Supplementary Figure 1: Determination of AAV2 amplification in mouse heart tissue
superinfected with Ad5. Hearts isolated from NMRI mice injected intravenously with 1011
vg of AAV2 were sectioned into organotypic culture (OTC) slices. Ad5 superinfection (108
pfu/slice) was performed directly onto heart OTC slices. Genomic DNA was extracted from
homogenized heart slices 1 h (Time 0) or 72 h (Time 72 h) after Ad5 super-infection. Serial
10-fold dilutions of extracted DNA were transferred to a nylon membrane, and amplification
of AAV2 genomes at indicated time points were analyzed by a DNA-dot blot using a repspecific probe.
Supplementary Figure 2: Enrichment of peptides displayed on AAV2 capsids after
repeated rounds of selection. Shown is the fold change in recovery versus round 1 of peptide
sequences displayed by AAV capsids after indicated rounds of in vivo selection in mice hearts
(A) or in vitro selection on primary neonatal rat cardiomyocytes (B).
Supplementary Figure 3: Recovery of selected oligonucleotide library. Oligonucleotide
inserts of the selected library were isolated by BglI restriction digest of the pCR2.1-TOPOLib plasmids and purification of the released library sequences by a QIAquick PCR column.
The selected oligonucleotide library was recovered by DNA precipitation from the column
flow-through.
Supplementary Figure 4: Quantitation of vector genomes after injection of single
vectors. Adult mice were intravenously injected with 1 x 1011 vg/mouse of wt AAV2 (n=5),
AAV9 (n=5) vectors or peptide targeted AAV2-VNSTRLP (n=5) vectors harbouring a
luciferase reporter gene under the control of the CMV promoter. Heart and liver were
harvested one month after systemic administration. Vector genomes were determined by
quantitative real-time PCR (vector genomes/µg DNA) for comparison of the different vectors
(A) and heart to liver ratios of vector genomes (B). *p<0.05: AAV2 vectors versus AAV2VNSTRLP.
Supplementary Methods
Selection of targeted AAV2 from AAV2 display peptide libraries. For in vivo screening of
AAV2 display peptide libraries 2 NMRI mice were injected with 2 x 1011 virus genomes (vg)
of a random AAV2 display peptide library
1
via the tail vein. Three days after injection, the
heart was removed, immersed in preparation medium (MEM supplemented with 1% glutamin,
Gibco, Karlsruhe, Germany), and sectioned at 300 µm thickness under a sliding vibratome
(VT1000 S - Microtome, Leica, Nussloch, Germany) at 4 °C for organotypic culture as
adapted from previously published methods
2,3
. Explanted heart slices were placed on Falcon
cell culture inserts (pore size 0.4 µm, BD, Heidelberg, Germany) in 6-well plates, fed with 1
ml of warmed culture medium 3 applied underneath. Eight organotypic heart slices were then
super-infected with adenovirus type 5 (Ad5) at a multiplicity of infection (MOI) of 108 plaque
forming units (pfu) per slice and kept in culture at 37 °C with 5% CO2. The culture medium
was changed, every 2 days. To evaluate the viability of OTC slices, we stained control heart
slices with propidium iodide (PI) after 4 days in culture. Heart tissue remained highly viable
in the slice culture as only few non-viable patterns indicated by positive red fluorescence were
detected (data not shown). At 4 days of culture, genomic DNA was extrated from
homogenized heart slices using the DNeasy tissue kit (Qiagen, Hilden, Germany). Eight
hundred ng genomic DNA served as template for polymerase chain reaction (PCR)
amplification
of
the
internalized
peptide
ACCTCCAGAGAGGCCAGAGAGGC-3’)
library
and
region
using
reverse
forward
(5’
(5’-
ATCTGCGGTGGCCGCCTGGGC-3’) primers (hereafter referred to TOPO primers), with 2
different BglI sites, flanking the 5’ and 3’ ends of the selected peptide inserts. The PCR
product was then cloned into the plasmid pCR2.1 using the TOPO-TA cloning kit (Invitrogen,
Karlsruhe, Germany) (supplementary Figure 3). Ligated plasmids were transformed into
TOP10 competent E.coli. A small portion of precultured bacteria was transferred to ampicillin
supplemented agar plates and randomly assigned positive clones were sequenced using the
primer 5’ -AGGAAACAGCTATGACCATG-3’. The rest of the preculture was pooled and
grown overnight for plasmid purification using a Maxiprep column (Qiagen). The resulting
plasmid preparation (designated as pCR2.1-TOPO-Lib), containing the PCR amplified
selected library sequences, was digested with BglI and released library sequences were
purified using the QIAquick PCR purification kit (Qiagen). Larger fragments remained in the
column, whereas the flow-through contained the 33 bp of library inserts. These were then
recovered by DNA precipitation and cloned in an oriented fashion into the SfiI digested
pMT187-0-3 backbone plasmid 4. This plasmid library was used to reconstruct the selected
virus library through an improved three-step production protocol as described previously 1.
The newly generated pre-selected AAV library was subjected to a next round of in vivo
screening. The entire screening process was done in 2 animals for each round.
Primary neonatal rat cardiomyocytes were generated and maintained in DMEM-high glucose
with 10% FCS as previously described
5
. To start bio-panning, 1 x 106 primary
cardiomyocytes at 70% confluence were infected with a random AAV2 display peptide library
with 10,000 capsids/cell. After 4 h, cells were washed with PBS, followed by super-infection
of Ad5 with 20 pfu/cell. When approximately 50% of the cells showed a cytopathic effect
(after 3-5 days) replicated AAV particles were harvested from cell lysates by 3 freeze-thaw
cycles and capsid titer was determined. For each subsequent selection round, pre-selected
viruses recovered from the preceding screening round were re-applied to target cells at a 5fold lower MOI.
PCR analysis of transduced genomes. To monitor the gene transfer into different tissues by
targeted or non-targeted capsids, respectively, 800 ng of extracted genome DNA was used for
PCR amplification of viral DNA comprising the oligonucleotide modified cap gene section
(to
detect
the
targeted
gene
transfer),
using
the
primers
5’
-
GGTTCTCATCTTTGGGAAGCAAG-3’ and 5’ -TGATGAGAATCTGTGGAGGAG-3’, or
for amplification of a fragment of the luciferase gene (to detect the non-targeted gene
transfer), using the luciferase primers 5’ -GACGCCAAAAACATAAAGAAAG-3’ and 5’ CCAAAAATAGGATCTCTGGC-3’. A region of the murine ß-actin gene was amplified as
reference for DNA integrity, using the primers 5’ -ATGTTTGAGACCTTCAACAC-3’ and 5’
-AACGTCACACTTCATGATGG-3’. PCR products were analyzed by agarose gel
electrophoresis. In parallel, we employed Taqman quantitative real-time PCR (QR-PCR) to
measure the accurate amount of viral DNA delivered into different tissues by targeted or nontargeted AAV2 capsids, respectively. Gene transfer by targeted capsids was quantified using a
designed
“Rep“-primer/probe
set:
AAGTCCTCGGCCCAGATAGAC
(F)/
CAATCACGGCGCACATGT (R); 6-fam-TGATCGTCACCTCCAACA-MGB.Gene transfer
by non-targeted capsids into the same tissue was quantified using a “CMV“-primer/probe set:
TGC CCA GTA CAT GAC CTT ATG G (F)/ GAA ATC CCC GTG AGT CAA ACC (R); 6fam-AGT CAT CGC TAT TAC CAT GG-MGB.Two hundred ng of extracted DNA served as
template for QR-PCR under the conditions previously described 6. Products were evaluated
with Taqman data analysis software (Applied Biosystems, Darmstadt, Germany).
Determination of AAV2 amplification in mouse heart tissue super-infected with Ad5. To
validate the amplification of AAV2 in the mouse OTC heart slices super-infetced with Ad5,
NMRI mice were intravenously injected with 1011gp of AAV2. Three days after injection,
hearts were isolated and sectioned into slices of 300 μm thickness for organotypic culture.
Explanted heart slices from AAV2 injected mice were super-infected with Ad5 at a MOI of
108 pfu/slice and incubated at 37°C with 5% CO2. 1 h (Time 0) or 72h (Time 72h) after ad5
super-infection, OTC heart slices were washed twice with PBS. Genomic DNA was then
extracted from the homogenized heart slices for DNA dot-blot analysis. 2 μg of extracted
genomic DNA was serially 10-fold diluted in 0.4 M NaOH/10 mM EDTA and transferred to a
nylon membrane. To detect the immobilized AAV2 genome, a α-32P labelled rep-specific
probe was hybridized to the target DNA and visualized by autoradiography.
References
1.
Waterkamp DA, Muller OJ, Ying Y, Trepel M, Kleinschmidt JA. Isolation of targeted
AAV2 vectors from novel virus display libraries. J Gene Med 2006; 8: 1307-1319.
2.
Stoppini L, Buchs PA, Muller D. A simple method for organotypic cultures of nervous
tissue. J Neurosci Methods 1991; 37: 173-182.
3.
Hailer NP, Heppner FL, Haas D, Nitsch R. Astrocytic factors deactivate antigen
presenting cells that invade the central nervous system. Brain Pathol 1998; 8: 459474.
4.
Muller OJ, Kaul F, Weitzman MD, Pasqualini R, Arap W, Kleinschmidt JA et al.
Random peptide libraries displayed on adeno-associated virus to select for targeted
gene therapy vectors. Nat Biotechnol 2003; 21: 1040-1046.
5.
Rohrer DK, Hartong R, Dillmann WH. Influence of thyroid hormone and retinoic acid
on slow sarcoplasmic reticulum Ca2+ ATPase and myosin heavy chain alpha gene
expression in cardiac myocytes. Delineation of cis-active DNA elements that confer
responsiveness to thyroid hormone but not to retinoic acid. J Biol Chem 1991; 266:
8638-8646.
6.
Veldwijk MR, Topaly J, Laufs S, Hengge UR, Wenz F, Zeller WJ et al. Development
and optimization of a real-time quantitative PCR-based method for the titration of
AAV-2 vector stocks. Mol Ther 2002; 6: 272-278.