The Electrophoresis of Human Hemoglobin
Linda H. Austin
Class time Two to five forty-five minute periods depending on the extent of prerequired: and post-lab activities and extensions. Allow one class period for each
of the following:

practice using digital micropipets or some other gel loading
device and pouring the gel

loading the hemoglobin samples and running the gel

Coomassie blue staining and destaining (can be done overnight)

recording and analyzing the gel results and completing the
pedigree chart

extension activity: transcription and translation of portions of the
DNA sequences for normal and sickle cell hemoglobin
Materials power supply
and
horizontal electrophoresis chamber, casting tray, comb
equipment:
digital micropipet, disposable tips, or some other implement to load the
gel
staining dish, disposable gloves
running buffer (1X Tris-Glycine)
1.5% molten agarose
samples containing normal adult hemoglobin, sickle hemoglobin, and a
mixture of the two types
Coomassie blue stain
destaining solution
Summary In this activity, students are presented with a scenario that requires them
of activity: to electrophorese human hemoglobin samples in order to confirm a
diagnosis of sickle cell anemia and/or to determine whether individuals
in the scenario are carriers of the sickle cell allele. Students will be
asked to analyze the separation of the different types of hemoglobin on
the gel. From this analysis, they will be able to determine the
alleles/genotypes of individuals in a pedigree chart. As an extension of
the activity, students can be asked to transcribe and translate portions of
the DNA sequences for the two alleles. Also as an extension, students
can be presented with questions about how the Hardy-Weinberg
equation applies to the alleles for normal and sickle hemoglobin in
human populations.
Some understanding of Mendelian genetics is essential. The alleles for
Prior
knowledge, human hemoglobin are codominant. In this activity, students are asked
concepts or to interpret the results on the gel and use the information to construct a
vocabulary pedigree chart. Students need to understand the principles of
necessary electrophoresis. Prior hands-on experience with agarose gel
electrophoresis is desirable, but not necessary because this is a "load
to
complete and run" lab; however, students will need to practice using the digital
micropipet or whatever implement is used to load the gels. If the DNA
activity:
sequence extension is selected, students will need to understand the
DNA code, transcription, and translation. Some prior knowledge is
required if the Hardy-Weinberg extension is selected.
Teacher Instructions
Hemoglobin Sample Preparation
(1) Hemoglobin can be purchased from some chemical supply companies. Most require a letter
on school letterhead explaining how the hemoglobin will be used. These blood products are
routinely screened for both AIDS and Hepatitis B, but standard precautions should be used:
GLOVES AND BLEACH CLEAN-UP. The following instructions are based on the 100 mg
size.
(2) Prepare 500 mL total volume of a 1.5M solution of Tris (Sigma #T1503), pH=9.2.
(3) Dissolve each of the hemoglobin samples in 20 mL of the 1.5M Tris, pH=9.2.
(4) PREPARE A 2X Sample Buffer by mixing the following:
glycerol (#G6279) 8.00 mL
1.5M Tris, pH=9.2 4.00 mL
deionized water 28.00 mL
bromophenol blue (#B8026) 0.01 gm
(5) Add 20 mL of 2X Sample Buffer to the dissolved HgA, mix and dispense into 5 mL aliquots.
Place in the refrigerator for short term storage (one month). For storage longer than a month,
place in a freezer (can be frozen indefinitely).
(6) Add 20 mL of 2X Sample Buffer to the dissolved HgS, mix and dispense into 5 mL aliquots.
Store appropriately. (See Step 5.)
(7) For each group of students, aliquot 20 µL of each sample. Students will load 15 µL. To
prepare the sickle trait samples, mix 10 µL of HgA and 10 µL of HgS. Student samples can be
stored for one week in a refrigerator.
Tris-Glycine Electrophoresis Buffer
(1) For each station, prepare 500 mL of Tris-glycine electrophoresis buffer by mixing the
following:
Tris base 8.0 gm
Glycine 3.6 gm
deionized water 500.0 mL
(2) The electrophoresis buffer can be stored indefinitely. Place in a refrigerator if possible.
Agarose Gels
(1) Prepare 1.5% agarose gels by mixing 1.5 gm of agarose and 100 mL of Tris-glycine buffer.
Each group of students will use approximately 30-50 mL of agarose.
(2) To dissolve the agarose, bring the mixture to a boil in a microwave oven or double boiler.
Coomassie Blue Stain
(1) Mix:
40.0% methanol
10.0% acetic acid
0.5% Coomassie blue
49.5% distilled water
Destaining Solution
(1) Mix:
10% methanol
10% acetic acid
80% distilled water
Possible scenario: Parents have brought their youngest daughter to the genetics clinic to be
tested because their family doctor suspects that her chronic health problems may be caused by
sickle cell anemia. The genetics counselor meets with the family and suggests that all members
of the family be tested. The family consists of the mother, father, two older sisters, and the
youngest daughter. By electrophoresing their hemoglobin samples, it will be possible to confirm
the diagnosis of sickle cell anemia and identify carriers of the allele. A control sample containing
both types of hemoglobin should be run on the same gel.
References:
Cahill, Holly. "An Interdisciplinary Look at Sickle Cell Anemia." Woodrow Wilson Middle
School Biology Institute, 1994.
Capra, Judy. Genetics: A Human Approach, Rev. Ed. University of Colorado Health Sciences
Center, 1983.
"The Mystery of the Crooked Cell." CityLab, Boston University School of Medicine, Boston,
Massachusetts, 1993.
Offner, Susan. "Dry Lab #2." American Biology Teacher, February 1992.
Pines, Maya. "Turning Back the Biological Clock to Cure Sickle Cell Disease." Blood: Bearer of
Life and Death. Howard Hughes Medical Institute, 1994. 18-27.
Lab No.
Date
Name
The Electrophoresis of Human Hemoglobin Molecules
INTRODUCTION: Two variants of human hemoglobin, normal and sickle cell, are examined
in this activity. In homozygous (pure) condition, two alleles for sickle cell hemoglobin result in a
serious medical condition known as sickle cell anemia. In the United States, eighty thousand
African-Americans suffer from sickle cell anemia. Two and a half million African-Americans
(8%) are carriers of the sickle cell allele. In some areas of Africa, 30% of the people are carriers
of the sickle cell allele. Such high frequencies of an otherwise harmful allele suggest some type
of selection pressure. Population studies have demonstrated a link between carrier status and
resistance to malaria.
A single dose of this gene offers some protection against malaria, which is common in Africa.
When malaria parasites invade the bloodstream, the red cells that contain defective hemoglobin
become sickled and die, trapping the parasites inside them and reducing the infection. As a
result, some 30% of the people in certain areas of Africa have the sickle cell trait (carrier status).
The trait is also widespread around the Mediterranean and in other areas where malaria used to
be a major threat to life (Pines 24).
OBJECTIVES:
Use the technique of agarose gel electrophoresis to separate human hemoglobin molecules
according to their electrical charge, size, and/or shape.
Relate the migration of hemoglobin molecules on the gel (phenotype) to the alleles possessed by
individuals in the scenario (genotypes).
MATERIALS:
In the space provided below, list the equipment and supplies that you and your partner(s) used to
perform this activity.
PROCEDURE:
(1)
(a) If your casting tray has gates, use them to close
POURING off the ends. If your tray does not have gates, use
THE GEL masking tape to dam both ends. Place the comb in
(2)
LOADING
THE GEL
(3)
RUNNING
THE GEL
(4)
STAINING
the center slots.
(b) Place the casting try where it will not be
disturbed.
(c) Pour the melted agarose gel solution to a depth
one third to one half the way up the teeth of the
comb.
(d) Do not disturb the gel for 10-15 minutes.
(a) When set, the gel will have a slightly milky
appearance.
(b) Carefully lower the gates or remove the
masking tape from both ends of the casting tray.
(c) Immerse the casting tray into the
electrophoresis chamber . Add the running buffer to
the chamber so that it just floods the surface of the
gel.
(d) Remove the comb, taking care not to tear the
wells created by the comb.
(e) Use a digital micropipet or other implement to
load 15 µL of each hemoglobin sample into
separate wells. Avoid the wells on either end
whenever possible.
(a) Close the cover on the electrophoresis chamber.
(b) Attach the leads to the power supply, red to red
and black to black.
(c) Select the appropriate channel on the power
supply and adjust the voltage to 150 volts.
(d) Every 10 minutes, turn off the power, remove
the cover from the chamber, and observe the
progress of the hemoglobin molecules through the
gel.
(e) Run the gel for 30-60 minutes at 150 volts.
NOTE: Time permitting, you may do some or all of
the steps in the staining procedure. Your teacher
THE GEL will complete the procedure.
(a) Turn the power supply off.
(b) Detach the leads from the power supply and
remove the cover from the electrophoresis
chamber.
(c) Remove the casting tray and slide the gel into
the staining dish.
(d) USE DISPOSABLE LATEX GLOVES to pour
Coomassie blue stain over the gel. NOTE:
Coomassie blue is a protein stain; in addition to
staining hemoglobin, it will also stain your skin!
(e) Stain the gel for 1 hour.
(f) Replace the stain with destaining solution. For
best results, change the destaining solution several
times. Destain the gel until the "bands" of
hemoglobin are clearly visible on the gel (1-24
hours). High school biology students.
(5)
(a) USE DISPOSABLE LATEX GLOVES to place
VIEWING the gel on a sheet of clear plastic. Observe the gel
THE GEL on a lighted surface such as an overhead projector,
slide viewer, or white light transilluminator. High
school biology students.
RESULTS:
Record the results of electrophoresis on the gel template below. Draw each of the wells that the
comb created and label each of the wells into which sample was loaded. Indicate the direction
and distance that the hemoglobin molecules migrated from each well.
+
-
ANALYSIS OF RESULTS:
Base your answers to the questions below on your analysis of the gel and on the following
information.
The samples contained two types of hemoglobin, normal and sickle cell. Both normal and sickle
cell hemoglobin have the same size molecules containing about 600 amino acid subunits.
However, there is a single amino acid substitution between the two. In normal adult hemoglobin,
the sixth amino acid in the beta chain is a negatively charged subunit. In sickle cell hemoglobin,
the sixth amino acid in the beta chain is a nonpolar amino acid having no charge.
(1) From the results shown on your gel, is the overall charge on the two types hemoglobin
molecules positive, negative, both, or neither? How do you know?
(2) From an analysis of the results, which of the samples contains only sickle cell hemoglobin?
What is your reason for choosing this one?
(3) From an analysis of the results, which of the samples contain(s) a mixture of normal and
sickle cell hemoglobin? Explain your reasoning.
(4) Construct a pedigree chart for the members of the family investigated by your group. Show
the genotype for each member of the family based on your analysis of the electrophoresis gel.
Use the genotype key below:
A = allele for normal adult hemoglobin (normal beta chain)
S = allele for sickle cell hemoglobin
References:
Pines, Maya. "Turning Back the Biological Clock to Cure Sickle Cell Disease." Blood: Bearer of
Life and Death. Howard Hughes Medical Institute, 1994. 18-27.
Human Hemoglobin Extension Activity
(1) The DNA sequence below is the beginning of the coding region for the beta chain of normal
human hemoglobin. Write the messenger RNA (mRNA) sequence that would be transcribed
from this template DNA sequence:
CACGTGGACTGAGGACTCCTC
(2) Circle the sixth codon in both the DNA and mRNA sequences.
(3) Write the amino acid sequence that would be translated from the mRNA sequence.
(4) Circle the sixth amino acid in the polypeptide.
(5) The mutation that produces sickle cell hemoglobin is a single base substitution (point
mutation) in the sixth codon. The mutation results in the replacement of a negatively charged
amino acid (glutamic acid) with a nonpolar amino acid having no charge (valine). Using the
translation table, propose point mutations in the sixth codon that would result in the substitution
of valine for glutamic acid.
(6) If the beta chain of human hemoglobin is 146 amino acids in length, calculate the minimum
number of nucleotide base pairs needed to code for beta globin.