Raven/Johnson Biology 8e
Chapter 15 Answers
1. The experiments with nutritional mutants in Neurospora by Beadle and Tatum provided
evidence that—
a. bread mold can be grown in a lab on minimal media
b. X-rays can damage DNA
c. cells need enzymes
d. genes specify enzymes
The correct answer is d—
A. Answer a is incorrect. The ability of mold to grow on bread was not a new observation.
Beadle and Tatum’s research provided new insights into the relationship between genes
and proteins.
The correct answer is d—
B. Answer b is incorrect. The ability of X-rays to damage DNA was already known. Beadle
and Tatum used this fact when they generated nutritional mutants.
The correct answer is d—
C. Answer c is incorrect. The function of enzymes in cell metabolism was already known.
Beadle and Tatum used existing knowledge about the biochemical pathway of arginine
synthesis in their experiment.
The correct answer is d—genes specify enzymes
D. Answer d is correct. The concept of one-gene/one-polypeptide was based on the results of
Beadle and Tatum’s experiments.
2. What is the central dogma of molecular biology?
a. DNA is the genetic material
b. Information passes from DNA to protein
c. Information passes from DNA to RNA to protein
d. One gene encodes only one polypeptide
The correct answer is c—
A. Answer a is incorrect. The central dogma refers to the direction of information flow in a
cell. DNA is the genetic material; however, this does not explain the relationship between
DNA and protein.
The correct answer is c—
B. Answer b is incorrect. The information encoded in the DNA is converted to protein;
however, there is an intermediate step in the flow of information that requires a molecule
of RNA.
The correct answer is c—Information passes from DNA to RNA to protein
C. Answer c is correct. The flow of information in a cell moves from DNA to protein by way
of RNA.
The correct answer is c—
D. Answer d is incorrect. The central dogma refers to the direction of information flow in a
cell, not to the relationship between genes and proteins.
Raven/Johnson Biology 8e
Chapter 15 Answers
3. The manufacture of new proteins is termed ___________, and the production of a
messenger RNA corresponding to a specific gene is called ___________.
a. translation; transcription
b. termination; translation
c. transcription; translation
d. transfer; translation
The correct answer is a—translation; transcription
A. Answer a is correct. Protein synthesis involves the translation (RNA and protein are
different molecular types) of the genetic code in a messenger RNA into the amino acid
sequence of a protein. In contrast, the information in a molecule of DNA is transcribed
(DNA and RNA are the same molecular type) into a molecule of messenger RNA.
The correct answer is a—
B. Answer b is incorrect. Termination is a step in the process of protein or RNA synthesis,
but it is not the correct term for the manufacture of a protein. The production of a
molecule of RNA from DNA is not considered translation since both molecules are made
of the same material—that is, nucleic acid.
The correct answer is a—
C. Answer c is incorrect. Transcription occurs in the production of a molecule of messenger
RNA from DNA. Translation refers to the idea that information is moving from one kind
of molecule, a nucleic acid, to another kind of molecule, a protein.
The correct answer is a—
D. Answer d is incorrect. The manufacture of a protein involves the translation of the
genetic code in a molecule of messenger RNA into the amino acid sequence of a protein.
In contrast, the information in a molecule of DNA is transcribed into a molecule of
messenger RNA.
4. Each amino acid in a protein is specified by—
a. multiple genes
b. a promoter
c. a codon
d. a molecule of mRNA
The correct answer is c—
A. Answer a is incorrect. An amino acid is a subunit of a protein. A gene represents
information for building a protein; that is, it encodes multiple amino acids of a single
protein.
The correct answer is c—
B. Answer b is incorrect. A promoter is a region of DNA that binds an RNA polymerase
enzyme during the process of transcription.
The correct answer is c—a codon
C. Answer c is correct. A codon is a three-“letter” code, consisting of three nucleotides, that
specifies a particular amino acid.
Raven/Johnson Biology 8e
Chapter 15 Answers
The correct answer is c—
D. Answer d is incorrect. A molecule of messenger RNA encodes an entire protein. A
protein is composed of many amino acids.
5. The TATA box in eukaryotes is part of a—
a. core promoter
b. -35 sequence
c. -10 sequence
d. 5′ cap
The correct answer is a—core promoter
A. Answer a is correct. A core promoter region is a sequence of DNA that includes the
TATA box as well as other regulatory sequences.
The correct answer is a—
B. Answer b is incorrect. The -35 sequence is associated with prokaryotic promoters.
The correct answer is a—
C. Answer c is incorrect. The -10 sequence is associated with prokaryotic promoters.
The correct answer is a—
D. Answer d is incorrect. A 5′ cap is a modification of eukaryotic mRNAs.
6. What is the coding strand?
a. The single DNA strand copied to produce a molecule of RNA
b. The single-stranded RNA molecule that is transcribed from the DNA
c. The DNA strand that is not copied to synthesize a molecule of RNA
d. The region of a chromosome that contains a gene
The correct answer is c—
A. Answer a is incorrect. The strand of DNA copied to produce the messenger RNA is the
template strand.
The correct answer is c—
B. Answer b is incorrect. The RNA produced from the DNA is called messenger RNA.
The correct answer is c—The DNA strand that is not copied to synthesize a molecule of RNA
C. Answer c is correct. The coding strand is the complementary strand to the template strand.
It has the same sequence as the messenger RNA.
The correct answer is c—
D. Answer d is incorrect. The coding strand is complementary to the template strand used to
make the messenger RNA.
7. An anticodon would be found on which of the following types of RNA?
a. snRNA (small nuclear RNA)
b. mRNA (messenger RNA)
c. tRNA (transfer RNA)
d. rRNA (ribosomal RNA)
Raven/Johnson Biology 8e
Chapter 15 Answers
The correct answer is c—
A. Answer a is incorrect. An snRNA is involved in the processing of pre-mRNAs in the
nucleus.
The correct answer is c—
B. Answer b is incorrect. An mRNA is made up of codons.
The correct answer is c—tRNA (transfer RNA)
C. Answer c is correct. A tRNA uses its anticodon to form complementary base-pairs with
the codon of the mRNA
The correct answer is c—
D. Answer d is incorrect. An rRNA is found in a ribosome.
8. RNA polymerase binds to a _________ to initiate _____________.
a. mRNA; translation
b. promoter; transcription
c. primer; transcription
d. transcription factor; translation
The correct answer is b—
A. Answer a is incorrect. RNA polymerase is responsible for making the mRNA by binding
to the template sequence of DNA.
The correct answer is b—promoter; transcription
B. Answer b is correct. The promoter region aligns the polymerase so it can initiate the
transcription of a messenger RNA from the template strand of a DNA.
The correct answer is b—
C. Answer c is incorrect. A primer is used in DNA replication, not in the synthesis of RNA.
The correct answer is b—
D. Answer d is incorrect. Transcription factors are proteins that help direct RNA polymerase
II to bind to its promoter. Once there, the polymerase triggers transcription, not
translation.
9. Which of the following functions as a “stop” signal for a prokaryotic RNA polymerase?
a. Formation of a transcription bubble
b. Addition of a long chain of adenine nucleotides to the 3′ end
c. Addition of a 5′ cap
d. Formation of a GC hairpin
The correct answer is d—
A. Answer a is incorrect. The transcription bubble is the site of active transcription, not a
termination site.
The correct answer is d—
Raven/Johnson Biology 8e
Chapter 15 Answers
B. Answer b is incorrect. The addition of a poly-A tail is a eukaryotic trait that occurs after
termination of transcription.
The correct answer is d—
C. Answer c is incorrect. The addition of a 5′ cap is a eukaryotic trait that occurs after
termination of transcription.
The correct answer is d—Formation of a GC hairpin
D. Answer d is correct. The GC hairpin causes the prokaryotic RNA polymerase to pause,
eventually leading to the release of the newly synthesized messenger RNA.
10. An exon is a sequence of RNA that—
a. codes for protein
b. is removed through the action of a spliceosome
c. is part of a noncoding DNA sequence
d. both b and c are correct
The correct answer is a—codes for protein
A. Answer a is correct. An exon is the part of the gene that is expressed and eventually
specifies the amino acid sequence within a protein.
The correct answer is a—
B. Answer b is incorrect. A spliceosome removes the introns, or intervening sequences,
leaving the exons in the mature mRNA.
The correct answer is a—
C. Answer c is incorrect. An exon is part of the expressed region of a gene. The intervening
sequences, or introns, are the regions that are noncoding.
The correct answer is a—
D. Answer d is incorrect. Exons are the expressed region of a gene. Introns are the noncoding
regions that are removed by spliceosomes.
11. The job of a ribosome during translation can best be described as—
a. targeting proteins to the rough endoplasmic reticulum
b. determining the sequence of amino acids
c. carrying amino acids to the mRNA
d. catalyzing peptide bond formation between amino acids
The correct answer is d—
A. Answer a is incorrect. Targeting of proteins to the rough ER is the job of SRP.
The correct answer is d—
B. Answer b is incorrect. The sequence of amino acids is determined by the codon sequence
in the mRNA molecule.
The correct answer is d—
C. Answer c is incorrect. Transfer RNAs (tRNAs) are responsible for carrying amino acids
to the mRNA.
Raven/Johnson Biology 8e
Chapter 15 Answers
The correct answer is d—catalyzing peptide bond formation between amino acids
D. Answer d is correct. Ribosomes catalyze peptide bond formation.
12. What is the function of the signal sequence?
a. It initiates transcription by triggering RNA polymerase binding.
b. It initiates translation.
c. It is the binding site of signal recognition particle.
d. It signals the end of translation, resulting is the disassembly of the ribosome.
The correct answer is c—
A. Answer a is incorrect. RNA polymerase binding occurs at a promoter site, not at a signal
sequence.
The correct answer is c—
B. Answer b is incorrect. Translation is initiated by the start codon, AUG.
The correct answer is c—It is the binding site of signal recognition particle.
C. Answer c is correct. The signal recognition particle (SRP) binds to the signal sequence.
This complex then binds to a receptor in the rough ER.
The correct answer is c—
D. Answer d is incorrect. Stop codons and release factors are responsible for terminating
translation.
13. How can a point mutation lead to a nonsense mutation?
a. Changing a single base has no effect on the protein.
b. Changing a single base leads to a premature termination of translation.
c. Changing a single base within a codon from an A to a C.
d. The addition or deletion of a base alters the reading frame for the gene.
The correct answer is b—
A. Answer a is incorrect. If the change of a base has no effect, then the mutation would be
considered “silent.”
The correct answer is b—Changing a single base leads to a premature termination of translation.
B. Answer b is correct. A nonsense mutation changes a codon that encodes an amino acid to
a stop codon. This will lead to premature termination of translation.
The correct answer is b—
C. Answer c is incorrect. This missense mutation is a transversion. It could not be a nonsense
mutation as no stop codon contains a C.
The correct answer is b—
D. Answer d is incorrect. The addition or deletion of a base results in a frameshift mutation.
This often causes nonsense mutations after the frameshift but does not necessarily do so.
14. Which of the following is a consequence of a translocation?
a. Genes move from one chromosome to another.
Raven/Johnson Biology 8e
Chapter 15 Answers
b. RNA polymerase produces a molecule of mRNA.
c. A molecule of mRNA interacts with a ribosome to produce a protein.
d. A segment of a chromosome is broken, reversed, and reinserted.
The correct answer is a—Genes move from one chromosome to another.
A. Answer a is correct. A translocation occurs when a region of one chromosome is
transferred (translocated) to another chromosome.
The correct answer is a—
B. Answer b is incorrect. The production of a molecule of mRNA is called transcription.
The correct answer is a—
C. Answer c is incorrect. The production of a protein from a molecule of mRNA is called
translation.
The correct answer is a—
D. Answer d is incorrect. An inversion occurs when sections of a chromosome end up
reversed within the original chromosome.
15. What is the relationship between mutations and evolution?
a. Mutations make genes better.
b. Mutations can create new alleles.
c. Mutations happened early in evolution, but not now.
d. There is no relationship between evolution and genetic mutations.
The correct answer is b—
A. Answer a is incorrect. Mutations are random changes to DNA. They are neither good nor
bad, although typically, changes in genes end up disrupting the function of proteins.
The correct answer is b—Mutations can create new alleles.
B. Answer b is correct. By altering genetic material, mutation can produce new alleles that
selection can act on.
The correct answer is b—
C. Answer c is incorrect. Mutation is an ongoing process, as is natural selection.
The correct answer is b—
D. Answer d is incorrect. Evolution through natural selection requires change, and that
change is dependent on genetic mutations.
Challenge Questions
1. A template strand of DNA has the following sequence:
3′–CGTTACCCGAGCCGTACGATTAGG–5′
Use the sequence information to determine—
a. the predicted sequence of the mRNA for this gene
b. the predicted amino acid sequence of the protein
Raven/Johnson Biology 8e
Chapter 15 Answers
Answer—The template strand is the strand of DNA that is transcribed into mRNA. Recall that
RNA uses uracil (U) in place of thymine (T). The sequence of the mRNA will be complementary
to the DNA template.
a. 5′–GCAAUGGGCUCGGCAUGCUAAUCC–3′
The amino acid sequence is based on the sequence of codons within the molecule of mRNA.
Recall that all proteins start with the amino acid methionine encoded by the codon AUG. Find the
AUG in the mRNA and then count every three nucleotides to determine the codon sequence.
5′–GCA AUG GGC UCG GCA UGC UAA UCC–3′
Use the genetic code provided in Table 15.1 to decipher the amino acid sequence. Remember to
start with AUG and end with a stop codon. Nucleotides that occur before AUG or after a stop
codon will not contribute to the amino acid sequence of the protein.
b. Met-Gly-Ser-Ala-Cys-STOP
2. Describe how each of the following mutations will affect the final protein product.
Name the type of mutation.
Original Template strand: 3′–CGTTACCCGAGCCGTACGATTAGG–5′
a. 3′–CGTTACCCGAGCCGTAACGATTAGG–5′
b. 3′–CGTTACCCGATCCGTACGATTAGG–5′
c. 3′–CGTTACCCGAGCCGTTCGATTAGG–5′
Answer—For each of these mutations you will need to determine the sequence of the original
mRNA and protein based on the sequence of the DNA template strand (Hint: The sequence of
this template strand is the same as in question 1).
Original mRNA = 5′–GCA AUG GGC UCG GCA UGC UAA UCC–3′
Original protein = Met-Gly-Ser-Ala-Cys-STOP
a. mRNA = 5′–GCA AUG GGC UCG GCA UUG CUA AUC C–3′
The amino acid sequence would then be: Met-Gly-Ser-Ala-Leu-Leu-Iso-.
There is no stop codon. This is an example of a frameshift mutation. The addition of a nucleotide
alters the “reading frame,” resulting in a change in the type and number of amino acids in this
protein.
b. mRNA = 5′–GCA AUG GGC UAG GCA UGC UAA UCC–3′
The amino acid sequence would then be: Met-Gly-STOP.
This is an example of a nonsense mutation. A single nucleotide change has resulted in the early
termination of protein synthesis by altering the codon for Ser into a stop codon.
c. mRNA = 5′–GCA AUG GGC UCG GCA AGC UAA UCC –3′
The amino acid sequence would then be: Met-Gly-Ser-Ala-Ser-STOP.
This base substitution has affected the codon that would normally encode Cys (UGC) and
resulted in the addition of Ser (AGC).
3. Predict whether gene expression (from initiation of transcription to final protein
product) would be faster in a prokaryotic or eukaryotic cell. Explain your answer.
Answer—The process of gene expression would occur more quickly in the prokaryotic cell for a
number of reasons. The process of transcription is similar between eukaryotic and prokaryotic
cells; however, the messenger RNA in the eukaryotic cell is a pre-mRNA and must go through
additional steps (addition of the 5′ cap, splicing, etc.) before it exits the nucleus. In contrast, the
prokaryotic mRNA is capable of binding to ribosomes immediately after synthesis (refer to
Figure 15.8). This is possible because the prokaryotic DNA is not compartmentalized within a
Raven/Johnson Biology 8e
Chapter 15 Answers
nuclear membrane. In addition, prokaryotic mRNAs can encode multiple proteins (operons),
allowing the cell to generate many proteins quickly.