has an SP6 promoter. Therefore, clones within
the XL5 or XL6 vectors do not require prior excision.
Polylinker Sequence of pCMV6-XL4, XL5, XL6 and Neo
A) pCMV6-XL4, XL5 and Neo
Vector Primer v1.5 >
TTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACG
AAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTATTGGGGCGGGGCAACTGCGTTTACCCGCCATCCGCACATGC
T7 promoter >
Sac 1
(Not for sequencing)
Not I
EcoR I
GTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATT
CACCCTCCAGATATATTCGTCTCGAGCAAATCACTTGGCAGTCTTAAAACATTATGCTGAGTGATATCCCGCCGGCGCTTAA
Xho I/Sal I Xba 1
Not I
Sma I
C- - - -Tr u e C l o n e _ I n s e r t - - - - -T C G A C T C TA G A T T G C G G C C G C G G TC ATA G C TG T T TC C TG A A C ATG TG AT C C C G G G T
G - - - -Tr u e C l o n e _ I n s e r t- - - - -A G C TG A G ATC T A A C G C C G G C G CC AGTATCG AC A A AG G AC T TGTAC AC TA G G G C C C A
GGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAA
CCGTAGGGACACTGGGGAGGGGTCACGGAGAGGACCGGGACCTTCAACGGTGAGGTCACGGGTGGTCGGAACAGGATTATTT
< Vector Primer XL39
B) pCMV6-XL6
Vector Primer v1.5 >
TTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACG
AAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTATTGGGGCGGGGCAACTGCGTTTACCCGCCATCCGCACATGC
Sac 1
SP6 Promoter >
Not I
EcoR I
GTGGGAGGTCTATATAAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATT
CACCCTCCAGATATATTCGTCTCGAGTAAATCCACTGTGATATCTTATGTTCGATGAACAAGAAAAACGTCGCCGGCGCTTAA
Xho I/Sal I Xba 1
Not I
Sma I
C- - - -Tr u e C l o n e _ I n s e r t - - - - -T C G A C T C TA G A T T G C G G C C G C G G TC ATA G C TG T T TC C TG A A C ATG TG AT C C C G G G T
G - - - -Tr u e C l o n e _ I n s e r t- - - - -A G C TG A G ATC T A A C G C C G G C G CC AGTATCG AC A A AG G AC T TGTAC AC TA G G G C C C A
GGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAA
CCGTAGGGACACTGGGGAGGGGTCACGGAGAGGACCGGGACCTTCAACGGTGAGGTCACGGGTGGTCGGAACAGGATTATTT
< Vector Primer XL39
11
TrueClone Insert
Double purified mRNA was primed for reverse transcription with an oligo-dT linker
primer containing an Xho I site. Following the addition of EcoR I adapters, the methylated cDNA was cut with Xho I. Inserts were directionally ligated into the EcoR I and
Sal I sites of either the XL4, XL5, or XL6 vector. Inserts can be re-cut from the plasmid using the flanking Not I sites, but please note that neither the Xho I nor the Sal I
site was reconstituted and therefore cannot be re-cut. The adapter contributes the
underlined sequence between the EcoR I site and the actual cDNA insert (vectorGAATTCGGCACGAGG cDNA Insert). This adapter sequence should not be considered to be part of the original mRNA transcript and therefore should be trimmed.
Nucleotide Sequences of pCMV6-XL4, XL5 and XL6
All sequences are available electronically at the following URLs
1. http://www.origene.com/assets/Documents/NucleotideSequenceofpCMV6-XL4.doc
2. h
ttp://www.origene.com/assets/Documents/NucleotideSequenceofpCMV6-XL5.doc
3. http://www.origene.com/assets/Documents/NucleotideSequenceofpCMV6-XL6.doc
4. h
ttp://www.origene.com/assets/Documents/NucleotideSequenceofpCMV6-Neo.doc
12