Gene Expression Worksheet The following is the base sequence on one strand of a DNA molecule: GCGGGTTACAATGCCAGTGGTTCGCACAAGATGATCGCGGT 1. Give the base sequence of the complementary DNA strand. (Replicate the original strand) GCGGGTTACAATGCCAGTGGTTCGCACAAGATGATCGCGGT 2. Give the base sequence of the strand of mRNA read from the original DNA strand. (Transcribe the original strand) GCGGGT TACAATGCCAGTGGTTCGCACAAGATG ATCGCGGT 3. What polypeptide would this mRNA in number 2 code for? (Translate your answer to #2) (Find the “Start” codon!) 4. If the 13th nucleotide in the original DNA strand were changed from G to C, what would the resulting mRNA look like? (You must change the strand below.) GCGGGTTACAATGCCAGTGGTTCGCACAAGATGATCGCGGT 5. What would the resulting polypeptide be? 6. If a G were added to the original DNA strand after the 12th nucleotide, what would the resulting mRNA look like? (You must change it.) GCGGGTTACAATGCCAGTGGTTCGCACAAGATGATCGCGGT 7. What would the resulting polypeptide be? 8. If the 17th nucleotide in the original DNA strand were changed from G to C, what would the resulting mRNA look like? (You must change it.) GCGGGTTACAATGCCAGTGGTTCGCACAAGATGATCGCGGT 9. What would the resulting polypeptide be? 10. How did the simple point mutation in # 8, of losing just one nucleotide affect the polypeptide?