Modified from an activity by Jessica McLemore
Hemoglobin and Gene Expression
BACKGROUND INFORMATION
You have learned how a DNA molecule is able to act as a template for its own replication. How does this process allow for the
continuity of a species? How is the information stored in DNA used by each organism that possesses it? How do your cells use
the information stored in the sequence of nucleotides in your DNA to build and maintain the physical being that is you?
In this activity you will develop your own explanation of the relationship between DNA and traits by tracing the series of events
that leads to gene expression. The gene you will study is the gene for sickle cell disease, a potentially fatal condition. As you
and your partner work through this activity, you will create a poster that illustrates the molecular basis of sickle cell disease.
PROCESS & PROCEDURE
Part A: Looking at Sickle Cell Disease
1. Begin your study of the molecular basis (DNA) of sickle cell disease by reading the following
information about this inherited disorder and about the associated gene.
Hemoglobin and Red Blood Cell Abnormalities in Sickle Cell Disease
Each year about 1 in 625 African-American children in the United States is born with sickle cell disease. This disease is
caused by an abnormality in hemoglobin, the protein in red blood cells that carries oxygen to the cells of the body. When the
oxygen supply in the blood is low (ex: strenuous exercise or high altitude), these abnormal hemoglobin molecules clump
together instead of remaining separate as normal hemoglobin molecules do. The figure below shows this difference between the
behavior of sickle cell hemoglobin and normal hemoglobin.
Normal Oxygen Level
Low Oxygen Level
Normal Oxygen Level
Low Oxygen Level
Check:
a. What type of biomolecule is hemoglobin?
b. What is it used for?
Modified from an activity by Jessica McLemore
The clumping of the hemoglobin molecules at low oxygen levels causes the red blood cells in a person with sickle cell
disease to become long and rigid like a sickle instead of remaining round and flexible. (see figure below). This change in cell
shape causes a variety of problems in the body. For example, as cells become sickled, they tend to block small blood vessels,
causing pain and damage to the areas that are not receiving an adequate blood supply (see below). The long-term effect of
repeated blockages may permanently damage a person's internal organs, including the heart, lungs, kidneys, brain, and liver.
For some people the damage is so severe that they die in childhood. With good medical care, however, many people with sickle
cell disease can live reasonable normal lives.
Sickled red
Blood Cells
Normal Red
Blood Cells
2. Discuss the following questions with your partner before writing your answer on the Team Answer
Sheet.
a. What medical symptoms might a person with sickle cell disease experience?
b. What problem in the red blood cells causes these symptoms to occur?
c. What problem in the behavior of the hemoglobin molecules is associated with these
changes in an individual's red blood cells?
d. Think back to your knowledge of DNA structure. What might be the molecular basis
for the trait of sickle cell disease?
3. Working with your partner, begin creating a presentation that will illustrate the molecular basis of
sickle cell disease. Your presenation should have a place for a title (you will add this later), and it
should have each of the following numbered sections. The information you fill in for sections 5-6
will be in picture form, which should be accompanied by labels.
1.
DNA Sequence
2.
mRNA sequence
3.
polypeptide (protein) sequence
4.
Shape of the hemoglobin molecule
5.
Behavior of the hemoglobin molecule
6.
Shape of the red blood cell under low oxygen conditions
7.
Medical implications
4. Use the information that you gathered in Steps 1 and 2 to complete areas 5, 6, and 7 of your
poster. The top half of the poster is for Normal Hemoglobin and the bottom for Sickle
Hemoglobin.
Modified from an activity by Jessica McLemore
2
Codons
(mRNA)
3
Protein
(amino acid
sequence)
4
Hemoglobin
Shape
5
Hemoglobin
behavior
6
RBC shape
at low
oxygen
levels.
7
Medical
Implications
sickle cell
normal
1
DNA
sequence
Part B: Looking at the Structure of the Gene Involved in Sickle Cell Disease
1. To understand in more detail how the information present in the hemoglobin gene is related to
sickle cell disease, refer to the DNA sequences below. Use these sequences as paper models of
the same portion of two different alleles of the hemoglobin gene (normal and sickled). Copy them
onto your poster.
DNA Sequences for Hemoglobin Alleles
Normal Allele:
AGGTCTCCTCTAATGGGTCTCCTTAGGTCTCCT
Sickle Cell Allele:
AGGTCTCCTCTAATGGGTCACCTTAGGTCTCCT
2. Compare the 2 nucleotide sequences.
a. Draw an arrow or a circle on your poster to indicate the nucleotides in the sickle cell
sequence that differ from those in the normal sequence.
b. What type of mutations exist in the sickle cell allele?
Part C: Looking at the Expression of the Gene Involved in Sickle Cell Disease
1. To understand how the difference in sequence between the normal and sickle cell alleles of the
hemoglobin gene results in the symptoms associated with the disease, determine the messenger
RNA (mRNA) sequences that corresponds to the DNA sequences that you examined in Part B.
One member of the group should determine the mRNA sequence that results from the DNA
sequence that represents the allele for Normal Hemoglobin. The other group member should
transcribe the mRNA from the DNA sequence that represents the allele for Sickle Cell
hemoglobin. Write both mRNA sequences in section 3 of your poster.
2. Compare the mRNA that results from the transcription of the normal allele of the hemoglobin
gene to the mRNA that results from the transcription of the sickle cell allele. Use an arrow or a
circle to indicate on your poster the nucleotides in the sickle cell mRNA that differ from those in
the normal sequence.
3. Use the Codon Chart in your textbook to determine the amino acid sequence that would result
from the translation of both mRNA molecules. Write this sequence in section 4 of your poster.
4. Compare the amino acid sequence that results from transcription and translation of the normal
allele for the hemoglobin gene with the amino acid sequence that results from transcription and
Modified from an activity by Jessica McLemore
translation of the sickle cell allele. Use an arrow or a circle to indicate on your poster the amino
acids in the sickle cell protein sequence that differs from those in the normal sequence.
5. Read the following information about the relationship between the sequence of amino
acids in a hemoglobin molecule and the molecule's shape.
Inside the environment of the red blood cell, a molecule of normal hemoglobin consists of
four protein chains folded into a globular shape. The molecule remains folded in this
manner due to attractive forces that occur between amino acids in different parts of the
protein chains that make up the molecule.
The change in the amino acid sequence that occurs as a result of the single nucleotide
mutation in the hemoglobin gene has no effect on the overall shape of the molecule when
oxygen levels are normal, so sickle cell hemoglobin behaves just like normal hemoglobin
under these conditions. When oxygen levels are low, however, the amino acid change
alters the attractive forces inside the molecule, causing molecules of sickle cell
hemoglobin to assume a different shape from those of normal hemoglobin. As the figure
below shows, it is this change in molecular shape under low oxygen levels- a change in
shape that results from only one change in the amino acid sequence- that causes sickle
hemoglobin to form the rigid rods characteristic of the condition.
The difference in behavior of sickle
cell hemoglobin is related to a shape
change that occurs at low oxygen
levels. This shape change results
from the substitution of the amino
acid valine for a glutamic acid.
a. Molecules of normal hemoglobin
will not associate with each other
because the bulge created by the
glutamic acid is too large to fit into
a pocket that occurs in another part
of the hemoglobin molecule.
Molecules of sickle hemoglobin,
however, will associate with each
other because the bulge created
when a valine is substituted for the
glutamic acid is small enough to fit
into the pocket. (The size of the
pocket does not change.)
b. Molecules of normal hemoglobin
remain in solution, even under
conditions of low oxygen. In
contrast, molecules of sickle
hemoglobin associate together to
form rigid cells under conditions of
low oxygen.
6. Add the information presented in Step 5 above to the appropriate place in your team's
presentation.
Complete your team's presentation by adding a descriptive title and any other details that you think
would help someone else understand the information that it presents.