Analysis of DNA from Ethnoarchaeological Stone Scrapers
Birgitta Kimura, Bruce L Hardy, Steven A Brandt and William W Hauswirth
ABSTRACT
Analysis of DNA residues on stone tools provides a direct method of determining what the tools were used
on. However, little is known about the taphonomy of DNA on tools. The discovery of present-day stone-tool using
hide workers in Ethiopia therefore provides a unique opportunity to study the survival and authenticity of DNA
residues on stone tools. We collected stone scrapers from contexts ranging from excavated to confirmed use, as well
as unused scrapers to test for the presence of DNA residues. We amplified segments of the mitochondrial genome
with PCR to determine which animal species a tool was used on. We were able to recover authentic DNA from
scrapers of known use, and from a subset of excavated scrapers. We did, however, also occasionally obtain DNA
unrelated to the use of the tools. Thus, caution must be used when interpreting results of DNA analysis of stone tools.
Keywords
Ethnoarchaeology / DNA / Stone tools / Biomolecular archaeology / Taphonomy
INTRODUCTION
Stone tools are among the most common, indeed often the only, artifacts found at archaeological sites.
Knowledge of what they were used for is important for understanding the behavior of prehistoric groups. Although
use-wear studies can determine what ranges of tasks tools were used for, it can only indicate the broad category of
use-material. Biological residues, on the other hand, have the potential of revealing which species and subspecies of
animal or plant the tool was used on to process. Previous studies have used immunological techniques to identify
proteins on stone tools (Tuross et al, 1996, Kooyman et al, 1992, Loy and Hardy, 1992), but there are problems with
the technique.
Eisele (1994) was unable to detect protein on blood coated tools that had been buried in damp earth for 1
month, and found only weak reactivity on tools buried for 10 months in dry soil. Fiedel (1996) points out that blind
tests have shown inconsistencies when tools have been analyzed with different immunological methods, and that
species identification frequently does not fit with the faunal records. Tuross et al (1996) showed that experimental
tools only contained low amounts of protein and that UV-irradiated tools had no immunological reactivity. Protein
residues on pot sherds are also degraded (Evershed and Tuross 1996). Proteins are quickly degraded, antibodies used
for detection frequently react with more then one species, and samples may be contaminated with substances that
interfere with detection. In addition, the immunoreactive sites on proteins are often conserved between species, and
in particular between subspecies.
DNA, although it also degrades and may be contaminated with substances that interfere with detection, is
generally more stable than protein and differs more between species, thus offering better resolution for identifying
species and subspecies. Since the development of the polymerase chain reaction (PCR), which enables the detection
of minute amounts of DNA, there has been an explosion in studies of ancient DNA. Most of them have focused on
analyzing bone, for example the study of rabbit mitochondrial DNA in medieval France by Hardy et al (1995), and
the determination of Neanderthal DNA sequences by Krings et al (1997). However, other tissues such as brain
(Hauswirth et al, 1994), and plant material (Goulubinoff et al, 1993) have also been analyzed. There are also a few
published studies of DNA from stone tools. Loy (1993) and Loy and Dixon (1998) used DNA studies in conjunction
with protein analysis and hemoglobin crystallization to determine which species certain collections of Alaskan stone
tools had been used on, and Hardy et al (1997) analyzed Middle Paleolithic stone tools from La Quina. Loy (1993),
however, used a nested PCR approach, which only to characterizes the DNA obtained to the sub-Family Bovinae,
and. He did not sequence the product, but identified the species as bison by hemoglobin crystallization. Fiedel
(1996) points out that this identification is surprising, as there is no archaeological evidence for bison hunting in the
area at the time the tools were used. In the study by Loy and Dixon (1998), the DNA analysis was limited to one
tool, and the molecular size pattern obtained by nested PCR was compared to control samples. No DNA sequencing
was reported. Hardy et al (1997) obtained animal DNA sequences from 5 of 8 tools. However, only one sequence
was confined to a tool, and was not present in sediment samples. Consequently only 1 of 8 tools yielded a sequence
consistent with the probable use of the tool.
Although there have been a few experimental studies on taphonomy of DNA residues ( Hardy et al, 1997,
Gaensslen et al, 1994, Tuross, 1994), little is known about how fast DNA degrades in an archaeological
environment, what conditions are best for preservation of DNA or even whether it is practical to obtain DNA from
stone tools. In addition, there is the question of whether DNA obtained from a tool is related to it's use, or whether it
may reflect in situ contamination (Brown and Brown, 1992). Thus there is a need to study the reliability of DNA
analysis from stone tools.
The discovery of contemporary stone tool using hide workers in Ethiopia (Gallagher, 1977, Clark and
Kurashina, 1981, Brandt, 1996, Haaland, 1987, Brandt et al, 1996, Brandt and Weedman,1997) provides a unique
opportunity to study the survival and authenticity of DNA on stone tools in a natural setting. Using stone tools from
contemporary knappers to study taphonomy has several advantages over experimental studies. First, the bias of the
investigator is reduced. The hide workers make and use the stone tools as part of their everyday activities, and thus
the survival of DNA is more likely to reflect the situation with prehistoric tools. Even in careful experimental studies,
it is unlikely that the investigator will recognize and control for all variables which have bearing on the taphonomy of
DNA. Although one cannot make the analogy that all stone tools in prehistory were treated as those of the Ethiopian
hide workers, analysis of these samples should give an indication of additional variables to examine. Second, tool
use, storage patterns and discard practices are known. Thus, the determination of species based on the DNA can be
checked against the known use and possible contaminants. This is not possible with archaeological tools. Third,
observations of the hide workers will, for example, aid in setting up models about how much use is needed to recover
sufficient DNA to analyze, whether general household waste will contaminate DNA on stone tools, and what type of
storage and discard practices maximize chances for survival of DNA.
STUDY AREA AND SAMPLE PROCURMENT
In June and July 1995 one of us (SAB) directed a pilot ethnoarchaeological survey of the hide workers of
southern Ethiopia (Brandt 1996, Brandt and Weedman 1997, Brandt et al 1997). Focusing on the subsistence
farming communities of the Sidama, Konso, Gamo, Wolayta, and Gurage ethnic groups (Figure 1), the main goal of
the survey was to determine how many hide workers were still using stone rather then metal to process animal skins
into useful products. The survey identified many male and female hide workers who still manufacture and use flaked
stone scrapers, hafted into wooden handles, to scrape cow, goat and wild animal hides into skins that are made into
bedding, bags and clothing.
The scrapers in this study, examples of which are presented in Figure 2, were obtained from a sample of
hide workers from each ethnic group. The hide workers were first interviewed and videotaped for information on the
life cycle of stone scrapers from production to discard, followed by the collection of debitage as well as scrapers at
various stages of use. A sample of Some hide workers' trash pits were also excavated for purposes of recovering a
sample of buried lithic material.
1
The Sidama, Wolayta and Gurage manufacture scrapers exclusively from obsidian obtained from various
sources, while the Gamo use chert and obsidian and the Konso use chert and quartz. In all cases primary and
secondary flaking is done by direct percussion using an iron bar or hoe as a percussor. While all the scrapers are
used as end scrapers, typologically some can be described as side and end scrapers. All scrapers are hafted into
wooden handles with single or double sockets filled with mastic. The only exception are certain groups of Gamo hide
workers, who insert a scraper into the split end of a straight piece of wood, securing the scraper in the open haft by
tightly wrapped cord.
The composition of mastic differs between areas, but is composed largely of hardwood resins. However,
some hide workers include sheep hair or wool in the mixture. Scrapers are used to scrape off the fatty tissue on the
inside of hides that have been dried in the sun for several days. The hides are moistened with water before they are
scraped, usually by spraying with the mouth, but in Konso one hide worker applied it with a brush. The Sidama and
Gurage only scrape cattle hides, whereas the Konso and Wolayta scrape cattle, goat and occasionally wild animal
hides. Most groups keep their cores and unused and used scrapers in baskets, while debris from scraper manufacture
and retouch as well as discarded scrapers are dumped away from the living areas into pits, tree hollows or gardens
and is rarely intentionally buried. Debris is often collected into a container and periodically emptied into pits.
MATERIALS AND METHODS
Samples for DNA analysis were collected using disposable gloves and put in new plastic bags. Stone
scrapers were divided into the following categories: 1) Manufactured, defined as collected directly after observed
knapping; 2) "Unused", defined according to hide worker's reports and often stored with other supplies; 3) Known
use, defined as scrapers taken out of the handles after observed use by us; 4) Used or usable, defined according to
hide worker's reports, and stored among the hide worker's supplies or provided by the hide worker; 5) Excavated,
defined as collected from the hide workers disposal areas; 6) Surface collected, and;7) Unknown, defined as scrapers
obtained from the hide workers without any information. Three disposal pits were excavated in levels. One in
Sidama contained only lithics and had been in use for 20 years according to the hide worker. One in Gamo contained
both lithics and other household waste, such as animal bones, pottery fragments and glass, and had been in use for 3
years. The third was a Gurage pit which had been used solely for lithics, but was situated close to where cattle were
kept. Other pits containing lithics and mixed household waste in Sidama and Wolayta were sampled by shovel tests.
The majority of the samples were analyzed by B.K. at the University of Florida, and a subset by B.L.H. at Indiana
University. Some scrapers were examined by B.K. for presence of biological material under low magnification.
A brief description of the DNA analysis is given in this section, while details of the protocols for extraction
and analysis are presented in the appendix. To prevent contamination with modern DNA and cross contamination
between samples, we used standard precautions suggested for work with ancient DNA (Handt et al, 1994, Stoneking,
1995). Two different approaches were used for the determination of which species the tools had been used on. Both
involve comparisons of obtained species-specific DNA sequences with published sequences of the mitochondrial
cytochrome b gene (Irwin et al, 1991). This is the gene of choice, because it differs substantially between different
species, and has been sequenced for many mammalian species. In one approach, universal primers, capable of
amplifying all mammalian DNA were used to amplify a 116 basepair long fragment (Hardy et al 1997). In the
second, we used specific primers for a different 121 base pair long region of the gene, that preferentially amplify
bovine and caprine DNA. The latter will not amplify human DNA, which is likely to be present on the tools due to
handling by the hide workers. The DNA segment used to differentiate between species differ between goat and cow
at 9 positions when the universal primers are used, and at 12 positions for the species specific primers. The human
sequence differs from the cow sequence at 16 and 21 positions respectively. Generally only one primer was used for
sequencing, and species were determined based on a minimum of 8 diagnostic nucleotides. To ascertain that the
sequences made phylogenetic sense (Handt et al, 1994, Stoneking, 1995) a 138 base pair long segment of the
mitochondrial control region, which is the most variable part of the mitochondrial genome, was amplified for some
samples. In this region the African cattle consensus sequence differs from the Indian cattle consensus sequence at 16
positions, and from the European cattle consensus sequence at 2 positions. DNA was extracted from tools at the
University of Florida following the silica method developed by Höss and Pääbo (1991), and by guanidine
hydrochloride extraction, followed by dialysis at Indiana University (Hardy et al, 1997). Some samples contained a
potent inhibitor of PCR, and those were further purified on G-50 Sephadex (Pharmacia) spin columns. All
extractions were done in a laboratory separate from that used for subsequent analyses. PCR reactions were set up in a
dedicated biological hood which was UV-radiated before use. PCR was performed for 30-45 cycles, the amplified
products separated by gel electrophoresis and visualized by ethidium bromide staining. Controls included an
2
extraction blank for each set of samples and a no template PCR control. Samples that yielded a DNA band of the
expected size in the PCR were sequenced for subsequent species identification.
RESULTS
We attempted to extract DNA from 42 scrapers with the silica method, and extracts were subjected to PCR
using the species specific primers. Universal primers were used for 20 scrapers. The provinience, the presence of
biological material under low magnification, and the detection of mastic of the samples are given in Table 1. A
summary of the PCR and sequencing results are given in Figure 3 and Table 2.
Species specific primers
All the scrapers collected after observed use yielded PCR products corresponding to the species they were
used on, namely cattle. Figure 2B illustrates one of them. It has traces of mastic and yielded a cattle sequence. One
of the others differed at one nucleotide position from the published cattle sequence. The difference is in the third
position of a codon for asparagine, and would not change the amino-acid incorporated into the cytochrome b protein.
It is therefore likely that it is a silent mutation and a natural polymorphism.
Three out of four scrapers obtained as "unused" also yielded cattle sequences. All 3 had, however, shown
presence of biological material when examined under low magnification. One of them also had traces of mastic,
indicating that it may have been hafted. Two of the four scrapers obtained as used from the hide workers gave a PCR
product. One was sequenced as cow (Figure 2A), while the other showed a mixed sequence of cow and ovicaprid.
The latter came from Konso, where a single scraper may be used to scrape both cattle and goat hides.
Only 5 of the 20 excavated scrapers gave a PCR product. This product was of the correct length, but only 2
of them yielded enough DNA of sufficient quality to be sequenced (Figure 2C and D). One of the sequences was
from cow, the other was a mixed cow/ovicaprid sequence. The latter came from Gurage, where although only cattle
skins are scraped, one of the ingredients used in the mastic is sheep hair. One of the three scrapers of unknown
provinience yielded a cattle sequence. None of the surface collected scrapers showed any evidence for the presence
of DNA. One of the five scrapers collected directly after manufacture gave a product of the correct length after PCR.
However, when that sample was sequenced, it showed no resemblance to mammalian sequences, and part of the
sequence obtained consisted of repeated sequences of the primer that was used. It is therefore likely to be a PCR
artifact. Amplification of a segment of the mitochondrial control region for 6 samples positive for cattle showed 3
separate sequences that matched African cattle sequences (Bailey et al 1996). Sequences obtained are shown in
Table 3.
Universal primers
When universal primers were used to amplify DNA from the scrapers, no cattle or goat sequences were
obtained. However, 3 human and 3 dog sequences were found on 4 scrapers. All of the scrapers had been used, and
two had both dog and human DNA on them. One of the dog sequences was found on a scraper from Gurage, where
the hide worker had several puppies in the hide working area, while the others came from Gamo and Konso.
DISCUSSION
DNA analysis of stone tools is advantageous because it has the potential to give more specific information
on stone tool use than immunological methods used to detect protein, and it can add to information obtained from
use wear analysis. DNA analysis is also non-destructive, which preserves the tool for other future morphological
studies. In addition, the initial extraction is simple enough to do in the field. This analysis shows that it is possible to
obtain DNA of sufficient quality for species determination from stone tools. Although the scrapers used in this study
had only been discarded for a short time, 0-20 years, most degradation seems to take place shortly after cell death
(Brown and Brown, 1992), and it should may therefore be possible to isolate DNA from archaeological tools as well.
However, scrapers may not be the best tools to obtain DNA from. They are frequently resharpened during
use, thus the residues near the edge of the tool are removed until the scraper is exhausted, and only those trapped
closer to the haft remain. Tools which are not resharpened as frequently may retain more residues. For example, the
chert knives studied by Loy (1993) showed macroscopically visible deposits with embedded hair. None of the
scrapers in this study showed evidence of macroscopic remains, although most showed the presence of biological
material when examined under low, 40X, magnification. In addition, grinding stones may be good candidates for
recovery of plant DNA, as they are used for long time periods.
The DNA on the scrapers in this study is also degraded. The hides were dried in sunlight for several days
before being scraped, which will increase the probability of degradation from UV-radiation. Used scrapers are also
3
likely to have been subjected to UV-radiation, as they generally were not buried when they were discarded. Another
potential problem in analyzing DNA from scrapers is that of contamination with human DNA. All tools are, of
course, handled by their makers and users, but in addition it was found in the ethnoarchaeological study that hides
were rewetted by the hide worker swishing water in their mouths and spraying it on the hides before scraping. If this
practice also was done in prehistory, it may deposit human DNA on the hides, and consequently on the scrapers. As
the human DNA has not been subjected to UV-radiation, it is likely to be less degraded than the animal DNA, and
may be preferentially amplified in PCR analysis. This is consistent with our observation that universal primers that
amplify all mammalian DNA, preferentially yielded human DNA.
When we used species specific primers, we found that the correct species could be identified from all the
scrapers that were collected directly after observed use, and that the DNA obtained from other scrapers matched
species that were used in the area the scraper came from. However, only 25% of the excavated scrapers yielded
DNA, and only 10%, were of sufficient quality to be sequenced. As these scrapers were found in upper levels and
had been buried a relatively short time, probably less than 2 years, it is possible likely that the yield from prehistoric
tools will be even lower, limiting the information that can be obtained. In many cases it may not be practical to
attempt to extract DNA from large numbers of excavated stone tools in order to obtain a few sequences relevant to
tool use. In other cases, for example when stone tools are found without associated faunal remains, DNA analysis
may be of practical value. In addition, However, other types of tools may have more residues, and probably have less
degraded DNA at the time of use. In addition, 50% of the used scrapers that had been protected from rain and sun
light, namely those obtained from the hide workers supplies, gave analyzable DNA. This suggests that tools that have
been protected from the outside environment, such as those found in caves or structures, would have a better chance
of yielding analyzable DNA. Surface finds, on the other hand, are less likely to be good candidates for analysis.
This study also reveals a problem with analysis of DNA from stone tools. The presence of Canis familiaris
DNA on some of the scrapers in this study, one of which came from a hide worker that had puppies playing in the
area while he scraped hides, shows that universal primers may detect DNA that is not related to tool use. In this study
we were not able to detect the correct species of use on any of the tools that were analyzed with the universal
primers. Use of species specific primers diminishes this problem. However, it is necessary to have an idea of the
species the tools were used on, and this is often unknown for archaeological samples. Although the faunal remains
found at a site will give an indication of species utilized, tools may also have been used on other animal species away
from a site. In addition, hides may have been brought to one site for processing, while the carcasses were processed
at a different site. Furthermore, because it was found that some 3 of 4 unused, stored scrapers gave sequences of the
expected species of use with the species specific primers, there is a possibility that DNA obtained may be a result of
in situ contamination. However Although one of these scrapers had traces of mastic, indicating that it may have been
hafted, and possibly misidentified as "unused", the other 2 appeared unused. As none of the scrapers collected
directly after manufacture showed the presence of DNA, the source of the contamination is likely to have been used
scrapers that the hide workers stored with the unused ones. Further studies are needed to determine the extent of this
problem. The mastic composition may also influence the analysis of DNA, such as the mixed cow/ovicaprid
sequence we obtained on a tool from an area where only cattle hides were processed, but where sheep hair was used
in the mastic. A separate analysis of the mastic residues should overcome this problem.
In conclusion our ethnoarchaeological study shows that hide scraping leaves sufficient residue on tools for
reliable DNA analysis. DNA can be obtained from excavated tools, albeit in low frequencies, and from tools stored
in a protected environment. However, as our results show, tools may also yield DNA unrelated to their use, which
makes species determinations from archaeological tools problematic. It is therefore important to include other lines
of evidence in the interpretation of DNA results from residues. Microscopic use-wear and residue analysis,
taphonomy, and zooarchaeology can all aid in understanding the archaeological context more fully and make the
interpretation of DNA results more accurate.
APPENDIX
DNA was extracted at the University of Florida from scrapers following the method by Höss and Pääbo
(1993). Scrapers were placed in thick-wall plastic bags with 2 ml extraction buffer consisting of 10M guanidinium
isothiocyanate in 0.1M Tris-HCl pH 6.4 with 0.02M EDTA and 1.3% Triton X-100, heat sealed and placed on a
over night. One extraction blank was done with each set of 3-5 scrapers. The following day the suspension was
centrifuged at 10,000 g, and the silica pellet washed twice with 10M guanidinium thiocyanate in 0.1M Tris-HCl pH
6.4, twice with 70% ethanol, and once with acetone. After drying the pellet at 60 degrees Celsius for 5 minutes, the
10 mM Tris, 1 mM EDTA, pH 8 (TE) at 60 degrees Celsius. All extraction solutions
were pretreated with silica, and tested for purity by mock extractions and PCR. Samples that contained PCR
4
inhibitors were purified on Sephadex G-50 (Pharmacia, Uppsala, Sweden) spin columns. The gel was swollen in TE,
packed in Biorad (Hercules, CA) disposable columns, centrifuged at 500 rpm for 2 minutes, 30
extraction blank applied, the columns centrifuged at the same speed for 2 minutes and the eluate collected.
The specific cytochrome b primers, 5' ACAGGCCTATTCCTAGCAATA 3' and 5'
CTCCGTTTGCGTGTATGT 3', amplify a segment between positions 14,885 and 15,005 according to numbering in
Irwin et al (1991). The primers for the mitochondrial control region were 5' CCCATGCATATAAGCAAG 3' and 5'
TAAGCTCGTGATCTAATGG 3' . They amplify a segment between positions 16,024 and 16,162. Both sets of
primers were designed using the Oligo program (National Biosciences, Inc.). Final concentrations in the hot start
PCR were 20 mM Tris-HCl pH 8.4, 2.5 mM MgCl2, 0.25 mM deoxynucleic acid triphosphates (dNTP's), 0.5 units
TAQ polymerase and 200-400 nM primer. Five
Celsius was followed by 35-40 cycles with an annealing temperature of 49 or 52 degrees Celsius depending on
primer pair. A secondary PCR of 20done to obtain enough
material for sequencing. In all cases of multiple PCR, the extraction blanks and the no template control were run
concomitantly with the samples, to control for contamination. Extraction blanks and no template PCR controls did
not give any PCR products, except in 3 cases. In one of them the TAQ DNA polymerase was the source of the
contaminating DNA. In another, one aliqout of sample showed evidence of contamination, and new aliqouts used did
not give a product. The last was the result of a secondary PCR, which has a higher risk for contamination in the
laboratory. The samples that were contaminated were discarded and new extractions performed. Reaction products
were separated on a 2% agarose gel, and visualized with ethidium bromide staining.
All samples that yielded a mitochondrial amplification product were sequenced using either the USB
sequenase kit version 2 or the USB PCR sequencing kit, following the manufacturers instruction. The products were
separated on a 6% denaturing polyacrylamid gel, which was dried and exposed to X-ray film for 3-10 days.
At Indiana University, DNA was extracted by soaking the tools in 5-50 ml 4M guanidine hydrochloride,
followed by overnight dialysis against 1X Tris-EDTA buffer (Hardy et al 1997). The cytochrome b primers used in
PCR, 5' CTCCACACATCCAAACAACG 3' and 5' TGTTCGACTGGTTGTCCTCC 3' amplify a segment between
positions 15,664 and 15,780 (Irwin et al 1991). PCR reactions contained 250
degrees Celsius, products were separated on 1-1.5% agarose gels and visualized with ethidium bromide staining. A
negative control was run with each reaction. PCR products of the expected size were cloned into Invitrogen cloning
vector pCRTMII, cleaned with QIAGEN plasmid kit (QIAGEN, Inc.) and sequenced following the SEQUENASE
(U.S. Biochemicals) protocol.
ACKNOWLEDGEMENTS
We thank Dr. Kassaye Begeshaw, former head of Ethiopia's Center for Research and Conservation of the Cultural
Heritage (CRCCH), Ato Solomon Warede Kal, former director of the Ethiopian National Museum, Ato Awoke
Amzay, head of the Southern Ethiopian Peoples Administrative Region Bureau of Culture and Sports (SEPARBCS), and Ato Bidru Ahmed, head of the SEPAR-BCS Division of Culture for their administrative and logistical
support. We also thank our government field representatives, Ato Tesfaye Hailu of CRCCH, Ato Mulugetu Belay of
SEPAR-BCS, and our local SEPAR Bureau of Culture and Sports field representatives, in particular Ato Terekegn
Workneh and Ato Denote Kusia Shenkerea for their help. In addition, we thank Dr. Rudolf Raff, the Indiana Institute
for Molecular and Cellular Biology and the CRAFT Human Origins Research Center at Indiana University. We also
thank two anonymous reviewers for their helpful comments. Finally we thank Melanie Brandt for the excellent
drawings of the stone scrapers and the map. This work was supported in part by a grant from the Wenner-Gren
Foundation for Anthropological Research to SAB.
REFERENCES
Bailey, J. F., Richards, M. B., Macaulay, V. A., Colson, I. B., James, I. T., Bradley, D. G., Hedges, R. E. M. &
Sykes, B. C. (1996). Ancient DNA suggests a recent expansion of European cattle from a diverse wild
progenitor species. Proceedings of the Royal Society of London B 263,1467-1473.
Brandt, S. A. (1996). The ethnoarchaeology of flaked stone tool use in Southern Ethiopia. In (G. Pwiti & R. Soper,
Eds) Aspects of African Archaeology. Harare: University of Zimbabwe Publications, pp. 733-738.
5
Brandt, S. A., Weedman, K. J. & Hundie, G. (1996). Gurage hide working, stone tool use and social identity: an
archaeological perspective. In (G. Hudson, Ed) Essays on Gurage Language and Culture. Harrassowitz
Verlag, pp. 35-51.
Brandt, S. A. & Weedman, K. J. (1997). The ethnoarchaeology of hide working and flaked stone tool use in southern
Ethiopia. In (K. Fukui, E. Kurimoto & M. Shigeta, Eds) Ethiopia in a Broader Perspective. Volume 1.
Kyoto: Shokado Books, pp 351-361.
Brown, T. A. & Brown, K. A. (1992). Ancient DNA and the archaeologist. Antiquity 66, 10-23.
Clark, J. D. & Kurashina, H. (1981). A study of the work of a modern tanner in Ethiopia and its relevance for
archaeological interpretation. In ( R. A. Gould & m. B. Schiffer, Eds) Modern Material Culture. New York:
Academic Press, pp 303-321.
Eisele, J. (1994). Survival and detection of blood residues on stone tools. University of Nevada, Reno Department of
Anthropology Technical Report 94-1, Reno.
Evershed, R. P., & Tuross, N. (1996) Proteinaceous Material from Potsherds and Associated Soils. Journal of
archaeological Science 23, 429-436.
Fiedel, S. J. (1996). Blood from stones? Some methodological and interpretive problems in blood residue analysis.
Journal of Archaeological Science 23, 139-147.
Gaensslen, R. E., Berka, K. M., Pagliaro, E. M., Ruano, G., Messina, D. & Lee, H. C. (1994). Studies on DNA
polymorphisms in human bone and soft tissues. Analytica Chimica Acta 288, 3-16.
Gallagher, J. P. (1977). Contemporary stone tools in Ethiopia: implications for archaeology. Journal of Field
Archaeology 4, 408-414.
Goulubinoff, P., Pääbo, S. & Wilson, A. C. (1993). Evolution of maize inferred from sequence diversity of an Adh2
gene segment from archaeological specimens. Proceedings of the National Academy of Sciences USA 90,
1997-2001.
Haaland, R. (1987). Socio-economic differentiation in the Neolithic Sudan. B. A. R. International Series 350, pp. 6669 and 138-141.
Handt, O., Höss, M., Krings, M. & Pääbo, S. (1994). Ancient DNA :
methodological challenges. Experentia 50, 524-529.
Hardy, B. L., Raman, V. & Raff, R. A. (1997). Recovery of DNA from Middle Paleolithic stone tools. Journal of
Archaeological Science 24(7), 601-611.
Hardy, C., Callou, C., Vigne, J. D., Casane, D., Dennebouy, N., Mounolou, J.-C. & Monnerot, M. (1995). Rabbit
mitochondrial DNA diversity from prehistoric to modern times. Journal of Molecular Evolution 40, 227237.
Hauswirth, W. W., Dickel, C. D., Rowold, D. J. & Hauswirth, M. A. (1994). Inter- and intrapopulation studies of
ancient humans. Experentia 50, 585-591.
Höss, M. & Pääbo, S. (1993). DNA extraction from Pleistocene bones by a silica-based purification method. Nucleic
Acids Research 21(16), 3913-3914.
Irwin. D. M., Kocher, T. D. & Wilson, A. C. (1991). Evolution of the cytochrome b gene of mammals. Journal of
Molecular Evolution 32, 128-144.
Kooyman, B., Newman, M. E. & Ceri, H. (1992). Verifying the reliability of blood residue analysis on
archaeological tools. Journal of Archaeological Science 19, 265-269.
Krings, M., Stone, A., Schmitz, R. W., Kreinitzki, H., Stoneking, M. & Pääbo, S. (1997). Neanderthal DNA
sequences and the origin of modern humans. Cell 90, 19-30.
Loy, T. H. (1993). The artifact as a site: an example of the biomolecular analysis of organic residues on prehistoric
tools. World Archaeology 25 (1), 44-63.
Loy, T. H. & Hardy, B. L. (1992). Blood residue analysis of 90,000 year-old stone tools from Tabun Cave, Israel.
Antiquity 66, 24-35.
Loy, T. H. & Dixon, E. J. (1998). Blood residues on fluted points from eastern Beringia. American Antiquity 63 (1),
21-46.
Stoneking, M. (1995). Ancient DNA : How do you know when you have it and what can you do with it. American
Journal of Human Genetics 57, 1259-1262.
Tuross, N. (1994). The biochemistry of ancient DNA in bone. Experentia 50, 530-535.
Tuross, N., Barnes, I. & Potts, R. (1996). Protein Identification of Blood Residues on Experimental Stone Tools.
Journal of Archaeological Science 23, 289-296.
6