Transcription & Translation Quiz Transcription: 1.) Which of the following best describes what happens during transcription? A. mRNA is made using a DNA template B. tRNA is made using a DNA template C. proteins are made using an RNA template D. RNA is made using an RNA template 2.) Which of the following would be the complimentary RNA strand produced by transcription to this: ATCGGCTTAACGTCA A. TAGCCGAATTGCAGT B. UAGCCGAAUUGCAGU C. CGAUUAGGCCGACUC D. GCTAATCCGGCTGCG 3.) In transcription, which enzyme is responsible for laying down complimentary bases to the parent strand? A. DNA Polymerase B. DNA Helicase C. RNA Polymerase D. RNA Helicase 4.) Which of the following is NOT a difference between DNA and RNA? A. The sugar is different between the two B. The length of the strand is different between the two C. One is single stranded and one is double stranded D. At least one of the nitrogenous bases is different between the two 5.) Which of the following best illustrates the order of the central dogma? A. DNA RNA Proteins Traits B. RNA DNA Proteins Traits C. DNA RNA Traits Proteins D. RNA DNA Traits Proteins 6.) Where does transcription occur? A. In the nucleus B. In the cytoplasm C. In the ribosome D. In the golgi body 7.) What does tRNA stand for? A. Trade RNA B. Translate RNA C. Transcript RNA D. Transfer RNA Translation: 8.) Which of the following best describes what happens during translation? A. mRNA is made using a DNA template B. tRNA is made using a DNA template C. proteins are made using an RNA template D. RNA is made using an RNA template 9.) How many codons does the following tRNA strand have? AUGUUUCAUGAUGCGGGAGUCAUUCCAACCUAG A. 33 B. 3 C. 11 D. 1 10.) How many amino acids will this tRNA strand code for? AUGUUUCAUGAUGCGGGAGUCAUUUAG A. 27 B. 3 C. 9 D. 1 11.) Which of the following are the building blocks of proteins? A. Codons B. Nitrogenous Bases C. Amino Acids D. SpongeBob Squarepants 12.) Which of the following is the tRNA complement to this mRNA strand? UACAAAGUACUACGCCCUCAGUAAAUC A. UACAAAGUACUACGCCCUCAGUAAAUC B. ATGTTTCATGATGCGGGAGTCATTTAG C. AUGUUUCAUGAUGCGGGAGUCAUUUAG D. TACAAAGTACTACGCCCTCAGTAAATC 13.) Which of the following is the correct sequence of amino acids that would be produced from the following codons? AUG-GUA-CCA-GGA-UGA A. Iso- Val-Pro-Gly-stop B. Met-Val-Pro-Gly-stop C. Val-Met-Pro-Arg-Ser D. Leu-Ser-Gly-Arg-His 14.) Which of the following is NOT a stop codon? A. AUG B. UAG C. UAA D. UGA