Solutions used in ChIP-on-Chip experiments:
1. 2% of BSA: 1 g of BSA in 50 ml of Mili-Q water
2. Cross-linking solution: 11% formaldehyde, 0.1M NaCl, 1mM
Na-EDTA, 0.5mM Na-EGTA, 50 mM Hepes, pH 8.0
3. Lysis Buffer 1: 0.05 M Hepes-KOH, pH 7.5, 0.14 M NaCl, 1mM EDTA,
10% glycerol, 0.5% NP-40, 0.25% Triton X-100, with protease inhibitor
cocktail (Roche Applied Science)
4. Lysis Buffer 2: 0.2 M NaCl, 1mM EDTA, 0.5 mM EGTA, 10 mM Tris pH
8, protease inhibitor cocktail
5. Lysis Buffer 3: 1mM EDTA, 0.5 mM EGTA, 10 mM Tris-HCl pH 8,
protease inhibitor cocktail
6. Proteinase K stock solution: 20 mg/ml proteinase K (Sigma) 50 mM
Tris-HCl pH 8.0, 1.5 mM calcium Acetate
7. RIPA buffer: 50 mM Hepes, pH 8.0, 1mM EDTA, 0.7% DOC, 1% NP-40,
0.5M LiCl, protease inhibitor cocktail
8. Elution buffer: 10 mM Tris pH 8, 1 mM EDTA, 1% SDS
9. Array Pre-hybridization Solution: 2XSSC/0.05%SDS/0.2%BSA
10. Hybridization buffer 1: 2.2x SSC, 0.22% SDS
11. Hybridization buffer 2: 70% formamide, 3XSSC, 14.3% dextran
sulfate
Cross-linking of cells and fragmentation and immunoprecipitation of chromatin:
Formaldehyde cross-linking and preparation of chromatin 109 cells
suspended in growth medium are transferred as 40ml aliquots to 50 ml tubes
and placed on ice for 10 minutes. Then 1/10 volume of cross-linking solution is
added directly to each tube. After a 10 minute incubation on ice (adjust
cross-linking time and temperature depending upon the cell type), 1/20 volume
of 2.5M glycine solution is added to each tube to stop the cross-linking reaction.
The cells are harvested by centrifugation at 2000 x g for 10 minutes at 4oC.
The cell pellets are re-suspended in cold PBS (137 mM NaCl, 2.7 mM KCl, 10
mM Na2HPO4, 2 mM KH2PO4) and washed twice. The final cell pellet may be
snap-frozen in liquid nitrogen. Adherent cells can also be fixed directly on
plates, treated with glycine, washed with PBS, and harvested in cold PBS with
a silicone scraper.
The cell pellet is re-suspended in 30 ml of chilled Lysis Buffer 1 by pipetting
and is mixed for 10 minutes at 4oC on a rocking platform. After centrifugation
at 2000 x g for 10 minutes at 4oC, the cell pellet is re-suspended in 24 ml Lysis
Buffer 2 by pipetting and mixed gently at room temperature for 10 min on a
rocking platform. After centrifugation at 2000 x g for 10 minutes at 4oC, the
pellet is resuspended in 5 ml of Lysis Buffer 3.
The mixture is divided into 5 ml aliquots in 15 ml conical tubes. These tubes
are then placed into 50ml tubes containing ice. A sonicator (Branson Sonifier
450, with power setting at 5) is used to disrupt the cell and nuclear membranes
and fragment the chromatin. To avoid foaming, the sonicator probe tip is first
immersed in the mixture followed by a 25~30 second, continuous pulse of
sonication. The tube is immediately placed on ice for at least 1 minute to avoid
over-heating the sample. Sonication is repeated until the chromatin fragments
are of the desired length. The fragment size can be examined by agarose gel
electrophoresis of 10 ul of cell extract digested with Proteinase K for 1 hour.
The number of sonication cycles varies with cell type and cross-linking
conditions, and pilot tests are recommended. Ten cycles of sonication are
normally sufficient to achieve the desired (~500 bp) fragment size. Finally, the
chromatin solution is adjusted to 0.5% Sarkosyl (sodium lauryl sarcosine) and
gently mixed for 10 minutes at room temperature on a rocking platform. The
chromatin solution is then transferred to a centrifuge tube and spun for 10 min
at 10,000 x g to remove cell debris. The supernatant is collected for chromatin
immunoprecipitation. At this stage, the concentration of DNA should be
normalized to 2mg/ml plus 10% glycerol. The solution can be stored at -80oC
in 1 ml aliquots. The amount of chromatin generated here should be sufficient
for 10 immunoprecipitation reactions.
Immunoprecipitation of chromatin Magnetic beads (Dynal) pre-bound to
polyclonal antibodies are used to immunoprecipitate the DNA associated with
the protein of interest. To prepare the magnetic beads, 100 ul of sheep
anti-rabbit IgG-conjugated Dynabeads (Dynal) are first washed three times
with cold PBS containing 5 mg/ml Bovine Serum Albumin (BSA) and then
resuspended in 5 ml of cold PBS. 10 ug of rabbit polyclonal antibody is added
to the mixture and incubated overnight on a rotating platform at 4oC. After
collecting the magnetic beads by centrifugation and washing three times with
cold PBS containing 5 mg/ml BSA, the beads are re-suspended in 100 ul of
cold PBS with 5 mg/ml BSA and are then ready for immunoprecipitation.
In an Eppendorf tube, 2 mg of soluble chromatin are first adjusted to 1% Triton
X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail and 1X TE to
make 1.3ml total volume, then mixed with 100 ul of magnetic beads pre-bound
to the antibody. The mixture is incubated at 4oC overnight on a rotating
platform. The magnetic beads are then collected using a magnet (Dynal), and
the supernatant is removed by aspiration. To remove material non-specifically
bound to the beads, 1ml of RIPA buffer is added to the tube, and the beads are
gently re-suspended by removing magnet and inverting by hand. The magnetic
beads are again collected with the magnet and washed with RIPA buffer a total
of 8 times. After washing once with 1 ml of TE, the beads are precipitated with
magnet and the suspension is removed. The beads are then collected by
centrifugation at 2000 x g for 3 minutes and re-suspended in 50 ul of elution
buffer. To elute precipitated chromatin from the beads, the tubes are incubated
at 65oC for 10 minutes with constant agitation then centrifuged for 30 seconds
at maximum speed in microcentrifuge (14000rpm). 50 ul of supernatant are
removed and mixed with 120ul of TE with 1% SDS. This solution is incubated
at 65oC overnight to reverse the cross-links. As a chromatin input control, 50
ug of chromatin are mixed with 120 ul of TE containing 1% SDS in a separate
tube and incubated at 65oC overnight.
Purification of DNA After reversal of cross-links, proteins in the DNA
sample are removed by incubation with 150 ul of Proteinase K solution (2%
glycogen, 5% Proteinase K stock solution, and TE) for 2 hours at 37oC. The
sample is then extracted twice with phenol and once with 24:1
chloroform/isoamyl alcohol. The sample is adjusted to 200 mM NaCl. After
ethanol precipitation, the DNA is dissolved in 30 ul of TE containing 10 ug of
DNase-free RNase A and incubated for 2 hours at 37oC. The DNA at this step
can be further purified with a Qiaquick PCR clean-up kit (Qiagen).
Blunting, ligation of linkers to DNA, and amplification by PCR:
The immunoprecipitated DNA is typically present in very small quantities (1-10
ng total), and it is therefore necessary to perform an amplification step prior to
labeling and DNA microarray analysis. To achieve this, a ligation-mediated
PCR (LM-PCR) procedure is used. Because the DNA at this stage contains
recessed and heterogeneous ends as a result of the physical shearing process,
it is first treated with T4 DNA polymerase to form blunt ends. Then a linker is
ligated to the DNA fragments. The addition of this linker allows the DNA to be
amplified by PCR using a universal oligonucleotide primer.
Blunting, ligation, and PCR In an Eppendorf tube, the immunoprecipitated
DNA (or 20 ng of control input DNA) is combined with 11 ul of 10X T4 DNA
polymerase buffer (New England Biolabs), 0.5 ul BSA (10 mg/ml) (New
England Biolabs), 0.5 ul dNTP mix (20 mM each), 0.2 ul T4 DNA polymerase
(3U/ul) (New England Biolabs), and distilled H2O in a total volume of 112.2 ul.
After a 20 minute incubation at 12oC, 1/10 volume of 3M sodium acetate (pH
5.2) and 20 ug of glycogen (Roche Applied Sciences) are added to the tube,
and the DNA sample is extracted once with phenol:chloroform:isoamyl alcohol
(25:24:1)(Sigma). After ethanol precipitation, the DNA is dissolved in 25 ul of
distilled H2O.
The blunt-ended DNA is mixed with 8 ul of distilled H2O, 10 ul of 5X ligase
buffer (Invitrogen), 6.7 ul of annealed oligonucleotide linkers (oligo-1:
GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC, annealed
to make a 15mM solution), and 0.5 ul T4 DNA ligase (New England Biolabs)
for a total volume of 50 ul. The ligation reaction is allowed to proceed overnight
at 16oC. After ligation, the DNA is purified by ethanol precipitation and
dissolved in 25 ul of distilled H2O.
The ligated DNA is then mixed with 4 ul of 10X ThermoPol reaction buffer
(New England Biolabs), 4.75 ul distilled H2O, 5 ul of 10X dNTP mix (2.5 mM
each), 1.25 ul oligo-1 (40 mM stock) in a final volume of 40 ul in a 200µl
thin-walled PCR tube. The tube is first incubated at 55oC for 2 minutes in a
thermal cycler to separate linker oligonucleotides not ligated to the DNA, then
10 ul of an enzyme mix [8ul dH2O, 1 ul Taq DNA polymerase (5U/ul), 1 ul
ThermoPol reaction buffer, and 0.025 unit of Pfu polymerase (Stratagene)] is
added. Subsequently, the following PCR protocol is performed:
1.
2.
3.
4.
5.
step 1: 72oC for 5 minutes;
step 2: 95oC for 2 minutes;
step 3: 95oC for 1 minute;
step 4: 60oC for 1 minute;
step 5: 72oC for 2 minutes (use 3' if DNA fragments are 2-3kb on
average);
6. step 6: go to step 3, 22 times;
7. step 7: 72oC for 5 minutes;
8. step 8: 4oC indefinitely
After PCR, the DNA is purified using the Qiaquick PCR purification kit (Qiagen)
and eluted in 50 µl elution buffer provided with the kit.