Lesson Plan
Day:
Year
​
​
​
​Date:
​
​
​
​Class:
​5th
Length of Class: 80 mins
​Subject: Genetics
Topic: Introduction to Genetics
Introduction: In this lesson pupils will be introduced to the topic of genetics, they will learn
about genes, alleles, heredity and gene expression. They will be introduced to DNA and will
learn about how it is made up.
Previous Knowledge: Pupils should know that children can inheret characteristics from their
parents, but may not know why. Pupils may know that genes carry traits but may not
understand that it is a section of DNA that codes for these particular traits. Pupils should
know that DNA can be used to identify a person and shoujld also know that children should
have the same DNA as their biological parents.
Aim: To introduce the topic of Genetics to a 5th year Biology class and to address any
previous misconceptions they may have on the topic.
Objectives:
•• Pupils should be able to define a species and use a real example of an infertile
offspring to explain this.
•• Pupils should be able to explain the relationship between genes and alleles and
discuss the difference between homozygous and heterozygous cells.
•• Pupils should be able to name the different bases within a double helix of DNA and
should know how to pair the bases.
•• Pupils should be able to draw a DNA double helix and label the diagram.
•• Pupils should be able to identify their miscinceptions on this topic and remedy them
by the use of various activities in class.
Subject Matter:
In this topic pupils will be introduced to definitions such as: Species, heredity, alleles, gene
expression etc. In this lesson each of those definitions will be discussed at a basic level using
real life examples. Pupils will learn if they have certain characteristics and thus discuss if
their parents have the same ability or characteristics. This will help to introduce the topic of
heredity and genes. In this topics pupils will also be introduced to the terms haploid, diploid,
chromosomes etc which will further enhance pupils understanding of heredity and how genes
are passed on from parent to offspring.
Pupils will then be introduced to the concept of DNA and how it is made up. Pupils will learn
about the different components of a DNA double helix and why the pairing of base is
specifically important. Finally pupils will make the distinction between interons and exons
and give an example of where they may be used(DNA profile)
Resources:
• Concept Cartoons
• Miniature Whiteboards
• Powerpoint
• Whiteboard and whiteboard markers
• Worksheets
• Video Clips
• Images of DNA fingerprints
• Traffic Light Diagram
• Jelly Sweets
• Toothpicks
• Video Clips
Classroom Management: Pupils will work on there own when carrying out the worksheets
and this should keep the pupils focused on the task at hand. Pupils will be placed in pairs
when answering the concept cartoons. They will pick the answer together and write it down
on their mini whiteboards.
Safety: Pupils will remain at their desks for the lesson and bags must be kept under the desks
and out of the way.
Assessment:
There will be two forms of assessment in this lesson:
1. Concept Cartoons: Pupils will work in pairs to determine what the correct definition is
2. Worksheet: Pupils will work individually on the worksheet, answering questions and
drawing diagrams to show they understand the topic.
3. Oral questioning during class will help to show if pupils are understanding the
material
4. Pupils will work in pairs building their own dna double helix using jelly sweets and
toothpicks. Each colour will be assigned a letter (A, T, C, G) and with that the
students must pair up the colours to make the right base pairs
Strategies/Resources used to identify Misconceptions:
Concept Cartoons: Concept cartoons are useful in the classroom, as they get pupils thinking
about their understanding of a topic.
“Concept cartoons are cartoon style drawings designed as a stimulus to question; to intrigue;
to provoke discussion; and to generate scientific thinking (Long and Marson, 2003).” (Inel,
2013)
By using characters from popular television programmes, pupils respond well as they relate
to the charaters. Therefore by bringing in aspects of their everyday lives, pupils tend to get
more involved.
“Since problems, in daily life, are central to them, it is thought concept cartoons enhance
inquiries and discussion; and develop scientific thinking (Morris et al., 2007). Concept
cartoons help teachers to grasp their students’ conceptual development provoke the students
to learn; and keep them interested (Huang et al., 2006)” (Inel, D, 2013)
Video Clip: Pupils will watch the clip on the introduction to genetics. They will take note of
certain concepts throughout the video and take note of what was mentioned about each
concept (Heredity, Gene, Allele, Chromosome, Diploid, Haploid, Homo and Heterozygous).
These concepts will be written on the board and each time one is mentioned and explained I
will puase the video and allow the pupils to write down what they learned. After the video I
will ask some students what they learned about. This will help me to determine if the pupils
understand the basic definitions or if further explanation is needed.
Strategies/Resources used to address misconceptions:
Worksheets: Worksheets are useful tools in the classroom, as they give students the ability to
test their understanding of a topic. Worksheets, when created correctly should have clear
instructions for students to follow, so that they can participate in the activity.
“It is referred that worksheets make the students active in learning environment showing the
way of getting the findings in a controlled way by making observation ,forming hypothesis
and doing experiments around the specific topic” (Celikler, D., Aksan, Z., 2012)
Therefore when the students are more active in the learning environment, they will be more
involved in their own learning and figure out if they are understanding and remedying their
misconceptions. Worksheets are great for teachers as they can see by the way students carry
out the activity if they properly understand the topic.
Build a DNA molecule: Pupils will work in pairs to build a DNA double helix using jelly
sweets and toothpicks. The jellies will represent the different bases and the toothpicks will be
the bonds holding the DNA together. This will help to address pupils misconceptions as I will
knw by the way they put the DNA together if they understand how a DNA molecule is made
up.
Time
Pupil Activity
Teacher Activity
References
Set Induction (17m)
5m Pupils will receive a mini
Hand out mini whiteboards. Engage: By using
whiteboard between 2. In pairs Show pupils each concept
games it should
they will look at the concept
cartoon and allow time for stimulate an interest in
cartoons and answer on the
answering
pupils in the lesson.
boards, holding up their answers
The function of a set
for each
induction is “to focus
the student’s attention
on what is to be
learned by gaining
their interest” (Perrott,
12m Pupils will watch the video and Set up video clip. Explain to 1982)
each time one of the terms on the students the different
Explore: Pupils will
board is mentioned, pupils will concepts they must take note use this opportunity to
write down in their notes what
of in the video.These terms become familiar with
they said about this concept in
will be written on the board. the new concepts
the video
mentioned in the video
and what they mean
Development
15m Pupils will explain what they
learned from the video and each
concept that was mentioned. If
pupils are unsure of any of the
terms they can ask the teacher to
explain further
Teacher will ask some pupils
about each of the concepts
and what they learned.
Teacher will further explain
or answer any other
questions pupils may have
on the terms
Teacher will use the
20m Pupils will draw into their notes whiteboard to explain how a
the different components of a
DNA molecule is made up.
DNA molecule
This will be a whole new
topic of learning with not a
lot of previous knowledge.
“Questioning helps
students direct their
learning as they
try to merge their prior
knowledge and new
information in their
attempts to make sense
of these ideas.”
(Almeida, P.A., 2012)
“Various researchers
(e.g. Ellis,
2003 and Gillies,
2003) have highlighted
the cognitive,
metacognitive,
affective, social and
linguistic benefits of
group work for young
learners.” (Wyatt, M,
2010
10m In pairs pupils will build the
DNA molecule based on what
letter the coloured jelly
represents e.g. Red jellies
represent Adenine (A)
Teacher will hand out sweets
and toothpicks to students
and explain that in pairs they
must build a DNA molecule
using the equipment given.
Each colour will be assigned
a letter (A, T, C, G)
Hand out the worksheet and
explain that pupils will do
the worksheet on their own
20m Pupils will carry out a worksheet to test their understanding
based on what they have learned
in class. They will ask the teacher
if they are unsure of anything.
5m
•
The teacher will ask
Conclusion: 5m
different pupils what
Pupils will answer aloud when answers they got for each
asked what answer they have for question
each question.
Explain: Pupils will
use their DNA
molecule to explain
identify and explain
what eaach component
of their DNA molecule
represents“the
students enjoyed class
format and felt that the
games enhanced their
learning” (Grady et al,
2013)
Elaborate: Pupils
used what they learned
throughout the class to
answer questions and
solve problems on the
worksheets.
“Students had an
easier and better
grammar learning
experience in courses
taught with
worksheets” (Ulas et
al, 2012)
Evaluate: Pupils and
teacher will see if they
understood the topic
and if any
misunderstandings
need to be addresses.
References:
• Almeida, P. A., 2012, “Can I ask a question? the importance of classroom
questioning”, Social and Behavioral Sciences 31, 634 – 638
• Celikler, D., Aksan, Z., (2012) ‘The effect of the use of worksheets about aqueous
solution reactions on pre-service elementary science teachers’ academic success’,
Social and Behavioral Sciences 46 ( 2012 ) 4611 – 4614
• Elizabeth Perrott, E. P, 1982, ‘Effective Teaching’, New York, Longman Inc.
• Grady, S. E., Vest, K. M., Todd, T. J., 2013, Student attitudes toward the use of games
to promote learning in the large classroom setting, Currents in Pharmacy Teaching
and Learning 5, 263–268
http://www.youtube.com/watch?v=CBezq1fFUEA
• Inel, D., Balim, A. G., (2013) ‘Concept Cartoons Assisted Problem Based Learning
Method in Science and Technology Teaching and Students’ Views’, Social and
Behavioral Sciences, 93 ( 2013 ) 376 – 380.
• Ulas, A. H., Sevim, O., Tan, E., 2012, The effect of worksheets based upon 5e
learning cycle model on student success in teaching of adjectives as grammatical
components, Social and Behavioral Sciences 31, 391 – 398
• Wyatt, M, 2010, An English teacher’s developing self-efficacy beliefs in using
groupwork, Volume 38, Issue 4, December 2010, Pages 603–613
Misconceptions Associated with this Topic:
Scientific Concept
A gene is a section of DNA that
contains instructions to make
proteins
All organisms have DNA
DNA is made up of nucleotides
that join to form long chains
called polynucleotides
Alleles are different forms of a
gene
A gene is a section of DNA that
contains instructions to make
proteins while an allele is a
different form of a gene
Misconception
Author
Genes are traits.
A gene and the expression of the
gene as a characteristic or trait are
the same thing.
There are some types of organisms
that do not have DNA. Only
human contain DNA
DNA is made of protein.
(Marbach-Ad 2001)
(Lewis and Kattmann 2004)
Genes contain alleles. Alleles
contain genes.
(Tekkaya 2002)
Genes and alleles are the same
(Tekkaya 2002)
(Lewis and Wood-Robinson 2000)
Banet and Ayuso 2000
(Marbach-Ad 2001)
Specialised sex cells (gametes)
are haploid, i.e. they contain half
the number of chromosomes as
normal body cells.
Genes, as sections of the DNA
molecule, are made of
nitrogenous bases attached to
five carbon sugars and one or
more phosphate group.
Each cell in the body, apart from
sex cells, contains a full set of
DNA.
DNA is found in all cells in the
body.
Specialised sex cells contain the
same number of chromosomes as
normal body cells.
(Lewis et al 2000)
Genes are proteins.
(Marbach-Ad 2001)
Each cell only contains specific
genetic information required to
fulfill its function.
DNA is found in sex cells but not
in any other types of body cells.
(Lewis et al 2000)
(Banet and Ayuso 2000)
Appendix:
Genes are
pants I wear to
look good
No David
Genes are
traits that
people have
All Genes are
passed down
from parents to
their kids. So I’ll
be great at soccer
A gene is a
section of
DNA that
codes for a
particular
trait
Fools, Only Humans
have DNA which
can be passed on
from one
generation to the
next
All animals
have DNA
as do
plants.
All organisms have
DNA
Did you know,
that Alleles
are different
forms of the
same gene?
Don’t genes
contain
alleles?
I thought
alleles coded
for proteins?
No dude, alleles
and genes are
the same thing
DNA as sections of the
genes, are made of
nitrogenous bases attached
to 3 carbon sugars and one
or more phosphate group.
Genes, as
sections of the
DNA molecule,
are made of
nitrogenous
bases attached
to 4 carbon
sugars
Genes, as sections
of the DNA
molecule, are
made of
nitrogenous bases
attached to five
carbon sugars and
one or more
phosphate group.
Genes, are
sections of DNA
that are made up
of proteins, bases
and sugars
Build a DNA molecule:
Mini Whiteboard:
Worksheet:
1. Describe the genotypes given (use your notes). The first one is already done.
A. DD homozygous, dominant D. ss ______________________
B. Dd ___________________ E. Yy ______________________
C. dd ____________________ F. WW ____________________
2. The building blocks of nucleic acids are known as ________________________.
3. The acronym DNA stands for __________________________________________.
4. DNA makes up chromosomes, which are located in the ___________________ of a cell.
5. Small sections of a DNA molecule that determine genetic traits are called
______________. 6. A DNA molecule consists of _______ strands.
7. DNA is a long chain made of repeating units called ___________________________.
8. Nucleotides are attached by bonds between the __________________ and the phosphate
group.
9. DNA is shaped like a _______________ helix.
10. Write the complementary sequence to following DNA strand:
AATTCGCCGGTATTAGACGTT
11.
a. Label the phosphate group and the sugar in the diagram:
b. Complete the diagram filling in the base pairs:
12. DNA can be found in what organelles?
13. What two scientists established the structure of DNA?